Portal de Periódicos da CAPES

Bone Morphogenetic Protein Type IA Receptor Signaling Regulates Postnatal Osteoblast Function and Bone Remodeling

2004; Elsevier BV; Volume: 279; Issue: 26 Linguagem: Inglês

10.1074/jbc.m404222200

1083-351X

Yuji Mishina, Michael W. Starbuck, Michael A. Gentile, Tomokazu Fukuda, Viera Kasparcova, J.G. Seedor, Mark C. Hanks, Michael Amling, Gerald J. Pinero, Shun-ichi Harada, Richard R. Behringer,

Parathyroid Disorders and Treatments

Bone morphogenetic proteins (BMPs) function during various aspects of embryonic development including skeletogenesis. However, their biological functions after birth are less understood. To investigate the role of BMPs during bone remodeling, we generated a postnatal osteoblast-specific disruption of Bmpr1a that encodes the type IA receptor for BMPs in mice. Mutant mice were smaller than controls up to 6 months after birth. Irregular calcification and low bone mass were observed, but there were normal numbers of osteoblasts. The ability of the mutant osteoblasts to form mineralized nodules in culture was severely reduced. Interestingly, bone mass was increased in aged mutant mice due to reduced bone resorption evidenced by reduced bone turnover. The mutant mice lost more bone after ovariectomy likely resulting from decreased osteoblast function which could not overcome ovariectomy-induced bone resorption. In organ culture of bones from aged mice, ablation of the Bmpr1a gene by adenoviral Cre recombinase abolished the stimulatory effects of BMP4 on the expression of lysosomal enzymes essential for osteoclastic bone resorption. These results demonstrate essential and age-dependent roles for BMP signaling mediated by BMPRIA (a type IA receptor for BMP) in osteoblasts for bone remodeling. Bone morphogenetic proteins (BMPs) function during various aspects of embryonic development including skeletogenesis. However, their biological functions after birth are less understood. To investigate the role of BMPs during bone remodeling, we generated a postnatal osteoblast-specific disruption of Bmpr1a that encodes the type IA receptor for BMPs in mice. Mutant mice were smaller than controls up to 6 months after birth. Irregular calcification and low bone mass were observed, but there were normal numbers of osteoblasts. The ability of the mutant osteoblasts to form mineralized nodules in culture was severely reduced. Interestingly, bone mass was increased in aged mutant mice due to reduced bone resorption evidenced by reduced bone turnover. The mutant mice lost more bone after ovariectomy likely resulting from decreased osteoblast function which could not overcome ovariectomy-induced bone resorption. In organ culture of bones from aged mice, ablation of the Bmpr1a gene by adenoviral Cre recombinase abolished the stimulatory effects of BMP4 on the expression of lysosomal enzymes essential for osteoclastic bone resorption. These results demonstrate essential and age-dependent roles for BMP signaling mediated by BMPRIA (a type IA receptor for BMP) in osteoblasts for bone remodeling. Bone formation is a well characterized process; however, little is known about the molecular mechanisms that regulate bone remodeling, the physiological process through which bone mass is maintained constant. Remodeling consists of two distinct phases: initial bone resorption by the osteoclasts, followed by de novo bone formation by the osteoblasts (1Ducy P. Schinke T. Karsenty G. Science. 