Chronic Airway Infection/Inflammation Induces a Ca2+-dependent Hyperinflammatory Response in Human Cystic Fibrosis Airway Epithelia
2005; Elsevier BV; Volume: 280; Issue: 18 Linguagem: Inglês
10.1074/jbc.m410618200
ISSN1083-351X
AutoresCarla M. P. Ribeiro, Anthony M. Paradiso, Ute Schwab, Juan Pérez-Vilar, Lisa C. Jones, Wanda K. O’Neal, Richard C. Boucher,
Tópico(s)Inflammasome and immune disorders
ResumoHyperinflammatory responses to infection have been postulated as a component of cystic fibrosis (CF) lung disease. Studies have linked intracellular calcium (Ca2+i) mobilization with inflammatory responses in several systems. We have reported that the pro-inflammatory mediator bradykinin (BK) promotes larger Ca2+i signals in CF compared with normal bronchial epithelia, a response that reflects endoplasmic reticulum (ER)/Ca2+ store expansion induced by chronic luminal airway infection/inflammation. The present study investigated whether CF airway epithelia were hyperinflammatory and, if so, whether the hyperinflammatory CF phenotype was linked to larger Ca2+ stores in the ER. We found that ΔF508 CF bronchial epithelia were hyperinflammatory as defined by an increased basal and mucosal BK-induced interleukin (IL)-8 secretion. However, the CF hyperinflammation expressed in short-term (6–11-day-old) primary cultures of ΔF508 bronchial epithelia was lost in long-term (30–40-day-old) primary cultures of ΔF508 bronchial epithelia, indicating this response was independent of mutant cystic fibrosis transmembrane conductance regulator. Exposure of 30–40-day-old cultures of normal airway epithelia to supernatant from mucopurulent material (SMM) from CF airways reproduced the increased basal and mucosal BK-stimulated IL-8 secretion of short-term CF cultures. The BK-triggered increased IL-8 secretion in SMM-treated cultures was mediated by an increased Ca2+i mobilization consequent to an ER expansion associated with increases in protein synthesis (total, cytokines, and antimicrobial factors). The increased ER-dependent, Ca2+i-mediated hyperinflammatory epithelial response may represent a general beneficial airway epithelial adaptation to transient luminal infection. However, in CF airways, the Ca2+i-mediated hyperinflammation may be ineffective in promoting the eradication of infection in thickened mucus and, consequently, may have adverse effects in the lung. Hyperinflammatory responses to infection have been postulated as a component of cystic fibrosis (CF) lung disease. Studies have linked intracellular calcium (Ca2+i) mobilization with inflammatory responses in several systems. We have reported that the pro-inflammatory mediator bradykinin (BK) promotes larger Ca2+i signals in CF compared with normal bronchial epithelia, a response that reflects endoplasmic reticulum (ER)/Ca2+ store expansion induced by chronic luminal airway infection/inflammation. The present study investigated whether CF airway epithelia were hyperinflammatory and, if so, whether the hyperinflammatory CF phenotype was linked to larger Ca2+ stores in the ER. We found that ΔF508 CF bronchial epithelia were hyperinflammatory as defined by an increased basal and mucosal BK-induced interleukin (IL)-8 secretion. However, the CF hyperinflammation expressed in short-term (6–11-day-old) primary cultures of ΔF508 bronchial epithelia was lost in long-term (30–40-day-old) primary cultures of ΔF508 bronchial epithelia, indicating this response was independent of mutant cystic fibrosis transmembrane conductance regulator. Exposure of 30–40-day-old cultures of normal airway epithelia to supernatant from mucopurulent material (SMM) from CF airways reproduced the increased basal and mucosal BK-stimulated IL-8 secretion of short-term CF cultures. The BK-triggered increased IL-8 secretion in SMM-treated cultures was mediated by an increased Ca2+i mobilization consequent to an ER expansion associated with increases in protein synthesis (total, cytokines, and antimicrobial factors). The increased ER-dependent, Ca2+i-mediated hyperinflammatory epithelial response may represent a general beneficial airway epithelial adaptation to transient luminal