Sphingosine 1-Phosphate Modulates Spinal Nociceptive Processing
2008; Elsevier BV; Volume: 283; Issue: 47 Linguagem: Inglês
10.1074/jbc.m806410200
ISSN1083-351X
AutoresOvidiu Coste, Christian Brenneis, Bona Linke, Sandra Pierre, Christian Maeurer, Wiebke Becker, Helmut Schmidt, Wei Gao, Gerd Geißlinger, Klaus Scholich,
Tópico(s)Pain Mechanisms and Treatments
ResumoSphingosine 1-Phosphate (S1P) modulates various cellular functions such as apoptosis, cell differentiation, and migration. Although S1P is an abundant signaling molecule in the central nervous system, very little is known about its influence on neuronal functions. We found that S1P concentrations were selectively decreased in the cerebrospinal fluid of adult rats in an acute and an inflammatory pain model. Pharmacological inhibition of sphingosine kinases (SPHK) decreased basal pain thresholds and SphK2 knock-out mice, but not SphK1 knock-out mice, had a significant decrease in withdrawal latency. Intrathecal application of S1P or sphinganine 1-phosphate (dihydro-S1P) reduced the pain-related (nociceptive) behavior in the formalin assay. S1P and dihydro-S1P inhibited cyclic AMP (cAMP) synthesis, a key second messenger of spinal nociceptive processing, in spinal cord neurons. By combining fluorescence resonance energy transfer (FRET)-based cAMP measurements with Multi Epitope Ligand Cartography (MELC), we showed that S1P decreased cAMP synthesis in excitatory dorsal horn neurons. Accordingly, intrathecal application of dihydro-S1P abolished the cAMP-dependent phosphorylation of NMDA receptors in the outer laminae of the spinal cord. Taken together, the data show that S1P modulates spinal nociceptive processing through inhibition of neuronal cAMP synthesis. Sphingosine 1-Phosphate (S1P) modulates various cellular functions such as apoptosis, cell differentiation, and migration. Although S1P is an abundant signaling molecule in the central nervous system, very little is known about its influence on neuronal functions. We found that S1P concentrations were selectively decreased in the cerebrospinal fluid of adult rats in an acute and an inflammatory pain model. Pharmacological inhibition of sphingosine kinases (SPHK) decreased basal pain thresholds and SphK2 knock-out mice, but not SphK1 knock-out mice, had a significant decrease in withdrawal latency. Intrathecal application of S1P or sphinganine 1-phosphate (dihydro-S1P) reduced the pain-related (nociceptive) behavior in the formalin assay. S1P and dihydro-S1P inhibited cyclic AMP (cAMP) synthesis, a key second messenger of spinal nociceptive processing, in spinal cord neurons. By combining fluorescence resonance energy transfer (FRET)-based cAMP measurements with Multi Epitope Ligand Cartography (MELC), we showed that S1P decreased cAMP synthesis in excitatory dorsal horn neurons. Accordingly, intrathecal application of dihydro-S1P abolished the cAMP-dependent phosphorylation of NMDA receptors in the outer laminae of the spinal cord. Taken together, the data show that S1P modulates spinal nociceptive processing through inhibition of neuronal cAMP synthesis. The bioactive sphingolipid metabolite sphingosine 1-phosphate (S1P) 2The abbreviations used are: S1P, sphingosine 1-phosphate; FRET, fluorescence resonance energy transfer; MELC, multi epitope ligand cartography; PBS, phosphate-buffered saline; SPHK, sphingosine kinases; NNDS, N,N-dimethylsphingosine; DHS, dl-threo-dihydrosphingosine; IBMX, 3-isobutyl-1-methylxanthine; NMDA, N-methyl-d-aspartate; dihydro-S1P, sphinganine 1-phosphate; RT, reverse transcription; FITC, fluorescein isothiocyanate. 