2000; 289: 1501-1504Crossref PubMed Scopus (904) Google Scholar). Differentiated osteoblasts are the only cells responsible for bone formation. Bone formation is thought to be regulated by hormones and by locally acting growth factors (2Takeda S. Elefteriou F. Karsenty G. Annu. Rev. Nutr. 2003; 23: 403-411Crossref PubMed Scopus (61) Google Scholar). Bone morphogenetic proteins (BMPs) 1The abbreviations used are: BMP, bone morphogenetic protein; BMPRIA, a type IA receptor for BMP; BMD, bone mineral density; TRAP, tartrate-resistant acid phosphatase; Mmp9, matrix metalloproteinase-9 gene; Ctsk, cathepsin K gene; BV/TV, bone volume per total volume; BFR/BS, bone formation rate per total bone surface; OVX, ovariectomy; FAM, 6-carboxyfluorescein. are secreted molecules and members of transforming growth factor-β superfamily (3Hogan B.L.M. Genes Dev. 1996; 10: 1580-1594Crossref PubMed Scopus (1725) Google Scholar, 4Mishina Y. Front. Biosci. 2003; 8: d855-d869Crossref PubMed Google Scholar). They were discovered by their ectopic bone formation activity when implanted locally in soft tissues (5Urist M.R. Science. 1965; 150: 893-899Crossref PubMed Scopus (4520) Google Scholar). Over the past decade, the phenotypes of mice with mutations in genes coding for this group of proteins and their receptors uncovered the essential roles for BMPs in wide variety of developmental processes, including skeletal development and patterning (6Kingsley D.M. Bland A.E. Grubber J.M. Marker P.C. Russell L.B. Copeland N.G. Jenkins N.A. Cell. 1992; 71: 399-410Abstract Full Text PDF PubMed Scopus (412) Google Scholar, 7Storm E.E. Huynh T.V. Copeland N.G. Jenkins N.A. Kingsley D.M. Lee S.J. Nature. 1994; 368: 639-643Crossref PubMed Scopus (743) Google Scholar, 8Luo G. Hofmann C. Bronckers A.L. Sohocki M. Bradley A. Karsenty G. Genes Dev. 1995; 9: 2808-2820Crossref PubMed Scopus (878) Google Scholar, 9Dudley A.T. Lyons K.M. Robertson E.J. Genes Dev. 1995; 9: 2795-2807Crossref PubMed Scopus (967) Google Scholar). However, despite its powerful ability to induce ectopic osteogenesis, the essential role of BMPs in bone formation and bone metabolism in the adult skeleton has not been established (10Karsenty G. Wagner E.F. Dev. Cell. 2002; 2: 389-406Abstract Full Text Full Text PDF PubMed Scopus (1204) Google Scholar) because of embryonic lethality resulting from mutations of genes encoding the most potent BMPs for bone formation, BMP2 and BMP4, and their receptors (11Winnier G. Blessing M. Labosky P.A. Hogan B.L.M. Genes Dev. 1995; 9: 2105-2116Crossref PubMed Scopus (1473) Google Scholar, 12Zhang H. Bradley A. Development (Camb.). 1996; 122: 2977-2986PubMed Google Scholar, 13Mishina Y. Suzuki A. Ueno N. Behringer R.R. Genes Dev. 1995; 9: 3027-3037Crossref PubMed Scopus (646) Google Scholar). We previously generated a null allele for Bmpr1a that encodes a type IA receptor for BMP (BMPRIA or ALK3). Mice homozygous for this null allele died by embryonic day 8.0 (E8.0) without mesoderm formation (13Mishina Y. Suzuki A. Ueno N. Behringer R.R. Genes Dev. 1995; 9: 3027-3037Crossref PubMed Scopus (646) Google Scholar). Bmpr1a is expressed in most tissues throughout development and after birth (13Mishina Y. Suzuki A. Ueno N. Behringer R.R. Genes Dev. 1995; 9: 3027-3037Crossref PubMed Scopus (646) Google Scholar, 14Dewulf N. Verschueren K. Lonnoy O. Moren A. Grimsby S. Vande Spiegle K. Miyazono K. Huylebroeck D. Ten Dijke P. Endocrinology. 1995; 136: 2652-2663Crossref PubMed Google Scholar). Expression of a dominant-negative form of BMPRIA in a cultured cell line or chick limb buds suggests that signaling through this receptor regulates apoptosis and adipocyte differentiation (15Yokouchi Y. Sakiyama J. Kameda T. Iba H. Suzuki A. Ueno N. Kuroiwa A. Development (Camb.). 1996; 122: 3723-3734Google Scholar, 16Chen D. Ji X. Harris M.A. Feng J.Q. Karsenty G. Celeste A.J. Rosen V. Mundy G.R. Harris S.E. J. Cell Biol. 1998; 142: 295-305Crossref PubMed Scopus (346) Google Scholar). Overexpression of a constitutive-active form of BMPRIA in chicken limb buds suggests that signaling through this receptor also can regulate chondrocyte differentiation (17Zou H. Wieser R. Massague J. Niswander L. Genes Dev. 1997; 11: 2191-2203Crossref PubMed Scopus (458) Google Scholar). However, the essential role of BMPRIA in bone formation and bone metabolism in the adult skeleton is not known. To investigate the role of BMPRIA signaling at later stages of development, we generated a conditional null allele of Bmpr1a using the Cre/loxP system (18Nagy A. Genesis. 