infection. However, in CF airways, the Ca2+i-mediated hyperinflammation may be ineffective in promoting the eradication of infection in thickened mucus and, consequently, may have adverse effects in the lung. In CF 1The abbreviations used are: CF, cystic fibrosis; Ca2+i, intracellular calcium; BK, bradykinin; ER, endoplasmic reticulum; SMM, supernatant from mucopurulent material; CFTR, cystic fibrosis transmembrane conductance regulator; NF, nuclear factor; GPCR, G protein-coupled receptor; IL, interleukin; BIP, immunoglobulin-binding protein; PDI, protein disulfide isomerase; XBP-1, X-box binding protein-1; TG, thapsigargin; IRE1, inositol requiring 1; ATF6, activating transcription factor 6; PBS, phosphate-buffered saline; BAPTA, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid. airway epithelia, the absence of the cystic fibrosis transmembrane conductance regulator (CFTR)-mediated Cl– secretion, coupled with increased Na+ absorption, results in a reduced periciliary liquid layer depth (1Matsui H. Grubb B.R. Tarran R. Randell S.H. Gatzy J.T. Davis C.W. Boucher R.C. Cell. 1998; 95: 1005-1015Abstract Full Text Full Text PDF PubMed Scopus (936) Google Scholar), adherence of thickened mucus to airway surfaces, and persistent airway infections (2Konstan M.W. Hilliard K.A. Norvell T.M. Berger M. Am. J. Respir. Crit. Care Med. 1994; 150: 448-454Crossref PubMed Scopus (475) Google Scholar, 3Khan T.Z. Wagener J.S. Bost T. Martinez J. Accurso F.J. Riches D.W.H. Am. J. Respir. Crit. Care Med. 1995; 151: 1075-1082PubMed Google Scholar, 4Muhlebach M.S. Stewart P.W. Leigh M.W. Noah T.L. Am. J. Respir. Crit. Care Med. 1999; 160: 186-191Crossref PubMed Scopus (310) Google Scholar, 5Leigh M.W. Disorders of the Respiratory Tract of Children. W. B. Saunders, Philadelphia1998Google Scholar). It remains controversial whether the inflammatory response of CF airways to infection is intrinsically excessive and, thus, accelerates lung disease. As evidence for excessive inflammation, cytokines are elevated in sputa from CF compared with disease control (asthmatic) patients (6Koller D.Y. Nething I. Otto J. Urbanek R. Eichler I. Am. J. Respir. Crit. Care Med. 1997; 155: 1050-1054Crossref PubMed Scopus (73) Google Scholar), and bronchoalveolar lavage studies have revealed higher levels of cytokines and inflammatory cells referenced to bacterial number or endotoxin levels in CF versus non-CF patients with acute lung infection (4Muhlebach M.S. Stewart P.W. Leigh M.W. Noah T.L. Am. J. Respir. Crit. Care Med. 1999; 160: 186-191Crossref PubMed Scopus (310) Google Scholar, 7Muhlebach M.S. Noah T.L. Am. J. Respir. Crit. Care Med. 2002; 165: 911-915Crossref PubMed Scopus (112) Google Scholar). Many studies have addressed the magnitude of airway epithelial inflammatory responses to infection in CF by focusing on the regulation of cytokine production by the transcription factor nuclear factor (NF)-κB (8Konstan M.W. Berger M. Pediatr. Pulmonol. 1997; 24: 137-142Crossref PubMed Scopus (2) Google Scholar, 9Bals R. Weiner D.J. Wilson J.M. J. Clin. Investig. 1999; 103: 303-307Crossref PubMed Scopus (166) Google Scholar), including its regulation by toll receptors (10Akira S. Takeda K. Kaisho T. Nat. Immunol. 2001; 2: 675-680Crossref PubMed Scopus (3958) Google Scholar). In addition, intracellular calcium (Ca2+i) signals resulting from heterotrimeric G protein-coupled receptor (GPCR) activation by inflammatory mediators or infectious agents also modulate NF-κB activation by a Ca2+i-dependent mechanism (11Hu Q. Deshpande S. Irani K. Ziegelstein R.C. J. Biol. Chem. 1999; 274: 33995-33998Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 12Quinlan K.L. Naik S.M. Cannon G. Armstrong C.A. Bunnett N.W. Ansel J.C. Caughman S.W. J. Immunol. 1999; 163: 5656-5665PubMed Google Scholar, 13Han B. Logsdon C.D. Am. J. Physiol. 2000; 278: C344-C351Crossref PubMed Google Scholar, 14Ouellet M. Barbeau B. Tremblay M.J. J. Biol. Chem. 1999; 274: 35029-35036Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar, 15Gewirtz A.T. Rao A.S. Simon Jr., P.O. Merlin D. Carnes D. Madara J.L. Neish A.S. J. Clin. Investig. 