2The abbreviations used are: S1P, sphingosine 1-phosphate; FRET, fluorescence resonance energy transfer; MELC, multi epitope ligand cartography; PBS, phosphate-buffered saline; SPHK, sphingosine kinases; NNDS, N,N-dimethylsphingosine; DHS, dl-threo-dihydrosphingosine; IBMX, 3-isobutyl-1-methylxanthine; NMDA, N-methyl-d-aspartate; dihydro-S1P, sphinganine 1-phosphate; RT, reverse transcription; FITC, fluorescein isothiocyanate. is synthesized by phosphorylation of sphingosine by sphingosine kinases (SPHK) in a wide variety of cell types in response to extracellular stimuli such as nerve growth factor or vascular endothelial growth factor. S1P modulates diverse cellular functions such as apoptosis, cell differentiation, and migration either through the activation of a family of five G-protein-coupled receptors (S1P1–5) or by acting as an intracellular second messenger (1Saba J.D. Hla T. Circ. Res. 2004; 94: 724-734Crossref PubMed Scopus (224) Google Scholar, 2Anliker B. Chun J. J. Biol. Chem. 2004; 279: 20555-20558Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar, 3Spiegel S. Milstien S. Nat. Rev. Mol. Cell. Biol. 2003; 4: 397-407Crossref PubMed Scopus (1733) Google Scholar). In the central nervous system S1P has been shown to be released by cerebellar granule cells and astrocytes (4Anelli V. Bassi R. Tettamanti G. Viani P. Riboni L. J. Neurochem. 2005; 92: 1204-1215Crossref PubMed Scopus (97) Google Scholar, 5Edsall L.C. Spiegel S. Anal. Biochem. 1999; 272: 80-86Crossref PubMed Scopus (163) Google Scholar, 6Murata N. Sato K. Kon J. Tomura H. Okajima F. Anal. Biochem. 2000; 282: 115-120Crossref PubMed Scopus (91) Google Scholar). Regarding its function in the central nervous system it is well known that S1P promotes survival of neurons and astrocytes, induces proliferation of neural progenitor cells and astrocytes, and mediates nerve growth factor (NGF)-stimulated neurite outgrowth (2Anliker B. Chun J. J. Biol. Chem. 2004; 279: 20555-20558Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar, 3Spiegel S. Milstien S. Nat. Rev. Mol. Cell. Biol. 2003; 4: 397-407Crossref PubMed Scopus (1733) Google Scholar, 7Colombaioni L. Garcia-Gil M. Brain Res. Brain Res. Rev. 2004; 46: 328-355Crossref PubMed Scopus (112) Google Scholar). However, very little is known about the role of S1P in the regulation of neuronal excitability and the mechanisms that mediate these S1P functions. Recently whole cell patch clamp recordings revealed that loss of S1P2 leads to a large increase in the excitability of neocortical pyramidal neurons (8MacLennan A.J. Carney P.R. Zhu W.J. Chaves A.H. Garcia J. Grimes J.R. Anderson K.J. Roper S.N. Lee N. Eur. J. Neurosci. 2001; 14: 203-209Crossref PubMed Google Scholar), suggesting an inhibitory effect of S1P2 on neuronal excitability. On the other hand, several in vitro studies show that S1P can also increase neuronal functions. For example, S1P receptor activation augments glutamate secretion in hippocampal neurons (9Kajimoto T. Okada T. Yu H. Goparaju S.K. Jahangeer S. Nakamura S. Mol. Cell. Biol. 2007; 27: 3429-3440Crossref PubMed Scopus (108) Google Scholar) and elevated intracellular S1P concentrations enhance the spontaneous neurotransmitter release at neuromuscular junctions (10Brailoiu E. Cooper R.L. Dun N.J. Br. J. Pharmacol. 2002; 136: 1093-1097Crossref PubMed Scopus (27) Google Scholar). Furthermore, intra- as well as extracellularly applied S1P facilitated the NGF-induced increases in the excitability of sensory neurons from dorsal root ganglia (DRG) (11Zhang Y.H. Fehrenbacher J.C. Vasko M.R. Nicol G.D. J. Neurophysiol. 2006; 96: 1042-1052Crossref PubMed Scopus (69) Google Scholar, 12Zhang Y.H. Vasko M.R. Nicol G.D. J. Physiol. 