2000; 26: 99-109Crossref PubMed Scopus (974) Google Scholar, 19Mishina Y. Hanks M.C. Miura S. Tallquist M.D. Behringer R.R. Genesis. 2002; 32: 69-72Crossref PubMed Scopus (222) Google Scholar). Because Bmpr1a is expressed in osteoblasts (20Ishidou Y. Kitajima I. Obama H. Maruyama I. Murata F. Imamura T. Yamada N. ten Dijke P. Miyazono K. Sakou T. J. Bone Miner. Res. 1995; 10: 1651-1659Crossref PubMed Scopus (155) Google Scholar), we designed a postnatal, differentiated osteoblast-specific disruption of Bmpr1a to elucidate the requirement of BMP signaling for bone formation (21Dacquin R. Starbuck M. Schinke T. Karsenty G. Dev. Dyn. 2002; 224: 245-251Crossref PubMed Scopus (261) Google Scholar). Mice—The generation of Bmpr1a conditional null mice was reported elsewhere (19Mishina Y. Hanks M.C. Miura S. Tallquist M.D. Behringer R.R. Genesis. 2002; 32: 69-72Crossref PubMed Scopus (222) Google Scholar). Briefly, one loxP site was placed in intron 1, and two others were placed in intron 2 flanking a PGK-neo cassette (fn allele). After germ line transmission, mice heterozygous for the fn allele were mated with CMV-Cre transgenic mice to remove the neo cassette by Cre-dependent recombination in vivo (fx allele). Both the fn allele and the fx allele behaved as wild type, indicating that the presence of the PGK-neo cassette or the loxP sites in the Bmpr1a locus did not reduce Bmpr1a activity (19Mishina Y. Hanks M.C. Miura S. Tallquist M.D. Behringer R.R. Genesis. 2002; 32: 69-72Crossref PubMed Scopus (222) Google Scholar). For the studies reported here we used both the fn and fx alleles. Mice heterozygous for Bmpr1a null allele (+/-) were bred to Og2-Cre transgenic mice (21Dacquin R. Starbuck M. Schinke T. Karsenty G. Dev. Dyn. 2002; 224: 245-251Crossref PubMed Scopus (261) Google Scholar) to generate Bmpr1a(+/-),Og2-Cre(+) mice. These mice were bred to Bmpr1a fn/fn or fx/fx mice. Theoretically, 25% of the progeny should be transheterozygous for fn (or fx) and null alleles and also carry the Og2-Cre transgene to execute osteoblast-specific disruption of Bmpr1a. All experimental procedures were performed according to ethical guidelines approved by local authorities. Genotyping—Mouse genotypes were initially determined by Southern blot described elsewhere (19Mishina Y. Hanks M.C. Miura S. Tallquist M.D. Behringer R.R. Genesis. 2002; 32: 69-72Crossref PubMed Scopus (222) Google Scholar). In brief, genomic DNA from the tail was digested with NheI and SacI and probed with a 0.8-kb HindIII fragment that contained exon 3. Subsequently, each allele was identified by PCR (see Fig. 2C) using the following primers: primer 1, 5′-GGTTTGGATCTTAACCTTAGG-3′; primer 2, 5′-GCAGCTGCTGCTGCAGCCTCC-3′; primer 3, 5′-AGACTGCCTTGGGAAAAGCGC-3′; and primer 4, 5′-TGGCTACAATTTGTCTCATGC-3′. Osteoblast Culture—106 bone marrow cells collected from femurs were plated in mineralization medium (α-minimal essential medium, 0.1 mg/ml ascorbic acid, 5 mm β-glycerophosphate) in 35-mm culture dishes and cultured in 5% CO2 at 37 °C (22Weinstein R.S. Jilka R.L. Parfitt A.M. Manolagas S.C. Endocrinology. 1997; 138: 4013-4021Crossref PubMed Scopus (90) Google Scholar). After 4 weeks, the cultures were scored for osteoblastic colonies by staining for alkaline phosphatase to assess osteoblast differentiation and von Kossa stain for mineral deposition (22Weinstein R.S. Jilka R.L. Parfitt A.M. Manolagas S.C. Endocrinology. 