2000; 105: 79-92Crossref PubMed Scopus (175) Google Scholar, 16Jefferson K.K. Smith Jr., M.F. Bobak D.A. J. Immunol. 1999; 163: 5183-5191PubMed Google Scholar, 17Hsuan S.L. Kannan M.S. Jeyaseelan S. Prakash Y.S. Malazdrewich C. Abrahamsen M.S. Sieck G.C. Maheswaran S.K. Microb. Pathog. 1999; 26: 263-273Crossref PubMed Scopus (50) Google Scholar). For example, the pro-inflammatory mediator bradykinin (BK) triggers Ca2+i mobilization (18Paradiso A.M. Cheng E.H.C. Boucher R.C. Am. J. Physiol. 1991; 261: L63-L69PubMed Google Scholar) and induces interleukin (IL)-8 secretion in non-CF and CF human airway epithelia (19Rodgers H.C. Pang L. Holland E. Corbett L. Range S. Knox A.J. Am. J. Physiol. 2002; 283: L612-L618Google Scholar). Furthermore, the CF pathogens Pseudomonas aeruginosa and Staphylococcus aureus promote IL-8 secretion by a Ca2+i mobilization-dependent mechanism in airway epithelial cells (20Ratner A.J. Bryan R. Weber A. Nguyen S. Barnes D. Pitt A. Gelber S. Cheung A. Prince A. J. Biol. Chem. 2001; 276: 19267-19275Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). We have shown that apical purinoceptor (P2Y2 receptors) or BK receptor activation induces larger Ca2+i signals in CF compared with normal human airway epithelia (21Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (97) Google Scholar, 22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar), and this exaggerated Ca2+i response results from luminal infection/inflammation-induced up-regulation of the apically confined endoplasmic reticulum (ER) Ca2+ stores (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). The possibility that the amplified ER-derived Ca2+i responses provide a clue to the pathogenesis of CF hyperinflammation was raised by studies of other diseases. For example, in a model for Gaucher disease, hippocampal cells expressed a greater glutamate-dependent ER Ca2+ release, consequent to an increased ER size, which appeared linked to the neuronal toxicity characteristic of this disease (23Korkotian E. Schwarz A. Pelled D. Schwarzmann G. Segal M. Futerman A.H. J. Biol. Chem. 1999; 274: 21673-21678Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). Moreover, presenillin mutations in Alzheimer disease have been associated with increases in ER size, Ca2+ stores, and cytokine production (24Guo Q. Sopher B.L. Furukawa K. Pham D.G. Robinson N. Martin G.M. Mattson M.P. J. Neurosci. 1997; 17: 4212-4222Crossref PubMed Google Scholar, 25Patterson P.H. Curr. Opin. Neurobiol. 1995; 5: 642-646Crossref PubMed Scopus (52) Google Scholar). In the case of CF, the possible relationships among ER expansion, enhanced cytokine release, and CF airways inflammation are unknown. In the present study, we tested the hypothesis that CF airway epithelia express a hyperinflammatory phenotype resulting from luminal infection/inflammation-induced up-regulation of ER Ca2 stores. Accordingly, we investigated the following: 1) whether CF airway epithelia have increased IL-8 release in response to the inflammatory peptide BK as compared with normal airway epithelia; 2) whether this response is an epithelial adaptation to luminal infection/inflammation or depends on mutant ΔF508 CFTR; and 3) whether greater ER-derived Ca2+i responses contribute to the increased cytokine release in an in vitro model for CF airway epithelial inflammation. Cell Culture and Freshly Excised Tissue—Tissues and cells were obtained under the auspices of protocols approved by the Institutional Committee on the Protection of the Rights of Human Subjects. Excess tissues from human donor lungs and excised recipient lungs were obtained at the time of lung transplantation from main stem or lobar bronchi. Tissues were either fixed in 4% paraformaldehyde and embedded in paraffin or used for cell isolation. Bronchial epithelial cells were provided by the University of North Carolina Cystic Fibrosis Center Tissue Core. Normal and CF (ΔF508 homozygous) cells were harvested and cultured as previously described (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Cultures were maintained at an air-liquid surface interface, and polarized primary cultures were studied at 6–11 days (short-term cultures) or at 30–40 