2006; 575: 101-113Crossref PubMed Scopus (62) Google Scholar).However, to date little is known about physiological processes in which regulation of neuronal functions by S1P may play a role. Recently we showed that intrathecal administration of the S1P receptor agonist FTY720 reduces the nociceptive behavior in the formalin assay, demonstrating an antinociceptive effect of S1P receptor activation in the spinal cord (13Coste O. Pierre S. Marian C. Brenneis C. Angioni C. Schmidt H. Popp L. Geisslinger G. Scholich K. J. Cell Mol. Med. 2007; 12: 995-1004Crossref Scopus (36) Google Scholar).Here, we investigated in vivo the role of S1P in the spinal cord on pain perception (nociception). We show that peripheral nociceptive stimulation decreases S1P concentrations in the cerebrospinal fluid and that inhibition of spinal S1P synthesis lowers pain thresholds. Moreover, elevated spinal S1P concentrations reduced the nociceptive behavior in the formalin test. Toward the mechanism of the antinociceptive actions of S1P, we found that S1P decreases the cAMP synthesis in excitatory spinal cord neurons and prevents the cAMP-dependent phosphorylation of NMDA receptors in the outer laminae of the dorsal horn. These data present for the first time in vivo evidence that S1P is involved in nociceptive processing and modulated neuronal cAMP synthesis.EXPERIMENTAL PROCEDURESMaterials—S1P was purchased from Tocris (Ellisville, MO). N,N-Dimethylsphingosine (NNDS), dl-threo-dihydrosphingosine (DHS), and sphinganine 1-phosphate from Sigma.Antibodies—Antibodies used were directed against SPHK-1 (Orbigen, San Diego, CA), SPHK-2 (Abgent, San Diego, CA), nuclear neuronal protein (NeuN), CD146, glial fibrillary acid protein (GFAP) (all Chemicon, Temecula, CA), VGLUT-1 and-2 (Synaptic Systems, Göttingen, Germany), CD56 (neural cell adhesion molecule, N-CAM), 7-Amino Actinomycin D (7AAD) (both BD Pharmingen, San Jose, CA), IBA-1 (Wako, Richmond, VA), phospho897-NR1, and ATP synthase (Upstate-Millipore, Eschborn, Germany), phospho-T286 CamKII (Promega, Madison, WI) FITC-conjugated Griffonia simplicifolia isolectin B4 (IB4), FITC-conjugated phalloidin (both Sigma). Primary antibodies against S1P1–5 were generated by immunization of rabbits with the following peptides: S1P1-CRLTFRKNISKASRS, S1P2-ETLDMGETPSRKVAC, S1P3-CLAGRLRDPPEGSTL, S1P4-CLRPRDSFRTSRSLS, S1P5-CNARRLRAGPGSRRA by Sigma using their standard protocol.Animals—Sprague-Dawley rats (250–300 g) were supplied by Charles River Wiga GmbH (Sulzfeld, Germany). In all experiments the ethics guidelines for investigations in conscious animals were obeyed and the procedures were approved by the local Ethics Committee. SPHK-1 and SPHK-2 knock-out mice were kindly supplied by Novartis, Switzerland (14Zemann B. Kinzel B. Muller M. Reuschel R. Mechtcheriakova D. Urtz N. Bornancin F. Baumruker T. Billich A. Blood. 2006; 107: 1454-1458Crossref PubMed Scopus (239) Google Scholar).RT-PCR—2 μg of total RNA from rat spinal cord was annealed with 0.6 μm oligo(dT) primer and reversely transcribed using reverse transcriptase (Promega, Madison, WI) for 30 min at 37 °C. Rat-specific oligonucleotides are based on the primers used for the amplification of human S1P receptors as published previously (15Hornuss C. Hammermann R. Fuhrmann M. Juergens U.R. Racke K. Eur. J. Pharmacol. 2001; 429: 303-308Crossref PubMed Scopus (41) Google Scholar, 16Ehnert C. Tegeder I. Pierre S. Birod K. Nguyen H.V. Schmidtko A. Geisslinger G. Scholich K. J. Neurochem. 