1997; 138: 4013-4021Crossref PubMed Scopus (90) Google Scholar). Bone Histomorphometry—Animals were injected with calcein (5 mg/kg of body weight) twice at 4-day intervals and sacrificed 2 days later. Histomorphometric analyses were carried out according to standard protocols (23Parfitt A.M. Drezner M.K. Glorieux F.H. Kanis J.A. Malluche H. Meunier P.J. Ott S.M. Recker R.R. J. Bone Miner. Res. 1987; 2: 595-610Crossref PubMed Scopus (4921) Google Scholar). Measurement of Bone Mineral Density—Whole right femora were dissected and completely cleaned of all tissue for peripheral duel photon x-ray absorptiometry (pDXA) determination of bone mineral content and bone mineral density (BMD) of the whole femur, central femur (central 50%), and distal 25% of the femur. These data were obtained using a Norland™ Saber pDXA scanner set at a resolution of 0.1 × 0.1 mm and a scan speed of 2 mm/s. Mouse Calvarial and Tibia Organ Culture—The calvaria and tibia from aged mice (12 months old on average) that were homozygous for fx were excised and cut in half along the sagittal suture (calvaria) or perpendicular to the long axis (tibia). Each portion was placed in a 24-well tissue culture dish containing 0.5 ml of BGJb medium (Invitrogen) supplemented with 5% fetal bovine serum and 150 μg/ml vitamin C (Sigma) (43Traianedes K. Dallas M.R. Garrett I.R. Mundy G.R. Bonewald L.F. Endocrinology. 1998; 139: 3178-3184Crossref PubMed Scopus (73) Google Scholar). Cre-dependent recombination was induced by infection with recombinant adenovirus that expresses Cre recombinase (a gift from Dr. Robert Sobol), with 108 plaque-forming units/ml in culture for 7 days. Bone samples were subsequently cultured for 11 days with or without recombinant BMP4 (100 ng/ml, R&D Systems). Tibia were flushed to remove bone marrow before RNA extraction. RNA Isolation—Frozen calvaria and tibia from organ cultures were pooled (2 samples/pool, n = 3/group) together, crushed, and homogenized in TRIzol reagent (Invitrogen) using a Polytron PT 10-35. Total RNA was extracted from bone samples using a Purescript RNA Isolation Kit (Gentra Systems) followed by DNase treatment on RNeasy Micro-columns (Qiagen) according to manufacturer's instructions. Real-time PCR—Bmpr1a, cathepsin K (Ctsk), matrix metalloproteinase-9 (Mmp9), and tartrate-resistant acid phosphatase (TRAP) expression were determined by real-time reverse transcriptase-PCR analysis using an Applied Biosystems 7700 Sequence Detector System (Applied Biosystems). cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems). PCR reactions were performed in duplicate using the TaqMan PCR Core Reagent Kit (Applied Biosystems), a 200 nm concentration of each primer and probe, and 10 μl of cDNA template according to manufacturer's instructions. Gene-specific primers and fluorescence-labeled probes (5′-reporter dye, 6-carboxyfluorescein (FAM); 3′-quencher dye, 6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) were designed using Primer Express (version 1.5) software (Applied Biosystems) and synthesized by Applied Biosystems. Primer sequences were as follows: Bmpr1a (intact), TCATGTTCAAGGGCAGAATCTAGA (forward) and GGCAAGGTATCCTCTGGTGCTA (reverse); probe-FAM, AAATCAGACTTGGACCAGAAGAAGCCAGAAA; Bmpr1a (missing exon 2), GTTCATCATTTCTCATGTTCA(-/A/AG/AGG)AACTA (forward) and AATCAGAGCCTTCATACTTCATACACC (reverse); probe-FAM, CCATTATAGAAGAAGATGATCAGGGAGAAACCACATTA; Ctsk, CCATATGTGGGCCAGGATG (forward) and AGGAATCTCTCTGTACCCTCTGCA (reverse); probe-FAM, TGTATGTATAACGCCACGGCAAAGGCA; MMP-9, TGTCTGGAGATTCGACTTGAAGTC (forward) and TGAGTTCCAGGGCACACCA (reverse); probe-FAM, CCCAGAGCGTCATTCGCGTGGATA; TRAP, AATGCCTCGAGACCTGGGA (forward) and CGTAGTCCTCCTTGGCTGCT (reverse); probe-FAM, CGCACTCAGCTGTCCTGGCTCAA. The comparative Ct method was used to measure RNA expression levels, while glyceraldehyde-3-phosphate dehydrogenase RNA Control Reagents (Applied Biosystems) were used for normalization. Disruption of the Type IA Receptor for BMPs in a Differentiated Osteoblast-specific manner—Osteocalcin2 (Og2) is specifically expressed in differentiated osteoblasts only after birth (24Ducy P. Karsenty G. Mol. Cell. Biol. 1995; 15: 1858-1869Crossref PubMed Scopus (529) Google Scholar, 25Desbois C. Hogue D.A. Karsenty