days (long-term cultures). IL-8 Secretion—For basal, apical BK-stimulated, UTP-stimulated, or SMM from CF airways (see "Studies with Infectious/Inflammatory Material from CF Airways")-stimulated IL-8 secretion, the serosal media were collected at selected times from short-term or long-term cultures of normal and CF bronchial epithelia. IL-8 was measured by enzyme-linked immunosorbent assay (R&D Systems) in duplicate. Studies with Infectious/Inflammatory Material from CF Airways— Mucopurulent material was harvested from the airway lumens of excised human CF lungs infected with P. aeruginosa and S. aureus at the time of transplant and provided by the Tissue Core of the University of North Carolina Cystic Fibrosis Center as recently described (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). This material was centrifuged at 100,000 rpm (60 min, 4 °C), and the supernatant was filtered through a 0.2-μm filter and frozen at –80 °C. Preliminary studies revealed that treatment of airway epithelia with SMM from individual CF lungs infected with P. aeruginosa and S. aureus induced epithelial hyperinflammation. Because of the small volume of SMM per patient and the large number of experiments, SMMs from nine CF lungs (five males and four females; age, 17–48 years; four ΔF508 homozygous and five unknown genotypes) were pooled to assure homogeneous stimulus throughout experiments. PBS or SMM (40 μl) was applied to the mucosal surfaces of normal or CF bronchial epithelia, and the following protocols were utilized. First, to compare the inflammatory response of normal versus CF cultures to luminal infectious/inflammatory stimuli, cultures were treated with PBS or SMM, and a time course was performed for IL-8 secretion. Second, to test whether SMM-treated cultures were sensitized to a subsequent inflammatory stimulus, cultures were treated with PBS or SMM for 24–36 h, and the serosal media were replaced by fresh media, followed by mucosal BK (5 μm) or UTP (100 μm) and serial measurements of IL-8 secretion. Third, to address the role of Ca2+i mobilization on SMM-potentiated BK-induced IL-8 secretion, cultures were treated with PBS or SMM for 36 h, followed by removal of the medium and BAPTA/acetoxymethyl ester loading as previously described (21Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (97) Google Scholar). BK (5 μm) was subsequently mucosally added to cultures in a nominally Ca2+-free solution (21Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (97) Google Scholar), and Ca2+i mobilization was assessed as previously reported (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar); in parallel experiments, IL-8 release into the serosal compartment was measured 2 h later. Fourth, to assess the effect of SMM on IL-8, IL-6, and IL-1β secretion, cultures were treated with PBS or SMM for up to 120 h, and the serosal media were collected and replaced every 24 h for cytokine measurements. Fifth, to address the effect of SMM on total protein synthesis, the incorporation of 35S-labeled amino acids into proteins synthesized by cultures metabolically labeled with [35S]cysteine/methionine (26Coligan J.E. Gates F.T. II I Kimball E.S. Maloy W.L. Methods Enzymol. 1983; 91: 413-434Crossref PubMed Scopus (39) Google Scholar) was measured after 48 h of PBS or SMM treatment. Immunostaining of ER Protein Synthetic Markers—The immunostaining of ER chaperone proteins in cultures of bronchial airway epithelia or deparaffinized native bronchial epithelial sections was performed according to a modification of our previous method (27Ribeiro C.M. Reece J. Putney Jr., J.W. J. Biol. Chem. 1997; 272: 26555-26561Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). Cultures or epithelial sections were incubated with the primary antibodies, a rabbit (1:100 dilution) and a mouse (5 μg/ml; Stressgen) antibody, for BIP and PDI, respectively, followed by a fluorescein-labeled goat anti-rabbit antibody and a Texas Red-labeled goat anti-mouse antibody (1:200 dilution; Jackson Immunoresearch Laboratories). As controls, the primary antibodies were omitted. The fluorescent signals were studied by laser confocal microscopy (Leica model TCS 4D; PL APO 63x/1.20 mm water lens) in the XZ or XY scanning mode. The quantification of the fluorescence intensity of labeled BIP and PDI was performed according to a previous method (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Multiple scans were obtained from each sample, and regions of interest were designated in the apical domains with the MetaMorph software. The same acquisition parameters (e.g. laser power, contrast, brightness, and pinhole value) for each channel were employed to acquire the images from paired normal bronchial epithelial cultures treated in different ways or native normal versus CF bronchial epithelia in experiments performed on the same day. The fluorescence intensity values from the regions of interest were averaged from paired cultures and native bronchial epithelial tissues. XBP-1 mRNA Splicing—The assessment of XBP-1 mRNA splicing was an adaptation of a previous method (28Yoshida H. Matsui T. Yamamoto A. Okada T. Mori K. Cell. 2001; 107: 881-891Abstract Full Text Full Text PDF PubMed Scopus (3014) Google Scholar, 29Calfon M. Zeng H. Urano F. Till J.H. Hubbard S.R. Harding H.P. Clark S.G. Ron D. Nature. 2002; 415: 92-96Crossref PubMed Scopus (2161) Google Scholar). Long-term bronchial epithelial cultures were mucosally treated with 40 μl of PBS or SMM for 48 h or 1 μm thapsigargin (TG) for 24 h, followed by three washes with PBS. 1 ml of RNAlater™ (Qiagen) was added to the mucosal and serosal surfaces, and cultures were frozen at –20 °C. Total RNA was isolated using RNeasy (Qiagen), and 200 ng of RNA was reverse transcribed by SuperScript II RNase H+ reverse transcriptase (Invitrogen) using 250 ng of random primers. PCR primers were designed to amplify a 270-bp region of XBP-1 (sequence number NM_005080). The PCR product spans a 26-bp intron that, when spliced by IRE1, results in a translated XBP-1 mRNA that codes for an active transcription factor. The unspliced PCR product contains a PstI site, which is destroyed after splicing. The PCR protocol was 1 cycle at 94 °C for 7 min; 35 cycles of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 30 s; followed by 1 cycle of 72 °C for 7 min and holding at 4 °C. The PCR products were run on a 2% agarose gel, column-purified using a QIAquick PCR Purification Kit (Qiagen), and digested with PstI to visualize the 270-bp product (spliced product) and the two ∼140-bp products (unspliced product). To quantify the amount of unspliced product, a Southern blot was performed using the PstI-digested PCR product from PBS- and SMM-treated cultures. DNA was run on a 2% agarose gel, capillary blot transferred, cross-linked to the membrane, and probed (Megaprime DNA Labeling Kit; Amersham Biosciences) with the 270-bp PCR product from PBS-treated samples. Data were quantified with a Storm phosphorimaging system. Quantitation of BIP mRNA—Quantitative real-time PCR analysis was used to evaluate changes in BIP mRNA from PBS- and SMM-treated cultures utilizing the LightCycler (Roche Applied Science). RNA was isolated according to standard RNA isolation procedures involving phenol/choloroform extraction and purification/DNase treatment using the Qiagen RNeasy purification kit. cDNA was generated from RNA samples (200 ng) using SuperScript II reverse transcriptase. PCR amplification utilized the following primer sequences: 5′ forward, TCCTATGTCGCCTTCACTCC; and 3′ reverse, TTTCCCAATAACCTCAGC. Primers were initially tested for specificity by PCR and then by melting curve analysis in the LightCycler instrument. A standard curve was run utilizing a positive control cDNA to determine PCR reaction efficiency. PBS- or SMM-treated samples were run in duplicate, and cross-points were calculated using the LightCycler internal software. As a control gene, glyceraldehyde-3-phosphate dehydrogenase was also run in duplicate on each of the samples. Ratios of gene expression were calculated as previously reported (30Pfaffl M.W. Nucleic Acids Res. 2001; 29: 2002-2007Crossref Scopus (25871) Google Scholar). Statistics—Data represent the mean ± S.E. from at least three experiments from three individual donors and were analyzed by unpaired