2004; 88: 948-957Crossref PubMed Scopus (32) Google Scholar): (primer S1P1, CTTCAGCCTCCTTGCTATCG and GCAGGCAATGAAGACGACACTCA; S1P2, TTCTGGTGCTAATCGCAGTG and GAGCAGAGAGTTGAGGGTGG; S1P3, TCAGGGAGGGCAGTATGTTC and CTGACTCTTGAAGAGGATGG; S1P4, GTGCTCAACTCAGCCATCAA and CTGCCAAACATTCATCATGG; and S1P5, TGTTCCTGCTCCTGGGTAGT and GTTTCGGTTGGTGAAGGTGT).Sphingolipid Concentrations in the Cerebrospinal Fluid—Sphingolipid concentrations in the cerebrospinal fluid were determined without prior extraction by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). HPLC analysis was done under gradient conditions using a Luna C18-column (150 cm long × 2 mm ID, Phenomenex, Aschaffenburg, Germany). MS/MS analyses were performed on a 4000 Q TRAP triple quadrupole mass spectrometer with a Turbo V source (Applied Biosystems, Darmstadt, Germany) as described previously (17Schmidt H. Schmidt R. Geisslinger G. Prostaglandins Other Lipid Mediat. 2006; 81: 162-170Crossref PubMed Scopus (52) Google Scholar). Concentrations of the calibration standards, quality controls, and samples were evaluated by Analyst software 1.4 (Applied Biosystems, Darmstadt, Germany). The coefficient of correlation for all measured sequences was at least 0.99. Variations in accuracy and intra-day and inter-day precision (n = 6 for each concentration, respectively) were <15% over the range of calibration.Behavioral Tests—Implantation of lumbar catheters was performed as described previously (18Hofacker A. Coste O. Nguyen H.V. Marian C. Scholich K. Geisslinger G. J. Neurosci. 2005; 25: 9005-9009Crossref PubMed Scopus (17) Google Scholar) with the exception that polyethylene catheters (0.28-mm inner diameter, 0.61 mm outer diameter, Neolab, Heidelberg, Germany) were used. The formalin assay (18Hofacker A. Coste O. Nguyen H.V. Marian C. Scholich K. Geisslinger G. J. Neurosci. 2005; 25: 9005-9009Crossref PubMed Scopus (17) Google Scholar), and the hot plate test (19Tegeder I. Del Turco D. Schmidtko A. Sausbier M. Feil R. Hofmann F. Deller T. Ruth P. Geisslinger G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 3253-3257Crossref PubMed Scopus (84) Google Scholar) were performed as described previously. The observer was unaware of the treatments in all tests.Primary Cell Cultures—Whole spinal cords or brains were collected from embryos 16 to 18 days postcoitus and directly transferred into ice-cold HBSS containing CaCl2 and MgCl2 as described previously (20Brenneis C. Maier T.J. Schmidt R. Hofacker A. Zulauf L. Jakobsson P.J. Scholich K. Geisslinger G. Faseb J. 2006; 20: 1352-1360Crossref PubMed Scopus (68) Google Scholar). Briefly, the spinal cords were treated with trypsin-EDTA and collagenase (500 units/ml, Biochrom AG, Germany) followed by mechanical separation. To obtain neuronal cultures, the cell suspension was plated on poly-l-lysine-coated dishes and incubated for 2 h in neurobasal medium containing B-27 supplement, 10% fetal calf serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 mm l-glutamine (all from Invitrogen, Carlsbad, CA). After the cells became adherent, the medium was replaced and 0.01 μg/ml murine nerve growth factor (Invitrogen, Carlsbad, CA) was added. After 24 h, the medium was replaced by serum-free medium and incubated for another 6 days until the cAMP assays were performed. To generate glia cultures the cell suspension was cultivated in RPMI 1640, 10% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. The cells were grown for at least 7 days and split at least twice.cAMP Accumulation—cAMP amounts in primary spinal cord cells were determined as described previously (21Pierre S.C. Hausler J. Birod K. Geisslinger G. Scholich K. EMBO J. 2004; 23: 3031-3040Crossref PubMed Scopus (46) Google Scholar). For cAMP accumulation assays with freshly dissociated adult spinal cords, the dorsal half of the spinal cord from an adult rat was treated with 5 ml of 0.1% collagenase in neurobasal medium containing B27 for 45 min at 37 °C and then mechanically dissociated. Remaining tissue was allowed to sediment for 1 min before the supernatant was centrifuged for 5 min at 90 × g. The cells were