G. J. Biol. Chem. 1994; 269: 1183-1190Abstract Full Text PDF PubMed Google Scholar). To direct Cre recombinase in postnatal differentiated osteoblasts, we used transgenic mice that carry a 1.3-kb mouse Og2 upstream region ligated to the Cre recombinase gene (21Dacquin R. Starbuck M. Schinke T. Karsenty G. Dev. Dyn. 2002; 224: 245-251Crossref PubMed Scopus (261) Google Scholar). Osteoblast-specific Cre activity was examined by crosses with CAT-lacZ mice that report Cre activity by β-galactosidase expression (26Araki K. Araki M. Miyazaki J. Vassalli P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 160-164Crossref PubMed Scopus (259) Google Scholar). In Og2-Cre, CAT-lacZ double heterozygotes, all bones stained positively for β-galactosidase activity (Fig. 1A), resembling the β-galactosidase pattern of Og2-lacZ transgenic mice (27Frendo J.L. Xiao G. Fuchs S. Franceschi R.T. Karsenty G. Ducy P. J. Biol. Chem. 1998; 273: 30509-30516Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). β-Galactosidase activity was observed only in the osteoblasts on trabecular bone near the growth plates and on cortical bone surfaces (Fig. 1, B, C, E, and F). No β-galactosidase activity was detected in the soft tissues, bone marrow, or chondrocytes, indicating that expression of Cre in Og2-Cre mice was highly specific for osteoblasts. Pups transheterozygous for the conditional null and null alleles of Bmpr1a, and hemizygous for the Og2-Cre transgene, were recovered after birth. As shown in Fig. 2A, they were smaller than their control littermates at 2 months of age. Smaller body size was recognizable as early as 3 weeks of age and became more prominent at 6 or 12 weeks (Fig. 2B). Their body weight remained below normal for up to 6 months. Because the proportion of the mature osteoblasts was too small for detection of the Cre-dependent recombination by Southern blot, floxed and recombined alleles were differentiated by PCR. All of the mice that carried the Og2-Cre transgene showed at least one recombined allele that had deleted exon 2 (Fig. 2C). Reduced Osteoblast Function in the Mutant Mice—Contact x-ray photography of 3-month-old mice showed no overt changes in bone shape compared with controls (Fig. 3A). However, irregular calcification was found, most prominently in femurs (Fig. 3, B and C, arrow). Histological analysis showed decreased bone trabeculae (Fig. 3, D and E) with no growth plate abnormalities. Osteopontin and osteocalcin were expressed normally in the mutant bones (data not shown). To investigate the cause of the altered bone formation, we performed a morphometric analysis of undecalcified histological sections (23Parfitt A.M. Drezner M.K. Glorieux F.H. Kanis J.A. Malluche H. Meunier P.J. Ott S.M. Recker R.R. J. Bone Miner. Res. 1987; 2: 595-610Crossref PubMed Scopus (4921) Google Scholar), which revealed a decrease in bone volume in the mutant mice that was about half of that in their control littermates (Fig. 3F). Bone formation rate was reduced in mutants in comparison with controls (Fig. 3G). In addition, the numbers of osteoblasts and osteoclasts in tibia and spine did not differ significantly between mutants and their controls (data not shown). Consistent with the morphometric analysis, in in vitro culture of bone marrow cells from mutant and control mice, the osteoblastic colonies derived from Bmpr1a fx/-,Og2-Cre(+) mice were smaller than those derived from control cells and stained poorly for mineral deposition (Fig. 4, A and B). Fewer alkaline phosphatase-positive colonies and von Kossa-positive colonies were observed in the culture derived from bone marrow cells in mutant mice (Fig. 4C). Taken together, the in vivo and in vitro analyses suggest that osteoblast-specific Bmpr1a disruption leads to less osteoblast function and loss of bone formation, resulting in decreased bone remodeling and decreased body size in mutant mice. Reduced Osteoclast Activity