t test or two-way analysis of variance. Statistical significance was defined as p < 0.05. Short-term Primary Cultures of CF Airway Epithelia Exhibit Increased Basal and BK-stimulated IL-8 Secretion—To investigate whether CF airway epithelia exhibit hyperinflammation, we first compared the basal IL-8 secretion in 6–11-day-old normal versus ΔF508 homozygous CF primary bronchial epithelial cultures. Fig. 1A illustrates that the baseline IL-8 secretion was increased in short-term CF compared with normal cultures. The effect of the pro-inflammatory agonist BK on IL-8 secretion was measured in parallel 6–11-day-old primary cultures of normal and ΔF508 homozygous CF bronchial epithelia. Mucosal treatment with a maximal dose of BK (5 μm) (18Paradiso A.M. Cheng E.H.C. Boucher R.C. Am. J. Physiol. 1991; 261: L63-L69PubMed Google Scholar) promoted greater IL-8 secretion in CF compared with normal cultures (Fig. 1B). These data demonstrate that short-term primary cultures of CF bronchial airway epithelia express a hyperinflammatory phenotype. Is the CF Hyperinflammatory Phenotype the Result of an Intrinsic ΔF508 CFTR Defect or an Acquired Epithelial Response to Chronic Airway Infection/Inflammation?—To address this issue, IL-8 secretion under basal and BK-stimulated conditions was studied in long-term normal versus ΔF508 homozygous CF primary bronchial epithelial cultures. Fig. 1C demonstrates that the increased baseline IL-8 secretion in short-term CF cultures compared with normal cultures (Fig. 1A) was lost after 30–40 days in culture. Furthermore, 30–40-day-old CF cultures responded in the same manner to 5 μm mucosal BK-dependent IL-8 secretion as 30–40-day-old normal cultures (Fig. 1D). These data strongly suggest that the hyperinflammatory state observed in short-term CF cultures does not represent a defect intrinsic to the ΔF508 CFTR genotype but, rather, is a response to the persistent infectious/inflammatory milieu found in CF airways in vivo that wanes with prolonged periods in the absence of the stimulus. Can the CF Hyperinflammatory Phenotype Be Transferred to Normal Airway Epithelia by Mucosal Exposure to CF Airway Mucopurulent Material?—To test more directly for the role of persistent infection and inflammation on hyperinflammatory responsiveness, we prepared a SMM from CF airway lumens, exposed the lumens of airway epithelial cultures to it for prolonged periods, and measured basal and BK-induced IL-8 release. SMM-dependent IL-8 secretion was first investigated in long-term 30–40-day-old primary cultures of normal and CF bronchial epithelia acutely exposed to mucosal SMM for up to 6 h. Fig. 2A illustrates that the acute SMM treatment triggered IL-8 secretion, but this response was similar in long-term normal and CF cultures for each interval. We next assessed whether prolonged SMM pretreatment (36 h) conferred a "CF-like hyperinflammatory phenotype," i.e. an increased IL-8 secretory response to mucosal BK, in normal airway epithelia and whether this response was different in long-term cultures of CF epithelia. SMM-pretreated 30–40-day-old normal epithelia exhibited an increased IL-8 secretion to BK (Fig. 2B) compared with 30–40-day-old normal epithelia exposed to BK in the absence of SMM pretreatment (Fig. 1D). Moreover, an increased BK-dependent IL-8 secretion was induced in 30–40-day-old CF cultures pretreated for 36 h with SMM (Fig. 2B), as compared with non-SMM treated cultures (Fig. 1D). Notably, the IL-8 response of SMM-pretreated CF cultures in the absence (Fig. 2A) or presence (Fig. 2B) of mucosal BK was similar to that of normal cultures. Thus, these data again argue against an intrinsic hyperinflammatory defect associated with the ΔF508 genotype but suggest that chronic infection/inflammation (SMM) itself can induce the hyperinflammatory phenotype. Can the CF-like Hyperinflammatory Phenotype, e.g., the Amplified BK-dependent IL-8 Secretion in SMM-pretreated Normal Cultures, Be Reproduced with the Activation of Another Receptor Coupled to Ca2+i Mobilization?