washed twice with medium and then used for cAMP determinations.FRET Imaging—Primary spinal cord cell cultures were plated on poly-l-lysine coated, photoetched coverslips (Dunn Labortechnik, Asbach, Germany) and transfected with pcDNA-CAT-CFP and pcDNA-RII-L20-YFP constructs (22Lissandron V. Terrin A. Collini M. D'Alfonso L. Chirico G. Pantano S. Zaccolo M. J. Mol. Biol. 2005; 354: 546-555Crossref PubMed Scopus (63) Google Scholar) using Effectene Transfection Reagent (Qiagen, Monheim, Germany) 24–72 h after plating. FRET imaging experiments were performed 48–96 h after transfection. Cells were maintained in Hepes-buffered Ringer-modified saline containing 136 mm NaCl, 5,4 mm KCl, 0,33 mm NaH2PO4, 1 mm MgCl4, 10 mm glucose, 1,8 mm CaCl2, and 10 mm Hepes, pH 7.2, at room temperature (20–22 °C) and imaged on an Axioscope 2 upright microscope (Zeiss, Jena, Germany) with a ×63 Achroplan water immersion objective (Zeiss). The microscope was equipped with an Imago CCD camera, a Polychrome IV monochromator (all TILL Photonics, Gräfelfing, Germany), and a beam-splitter optical device (Multispec Microimager, Optical Insights). Images were acquired and processed using Tillvision software. FRET changes were measured as changes in the background-subtracted 480/545 nm fluorescence emission intensities on excitation at 430 nm and expressed as R/R0, where R is the ratio at time t and R0 is the ratio at time, 0 s. FRET signals were averaged over 20 s, and the calculation of statistical descriptions and best-fit were achieved using Sigma Plot 8.0. Cells were incubated with 50 μm 3-isobutyl-1-methylxanthine (IBMX) and 25 μm forskolin and where indicated with 3 μm S1P. Phase contrast images of cells of interest and the square identification numbers of the photoetched coverslips were recorded to permit later identification of the cells in the MELC system.Calcium Imaging—Calcium imaging experiments were performed with primary spinal cord neuronal cells (described under primary cell culture) plated on poly-l-lysine-coated, photoetched coverslips for 3–6 days in culture. Prior to the determination of intracellular calcium levels ([Ca2+]i), cells were incubated with 10 μm of the ratiomeric calcium indicator Fura-2 AM (Biotium, Hayward) in Neurobasal medium (Invitrogen) for 30 min at 37 °C and 5% CO2. Fura-2 loaded cells were washed twice with Neurobasal medium and transferred to the perfusion chamber (same setup as described under FRET imaging) and imaged with a ×40 Achroplan water immersion objective (Zeiss) at room temperature. [Ca2+]i was expressed as the ratio of the background-subtracted fluorescence emission at 510 nm (filter type LP 440) due to excitation at 340 nm and 380 nm using the Polychrom IV Monochromator (Till Photonics). Cells were first stimulated with 40 mm KCL-Ringer for 1 s by puff application prior to S1P application.MELC—MELC robot technology involved validated distinct hardware and software components, as described earlier (23Friedenberger M. Bode M. Krusche A. Schubert W. Nat. Protoc. 2007; 2: 2285-2294Crossref PubMed Scopus (64) Google Scholar, 24Schubert W. Bonnekoh B. Pommer A.J. Philipsen L. Bockelmann R. Malykh Y. Gollnick H. Friedenberger M. Bode M. Dress A.W. Nat. Biotechnol. 