in Aged Mutant Mice—Although younger mutant mice (up to 6 months) weighed less than controls (Fig. 2), the difference became smaller as they got older (data not shown). Intriguingly, BMD in 10-month-old mutant mice was significantly higher than that of controls (Fig. 5A, WT/Sham and KO/Sham, B, and D). Because there were no significant differences in BMD observed at 3 months of age (data not shown), these findings suggested that loss of BMP signaling in osteoblasts might lead to down-regulation of osteoclast function as the mice aged. Histomorphometric analysis of femurs of 10-month-old mice confirmed the higher bone volume (BV/TV (bone volume per total volume)) in mutant mice compared with controls (Fig. 5F, WT/Sham and KO/Sham). Dynamic histomorphometric analysis with double calcein labeling documented that bone turnover (BFR/BS (bone formation rate per total bone surface)) is decreased in mutant mice (Fig. 5G, WT/Sham and KO/Sham), indicating that increased bone mass in mutant mice is due to decreased bone resorption. These results suggest that, in aged animals, loss of BMP signaling via BMPRIA in osteoblasts may lead to suppression of osteoclast function and bone resorption. To gain further insights into the role of BMPRIA and BMP signaling in adult bone metabolism, we evaluated the effects of ovariectomy (OVX) that activates bone turnover and osteoclastic bone resorption, leading to bone loss. Interestingly, the loss of BMD in the OVX group, compared with the sham operated group, was more significant in mutant mice (Fig. 5A). Histological observations agreed with the BMD findings (Fig. 5, B-E). More trabecular bone is observed in the distal femur of the mutant mice compared with the controls, and in both mutant and control mice, trabecular bone was severely reduced by OVX. Quantitative histomorphometric analysis confirmed these findings by documenting the significant reduction of bone volume (BV/TV) in OVX groups to Sham-operated groups with more significant effects of OVX observed in mutant mice (Fig. 5F). More significant bone loss induced by OVX in mutant mice likely results from the decreased osteoblast function, observed in vivo and in vitro analyses in young animals, that became evident in high bone turnover induced by OVX. Taken together, the increased bone mass and the greater degree of bone loss induced by OVX in the mutant mice suggest that the activity of osteoclasts as well as osteoblasts is reduced in the aged osteoblast-specific Bmpr1a-deficient mice, leading to the complex skeletal phenotype. To further investigate the above mentioned hypothesis, we used a bone organ culture system to evaluate the impact of ablation of Bmpr1a on the genes associated with osteoblasts and osteoclasts. Calvarias from aged mice, that were homozygous for floxed Bmpr1a, were treated with adenoviral Cre recombinase and effects of BMP4 on the expression of marker genes were assessed by real-time PCR. Cre-dependent deletion of Bmpr1a was confirmed by significant reduction of the levels of wild-type transcript (Fig. 6A) and induction of the Bmpr1a transcript lacking exon 2 (Fig. 6B). In the control culture, expression levels of TRAP, Mmp9, and Ctsk, lysosomal enzymes secreted from osteoclasts, in calvaria were all increased with BMP4 treatment. These results are consistent with the role of the BMPRIA signaling pathway in osteoclastic bone resorption postulated by the reduced bone resorption observed in mutant mice. In contrast, in calvaria following treatment with Cre recombinase that inactivates Bmpr1a, BMP4 treatment showed no effects on the levels of expression of TRAP, Mmp9, and Ctsk (Fig. 6, C-E). Basal levels of these enzymes were also reduced by inactivation of Bmpr1a. Interestingly, the expression of calcitonin receptor, a marker of osteoclast, was not induced by BMP4 nor regulated by treatment with Cre recombinase (data not shown), suggesting the specific