—Like BK receptors, P2Y2 receptors are coupled to Ca2+i mobilization (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Therefore, we investigated whether activation of this class of receptors with UTP stimulated IL-8 secretion in airway epithelia and, if so, whether SMM potentiated this response. Following a 24-h PBS pretreatment, 100 μm mucosal UTP induced a modest increase in IL-8 secretion in 30–40-day-old normal bronchial epithelia compared with vehicle-treated cultures (Fig. 3). In contrast, cultures pretreated with SMM secreted much higher levels of IL-8 in response to 100 μm mucosal UTP compared with PBS-treated cultures (Fig. 3). These data suggest that the increased IL-8 secretion triggered by apical activation of BK receptors in SMM-pretreated cultures (Fig. 2B) may be a general finding associated with the activation of GPCRs that trigger increased Ca2+i mobilization in chronically infected/inflamed airway epithelia (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Is SMM-potentiated BK-dependent IL-8 Secretion Dependent on SMM-induced Expansion of the Releasable ER Ca2+ Stores?—To address the role of Ca2+i signals on the amplified SMM-induced BK-dependent inflammatory response, we investigated BK-induced Ca2+i mobilization in 30–40-day-old normal bronchial airway epithelial cultures treated with PBS versus SMM for 36 h. Mucosal BK (5 μm) elicited Ca2+i mobilization in both PBS- and SMM-treated cultures, but the BK-dependent Ca2+i signal was amplified in SMM-treated epithelia (Fig. 4, A and B, respectively). The compiled data for BK-dependent Δ340/380 Fura-2 fluorescence (peak – baseline values, an index of ER Ca2+ store capacity in airway epithelia) (22Ribeiro C.M.P. Paradiso A.M. Carew M.A. Shears S.B. Boucher R.C. J. Biol. Chem. 2005; 280: 10202-10209Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar) illustrate that SMM pretreatment increased the ER Ca2+ stores that can be mobilized following apical BK receptor activation (Fig. 4E). Utilizing a protocol previously shown to effectively buffer Ca2+i signals in airway epithelia (21Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (97) Google Scholar), the Ca2+i-mobilizing effect of BK was completely blocked in BAPTA-loaded PBS- or SMM-pretreated cultures (Fig. 4, C and D). We next tested the effect of Ca2+i clamping on BK-dependent IL-8 secretion in epithelia treated with PBS versus SMM for 24 h. Fig. 5 illustrates that BAPTA was ineffective in blocking BK-dependent IL-8 secretion in PBS-treated cultures. In contrast, the "hyperinflammatory" component of BK-dependent IL-8 secretion in SMM-treated cultures was inhibited by BAPTA. These data suggest that BK induces IL-8 secretion by Ca2+i-independent and -dependent mechanisms. We speculate that the absence of an effect of Ca2+i buffering on BK-induced IL-8 secretory responses in PBS-treated cultures reflects the fact that the small BK-induced Ca2+i signals in cells with normal ER Ca2+ stores did not reach the critical threshold necessary to induce the Ca2+i-mediated component of IL-8 secretion (Fig. 4A). In contrast, the larger BK-dependent Ca2+i signals resulting from the up-regulation of ER Ca2+ stores by SMM (Fig. 4B) were sufficient to produce a significant Ca2+i-dependent activation of signal transduction pathway(s) involved in amplified IL-8 secretion. To further investigate the Ca2+i-independent component of BK-induced IL-8 secretion in normal airway epithelia, cultures were pretreated for 24 h with the ER Ca2+-ATPase inhibitor TG to deplete the ER Ca2+ stores (31Ribeiro C.M.P. Putney Jr., J.W. J. Biol. Chem. 1996; 271: 21522-21528Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). As shown in Fig. 5, the IL-8 response to BK in cultures whose ER Ca2+ stores were depleted with TG was the same as that seen in PBS-treated cultures. Furthermore, BAPTA had no additional effect on BK-dependent IL-8 secretion in TG-treated cultures (Fig. 5). Collectively, these data suggest that apical BK receptor activation triggers a Ca2+i-independent component of IL-8 secretion in PBS-, SMM-, and TG-pretreated cultures (indexed as BAPTA-insensitive secretion) and a Ca2+i-dependent, BAPTA-sensitive component that requires SMM-dependent up-regulation of ER Ca2+ stores (Figs. 4 and 5). Does
Referência(s)