2006; 24: 1270-1278Crossref PubMed Scopus (324) Google Scholar). After FRET imaging, cells of interest were localized using the square identification number of the coverslips, the YFP fluorescence and the phase contrast images. The primary spinal cord cells were fixed with 4% paraformaldehyde/PBS for 10 min, incubated for 10 min with 6 m guanidinium-HCl to remove YFP fluorescence, and fixed again with 4% paraformaldehyde/PBS. Then the cells were permeabilized with 0.2% Triton X-100 for 10 min and incubated with normal goat serum (10%) for 60 min. The coverslip was placed onto a customized sample holder (2-mm thickness, inner diameter of 16 mm) and fixed with an adapted silicon ring (outer diameter 2 cm, inner diameter 1 cm) that also served as antibody incubation chamber. The sample was positioned onto the inverted fluorescence microscope (Leica DM IRE2; ×63 oil objective lens). By a robotic pipetting process, the specimen was incubated with fluorophore-labeled antibodies and wash solutions under temperature control. Phase contrast and fluorescence signals were recorded, followed by a bleaching step (488 nm for FITC and 546 nm for phycoerythrin). A postbleaching image was taken and subtracted from the image taken from the following epitope. Antibody labeling with FITC was performed as described previously (23Friedenberger M. Bode M. Krusche A. Schubert W. Nat. Protoc. 2007; 2: 2285-2294Crossref PubMed Scopus (64) Google Scholar, 24Schubert W. Bonnekoh B. Pommer A.J. Philipsen L. Bockelmann R. Malykh Y. Gollnick H. Friedenberger M. Bode M. Dress A.W. Nat. Biotechnol. 2006; 24: 1270-1278Crossref PubMed Scopus (324) Google Scholar) and signals were validated using conventional immunohistochemistry. Recording and processing of all image data and the coordination of all system components were fully automatically controlled by software developed by MelTec GmbH (Magdeburg, Germany).Conventional Immunohistochemistry—Cells as well as tissue slices were fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized in 0.1% Triton X-100 for 5 min and blocked for 1 h in 3% bovine serum albumin in PBS. Primary and secondary antibody incubations were done in PBS containing 1% bovine serum albumin for 1 h each. The samples were washed 3× with PBS prior mounting. For analysis a Nikon Eclipse C600 fluorescence microscope (Nikon, Duesseldorf, Germany) was used. Quantification of antibody signals on spinal cord slices was done using ImageJ 1.39 (NIH) software. For each image the mean integrated density for the outer lamina II of the dorsal horn was determined according to IB4 staining and background corrected. Values for each spinal cord were acquired using 3–4 different slices and averaged.Data Analysis—The statistical analysis was performed using the Student's t test, and p values of less than 0.05 were considered to be significant.RESULTSSpinal S1P Concentrations Are Selectively Decreased after Peripheral Nociceptive Stimulation and Modulate Pain Thresholds—First, we determined the expression of SPHK-1 and −2 as well as the expression of the S1P receptors S1P1–5 in the adult spinal cord. Both, SPHK-1 and SPHK-2, were detected by Western blot analysis in spinal cord lysates (Fig. 1A). The mRNA of all five S1P receptors (S1P1–5) was detected by RT-PCR (Fig. 1B) in the spinal cord of adult rats, and the expression of the respective proteins was confirmed by Western blot analysis (Fig. 1C).S1P itself as well as sphingosine and five ceramides were detectable by LC-MS/MS in the cerebrospinal fluid of naive adult animals (Fig. 2, A and B). To investigate the effect of nociceptive stimulation on spinal S1P concentrations we employed two commonly used pain models. In the formalin model for acute pain, formalin is injected into one hind paw and the nociceptive behavior is recorded during one hour. In the second model zymosan is injected into one hind paw and the development of hyperalgesia is monitored over 8 h. We found that S1P concentrations in the cerebrospinal fluid were significantly reduced in both pain models (Fig. 2A) while the concentrations of all other detectable sphingolipids were not significantly altered (Fig. 2B).FIGURE 2Spinal S1P concentrations after nociceptive stimulation and