effects of the BMP-BMPRIA signaling pathway in expression of lysosomal enzymes essential for osteoclastic bone resorption. Expression of RANKL that is expressed in osteoblasts to support osteoclast function was not changed by Cre treatment (data not shown). Similar results were observed by organ culture of tibia from the same animals (data not shown). Analysis of marker genes for osteoblasts, such as type I collagen or osteocalcin, did not show significant changes under these experimental conditions (data not shown). Our results show that signaling through the BMP type IA receptor in differentiated osteoblasts plays an important role in bone formation when mice are relatively young (>6 months of age). The mutant mice showed reduced body weight, lower bone volume, and reduced bone formation rate. This signal is apparently not be essential for osteoblast differentiation or proliferation but is important for the production of bone matrix by differentiated osteoblasts. Intriguingly, the differentiated osteoblast-specific disruption of the BMP type IA receptor leads to an opposite phenotype when mice become older (at 10 months of age). Bone volume in the mutant mice was higher than that of control littermates even though bone formation rate was still lower in the mutants. The mutant mice that were ovariectomized showed the same BMD and bone volume as the controls that were ovariectomized, suggesting that BMP signaling through the type IA receptor in the differentiated osteoblasts may be important for regulating osteoclast activity. This hypothesis is supported by the induction of lysosomal enzymes essential for osteoclastic bone resorption by BMP4 in calvarial organ culture that is abolished following inactivation of Bmpr1a. It has been shown that alteration of BMP signaling during embryogenesis affects skeletalgenesis (6Kingsley D.M. Bland A.E. Grubber J.M. Marker P.C. Russell L.B. Copeland N.G. Jenkins N.A. Cell. 1992; 71: 399-410Abstract Full Text PDF PubMed Scopus (412) Google Scholar, 7Storm E.E. Huynh T.V. Copeland N.G. Jenkins N.A. Kingsley D.M. Lee S.J. Nature. 1994; 368: 639-643Crossref PubMed Scopus (743) Google Scholar, 8Luo G. Hofmann C. Bronckers A.L. Sohocki M. Bradley A. Karsenty G. Genes Dev. 1995; 9: 2808-2820Crossref PubMed Scopus (878) Google Scholar, 9Dudley A.T. Lyons K.M. Robertson E.J. Genes Dev. 1995; 9: 2795-2807Crossref PubMed Scopus (967) Google Scholar, 28Solloway M.J. Dudley A.T. Bikoff E.K. Lyons K.M. Hogan B.L. Robertson E.J. Dev. Genet. 1998; 22: 321-339Crossref PubMed Scopus (306) Google Scholar, 29Katagiri T. Boorla S. Frendo J.L. Hogan B.L. Karsenty G. Dev. Genet. 1998; 22: 340-348Crossref PubMed Scopus (106) Google Scholar, 30Thomas J.T. Lin K. Nandedkar M. Camargo M. Cervenka J. Luyten F.P. Nat. Genet. 1996; 12: 315-317Crossref PubMed Scopus (349) Google Scholar, 31Thomas J.T. Kilpatrick M.W. Lin K. Erlacher L. Lembessis P. Costa T. Tsipouras P. Luyten F.P. Nat. Genet. 1997; 17: 58-64Crossref PubMed Scopus (288) Google Scholar). Gene disruption of the type IB receptor for BMPs (Bmpr1b) shows defects in the proximal and middle phalanges (32Yi S.E. Daluiski A. Pederson R. Rosen V. Lyons K.M. Development (Camb.). 2000; 127: 621-630PubMed Google Scholar, 33Baur S.T. Mai J.J. Dymecki S.M. Development (Camb.). 2000; 127: 605-619PubMed Google Scholar), which resembles that in Gdf5 mutant mice, brachypodism (7Storm E.E. Huynh T.V. Copeland N.G. Jenkins N.A. Kingsley D.M. Lee S.J. Nature. 1994; 368: 639-643Crossref PubMed Scopus (743) Google Scholar). A transgenic mouse line that expresses a dominant-negative form of Bmpr1b in an osteoblast-specific manner shows more severe abnormalities in the skeletal system than Bmpr1b-deficient mice such as reduced BMD, bone volume, and bone formation rate up to 3 months after birth (34Zhao M. Harris S.E. Horn D. Geng Z. Nishimura R. Mundy G.R. Chen D. J. Cell Biol. 2002; 157: 1049-1060Crossref PubMed Scopus (156) Google Scholar). A transgenic mouse line that expresses Noggin, one of the BMP antagonists, in a differentiated osteoblast-specific manner shows reduced bone formation up to 6 months after birth (35Devlin R.D. Du Z. Pereira R.C. Kimble R.B. Economides A.N. Jorgetti V. Canalis E. Endocrinology. 