influence pain thresholds. A, S1P concentrations in the cerebrospinal fluid of untreated rats (control) and after formalin or zymosan injection. Data are presented as the mean ± S.E. of 4–7 animals. Two-tailed Student's t test: *, p < 0.03; **, p < 0.005; ***, p < 0.0005 compared with control animals. B, same as A except that the concentrations of other sphingolipids than S1P are listed. Nondetectable sphingolipids were: sphinganine, dihydro-S1P, C2-, C4-, C6-, C8-, C10-, C12-, C14-, C18:1-ceramid (Cer.). C, adult rats were given intrathecally 10 μl of the SPHK inhibitors NNDS and DHS or saline containing 3 or 0.3% DMSO 90 min prior determining pain thresholds using the hot plate assay. Two-tailed Student's t test: *, p < 0.05. D, pain thresholds of SPHK-1 and −2 knock-out mice as well as wild-type mice were determined using the hot plate assay (D). Data are presented as change in the withdrawal latencies compared with baseline measurements. Data are presented as the mean ± S.E. of 5–9 animals. Two-tailed Student's t test: *, p < 0.05 as compared with wild-type animals.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Because in both pain models the S1P concentration in the cerebrospinal fluid decreased after nociceptive stimulation, we investigated whether a reduction of S1P synthesis facilitates the transmission of nociceptive signals. To reduce spinal S1P synthesis we intrathecally administered the SPHK inhibitors NNDS and DHS. Because of the fact that peripheral nociceptive stimulation alone decreases spinal S1P concentrations, we chose to determine the influence of the SPHK inhibitors on basal pain thresholds. 90 min after intrathecal application of NNDS or DHS, the rats exhibited significantly lower pain thresholds in the hot plate test as compared with control animals that received the respective vehicle (Fig. 2C). Also, SPHK2 knock-out mice had significantly lower pain thresholds in the hot plate test than wild-type mice or mice with knock-out of the gene for SPHK1 (Fig. 2D). Thus, so far the data show that pain thresholds can be modulated by intrathecal administration of S1P, S1P reduction by sphingosine kinase inhibitors, or the absence of one of the sphingosine kinases that might produce endogenous S1P.Spinal S1P Concentrations Modulate Nociceptive Behavior in the Formalin Assay—To determine whether elevated spinal S1P concentrations reduce nociceptive processing, we administered S1P intrathecally and determined its effect in the formalin assay. Administration of 10 μl of 5 and 10 μm S1P-solutions decreased the nociceptive behavior dose-dependently (Fig. 3, A and B). Surprisingly, this antinociceptive effect of S1P disappeared at higher S1P concentrations (40 μm; Fig. 3B), which may have two reasons: First, at higher doses S1P may reach the DRGs and increase the excitability of sensory neurons within the DRG (11Zhang Y.H. Fehrenbacher J.C. Vasko M.R. Nicol G.D. J. Neurophysiol. 2006; 96: 1042-1052Crossref PubMed Scopus (69) Google Scholar, 12Zhang Y.H. Vasko M.R. Nicol G.D. J. Physiol. 2006; 575: 101-113Crossref PubMed Scopus (62) Google Scholar). Second, because high extracellular S1P concentrations are described to cause its uptake in cells (25Van Brocklyn J.R. Lee M.J. Menzeleev R. Olivera A. Edsall L. Cuvillier O. Thomas D.M. Coopman P.J. Thangada S. Liu C.H. Hla T. Spiegel S. J. Cell Biol. 1998; 142: 229-240Crossref PubMed Scopus (445) Google Scholar), the second messenger properties of S1P could facilitate neuronal excitability (12Zhang Y.H. Vasko M.R. Nicol G.D. J. Physiol. 2006; 575: 101-113Crossref PubMed Scopus (62) Google Scholar, 26Brailoiu E. Patel S. Dun N.J. Biochem. J. 2003; 373: 313-318Crossref PubMed Scopus (44) Google Scholar). To distinguish between both possibilities, we intrathecally administered sphinganine 1-phosphate (dihydro-S1P), a S1P receptor agonist that has similar receptor affinities as S1P, but that does not mimic the intracellular second messenger properties of S1P (25Van Brocklyn J.R. Lee M.J. Menzeleev R. Olivera A. Edsall L. Cuvillier O. Thomas D.M. Coopman P.J. Thangada S. Liu C.H. Hla T. Spiegel S. J. Cell Biol. 1998; 142: 229-240Crossref PubMed Scopus (445) Google Scholar, 27Spiegel S. Milstien S. J. Biol. Chem. 2002; 277: 25851-25854Abstract Full Text Full Text PDF PubMed Scopus (508) Google Scholar). In contrast to S1P, intrathecally administered dihydro-S1P exhibited a linear concentration dependence in the formalin assay even at high doses (Fig. 3C), suggesting that the loss of the antinociceptive actions of S1P at higher doses is based on the intracellular properties of S1P in spinal neurons rather than the activation of S1P receptors on DRGs.FIGURE 3Intrathecally administered S1P and dhS1P decreases nociceptive behavior in the formalin assay. A, adult rats were given intrathecally 10 μl of 10 μm S1P or saline 30 min prior to formalin injection. The number of flinches during 5-min intervals is shown. The data are expressed as the mean ± S.E. of 6–7 animals. B, same as A, except that the number of flinches from 0–15 min (phase I), 16–35 min (phase IIa), and 36–60 min (phase IIb) is shown. Two-tailed Student's t test: *, p < 0.0001; **, p ≤ 0.038 as compared with saline-treated animals. C, same as B except that dihydro-S1P (dhS1P) was given instead of S1P. Two-tailed Student's t test: *, p ≤ 0.03; **, p < 0.0001 compared with saline-treated animals. D, calcium imaging of 1634 spinal cord cells (365 neurons). Cells that responded to S1P or dihydro-S1P (dhS1P) with increased intracellular calcium concentrations are shown as percentage of the total cell number. Student's t test: *, p ≤ 0.05; **, p < 0.01; ***, p < 0.001. E, calcium imaging of spinal cord neurons after incubation with 10 μm S1P. Fluorescence ratios of 17 neurons that respond to S1P (gray) and 11 non-responding neurons (black) are shown as the mean ± S.E. KCl was given by puff application, S1P by bath application.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Because high intracellular S1P concentrations increased intracellular calcium concentrations (25Van Brocklyn J.R. Lee M.J. Menzeleev R. Olivera A. Edsall L. Cuvillier O. Thomas D.M. Coopman P.J. Thangada S. Liu C.H. Hla T. Spiegel S. J. Cell Biol. 1998; 142: 229-240Crossref PubMed Scopus (445) Google Scholar, 26Brailoiu E. Patel S. Dun N.J. Biochem. J. 2003; 373: 313-318Crossref PubMed Scopus (44) Google Scholar, 27Spiegel S. Milstien S. J. Biol. Chem. 2002; 277: 25851-25854Abstract Full Text Full Text PDF PubMed Scopus (508) Google Scholar), we determined the effect of various S1P and dihydro-S1P concentrations on intracellular calcium concentrations of cultured spinal cord cells. Neurons were identified in these cultures by their response to high KCl concentrations, by morphology, and in part by immunocytochemistry. Physiological S1P concentrations (1 μm) increased intracellular calcium concentrations in a significant number of glia but not in neurons (Fig. 3D) while S1P concentrations of 0.1 μm or lower did not instigate a calcium response in either cell type. However, high S1P concentrations (10 μm) increased intracellular calcium concentrations in about 50% of the cells, neurons as well as glia (Fig. 3, D and E). Similar to the S1P, incubation with 1 μm dihydro-S1P increased intracellular calcium concentrations in a significant number of non-neuronal cells without triggering a response in a significant number of neurons (Fig. 3D). Most importantly, in con
Referência(s)