2003; 144: 1972-1978Crossref PubMed Scopus (161) Google Scholar). Recently, linkage of osteoporosis to chromosome 20p12 where BMP2 resides was demonstrated in a Danish population (36Styrkarsdottir U. Cazier J.-B. Kong A. Rolfsson O. Larsen H. Bjarnadottir E. Johannsdottir V.D. Sigurdardottir M.S. Bagger Y. Christiansen C. Reynisdottir I. Grant S.F.A. Jonasson K. Frigge M.L. Gulcher J.R. Sigurdsson G. Stefansson K. PLoS Biol. 2003; 1: E69Crossref PubMed Scopus (221) Google Scholar). These results suggest that BMP signaling in the osteoblasts plays important roles in bone formation during younger stages of life, consistent to the results presented here. It has been reported that osteoblasts play essential roles in supporting the generation and activity of osteoclasts that are critical for bone resorption (37Takahashi N. Akatsu T. Udagawa N. Sasaki T. Yamaguchi A. Moseley J.M. Martin T.J. Suda T. Endocrinology. 1998; 123: 2600-2602Crossref Scopus (856) Google Scholar). The stimulatory effects of BMP4 in lysosomal enzymes expressed in osteoclasts in calvarial organ culture is in agreement with previous reports documenting the stimulatory effects of BMPs on osteoclast function in vitro (38Hentunen T.A. Lakkakorpi P.T. Tuukkanen J. Lehenkari P.P. Sampath T.K. Vaananen H.K. Biochem. Biophys. Res. Commun. 1995; 209: 433-443Crossref PubMed Scopus (38) Google Scholar, 39Koide M. Murase Y. Yamato K. Noguchi T. Okahashi N. Nishihara T. Biochem. Biophys. Res. Commun. 1999; 259: 97-102Crossref PubMed Scopus (88) Google Scholar, 40Abe E. Yamamoto M. Taguchi Y. Lecka-Czernik B. O'Brien C.A. Economides A.N. Stahl N. Jilka R.L. Manolagas S.C. J. Bone Miner. Res. 2000; 15: 663-673Crossref PubMed Scopus (274) Google Scholar, 41Kaneko H. Arakawa T. Mano H. Kaneda T. Ogasawara A. Nakagawa M. Toyama Y. Yabe Y. Kumegawa M. Hakeda Y. Bone. 2000; 27: 479-486Crossref PubMed Scopus (276) Google Scholar, 42Itoh K. Udagawa N. Katagiri T. Iemura S. Ueno N. Yasuda H. Higashio K. Quinn J.M. Gillespie M.T. Martin T.J. Suda T. Takahashi N. Endocrinology. 2001; 142: 3656-3662Crossref PubMed Scopus (166) Google Scholar). BMPs may act directly on osteoclasts (41Kaneko H. Arakawa T. Mano H. Kaneda T. Ogasawara A. Nakagawa M. Toyama Y. Yabe Y. Kumegawa M. Hakeda Y. Bone. 2000; 27: 479-486Crossref PubMed Scopus (276) Google Scholar) or alternatively via osteoblasts (40Abe E. Yamamoto M. Taguchi Y. Lecka-Czernik B. O'Brien C.A. Economides A.N. Stahl N. Jilka R.L. Manolagas S.C. J. Bone Miner. Res. 2000; 15: 663-673Crossref PubMed Scopus (274) Google Scholar) because both types of cells express receptors for BMPs. Although we cannot exclude the possible role for Cre-dependent inactivation of Bmpr1a in osteoclasts in the loss of BMP induction of lysozomal enzymes in organ culture, these results along with in vivo results suggest that BMP signaling in osteoblasts controls bone resorption by supporting osteoclast function in aged mice. Our results suggest that BMP functions in differentiated osteoblasts are altered in an age-dependent manner, initially for bone formation at younger ages, then more predominantly for supporting osteoclast function as animals age. We thank Gerard Karsenty for Og2-Cre mice; Kimi Araki and Jun-ichi Miyazaki for the CAT-lacZ reporter mouse; Gideon A. Rodan, Donald Kimmel, and Kazuhisa Nakashima for helpful suggestions; Trisha Castranio, Satoshi Kishgiami, John Klingensmith, Ray Manas, and E. Mitch Eddy for helpful comments on the manuscript; Matt Erhinger, Paula King, and Mike Streiker for maintenance of the mouse colony; and Yoshiko, Kanade, and Ryoji Mishina for encouragement.