Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Platelet-derived Growth Factor and Reactive Oxygen Species (ROS) Regulate Ras Protein Levels in Primary Human Fibroblasts via ERK1/2

2005; Elsevier BV; Volume: 280; Issue: 43 Linguagem: Inglês

10.1074/jbc.m502851200

ISSN

1083-351X

Autores

Silvia Svegliati, Raffaella Cancello, Paola Sambo, Michele Maria Luchetti, Paolo Paroncini, Guido Orlandini, Giancarlo Discepoli, Roberto Paternò, Mariarosaria Santillo, Concetta Cuozzo, Silvana Cassano, Enrico V. Avvedimento, Armando Gabrielli,

Tópico(s)

Cell death mechanisms and regulation

Resumo

The levels of Ras proteins in human primary fibroblasts are regulated by PDGF (platelet-derived growth factor). PDGF induced post-transcriptionally Ha-Ras by stimulating reactive oxygen species (ROS) and ERK1/2. Activation of ERK1/2 and high ROS levels stabilize Ha-Ras protein, by inhibiting proteasomal degradation. We found a remarkable example in vivo of amplification of this circuitry in fibroblasts derived from systemic sclerosis (scleroderma) lesions, producing vast excess of ROS and undergoing rapid senescence. High ROS, Ha-Ras, and active ERK1/2 stimulated collagen synthesis, DNA damage, and accelerated senescence. Conversely ROS or Ras inhibition interrupted the signaling cascade and restored the normal phenotype. We conclude that in primary fibroblasts stabilization of Ras protein by ROS and ERK1/2 amplifies the response of the cells to growth factors and in systemic sclerosis represents a critical factor in the onset and progression of the disease. The levels of Ras proteins in human primary fibroblasts are regulated by PDGF (platelet-derived growth factor). PDGF induced post-transcriptionally Ha-Ras by stimulating reactive oxygen species (ROS) and ERK1/2. Activation of ERK1/2 and high ROS levels stabilize Ha-Ras protein, by inhibiting proteasomal degradation. We found a remarkable example in vivo of amplification of this circuitry in fibroblasts derived from systemic sclerosis (scleroderma) lesions, producing vast excess of ROS and undergoing rapid senescence. High ROS, Ha-Ras, and active ERK1/2 stimulated collagen synthesis, DNA damage, and accelerated senescence. Conversely ROS or Ras inhibition interrupted the signaling cascade and restored the normal phenotype. We conclude that in primary fibroblasts stabilization of Ras protein by ROS and ERK1/2 amplifies the response of the cells to growth factors and in systemic sclerosis represents a critical factor in the onset and progression of the disease. Although the detailed molecular nature of the link between oncogenesis and senescence remains obscure, they appear to be two sides of the same coin. Ras and reactive oxygen species (ROS) 3The abbreviations used are:ROSreactive oxygen speciesPKAcAMP-dependent protein kinasePDGFplatelet-derived growth factorPBSphosphate-buffered salineGSTglutathione S-transferaseFCSfetal calf serumFACSfluorescence-activated cell sorterNACN-acetyl cysteineERKextracellular signal-regulated kinaseDPIdiphenylene iodonium are two important players that underlie both phenotypes (transformation and senescence), but their effects are somewhat enigmatic. For example, in mammalian cells, expression in fibroblasts of the oncogenic allele of ras (v-Ha-Ras) triggers rapid senescence (1Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3994) Google Scholar). Also, ROS mediate apoptosis, DNA damage (2Chang H. Oehrl W. Elsner P. Thiele J.J. Free Radic. Res. 2003; 37: 655-663Crossref PubMed Scopus (66) Google Scholar), RNA synthesis (3Chen K.C. Zhou Y. Xing K. Krysan K. Lou M.F. Exp. Eye Res. 2004; 78: 1057-1067Crossref PubMed Scopus (69) Google Scholar), as well as growth inhibition (4Pani G. Colavitti R. Bedogni B. Anzevino R. Borrello S. Galeotti T. J. Biol. Chem. 2000; 275: 38891-38899Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). reactive oxygen species cAMP-dependent protein kinase platelet-derived growth factor phosphate-buffered saline glutathione S-transferase fetal calf serum fluorescence-activated cell sorter N-acetyl cysteine extracellular signal-regulated kinase diphenylene iodonium ROS and Ras signaling are linked. In the yeast Saccharomyces cerevisiae, cAMP-PKA signals are located downstream of Ras. However, constitutively active Ras2Val19 affects endogenous ROS production and oxygen consumption in a PKA-independent way (5Hlavata L. Aguilaniu H. Pichova A. Nystrom T. EMBO J. 2003; 22: 3337-3345Crossref PubMed Scopus (95) Google Scholar). Ras isoforms in higher eukaryotes are uncoupled from cAMP-PKA signaling, and control many aspects of redox metabolism. We and others have presented data showing that Ha-Ras induced production of superoxide by stimulating the membrane NADPH oxidase complex via ERK1/2 (6Irani K. Xia Y. Zweier J.L. Sollott S.J. Der C.J. Fearon E.R. Sundaresan M. Finkel T. Goldschmidt-Clermont P.J. Science. 1997; 275: 1649-1652Crossref PubMed Scopus (1441) Google Scholar, 7Santillo M. Mondola P. Seru R. Annella T. Cassano S. Ciullo I. Tecce M.F. Iacomino G. Damiano S. Cuda G. Paterno R. Martignetti V. Mele E. Feliciello A. Avvedimento E.V. Curr. Biol. 2001; 11: 614-619Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 8Seru R. Mondola P. Damiano S. Svegliati S. Agnese S. Avvedimento E.V. Santillo M. J. Neurochem. 2004; 91: 613-622Crossref PubMed Scopus (40) Google Scholar). On the other hand, we have found that Ki-Ras-stimulated mitochondrial MnSOD via ERK1/2 and reduced cellular ROS levels (7Santillo M. Mondola P. Seru R. Annella T. Cassano S. Ciullo I. Tecce M.F. Iacomino G. Damiano S. Cuda G. Paterno R. Martignetti V. Mele E. Feliciello A. Avvedimento E.V. Curr. Biol. 2001; 11: 614-619Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Different anchors may dictate different membrane compartments, localizing Ha and Ki-Ras in proximity of specific substrates (9Yan Z. Chen M. Perucho M. Friedman E. J. Biol. Chem. 1997; 272: 30928-30936Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 10Prior I.A. Hancock J.F. J. Cell Sci. 2001; 114: 1603-1608Crossref PubMed Google Scholar). We note, also, an important difference between the oncogenic activated form and the wild-type version of ras genes. This is illustrated by the opposing effects of these forms on life span of S. cerevisiae: deletion of ras2 or expression of the active RASVal19 allele decreased life span; overexpression of yeast wild-type RAS2 extended life span (11Sun J. Kale S.P. Childress A.M. Pinswasdi C. Jazwinski S.M. J. Biol. Chem. 1994; 269: 18638-18645Abstract Full Text PDF PubMed Google Scholar). In this work, we present a novel level of regulation of Ras proteins, dependent on ERK1/2 signaling. Specifically, we have found that PDGF and ROS induce Ha-Ras in primary fibroblasts. This has revealed a novel and hitherto unknown pathway, which links ROS to Ras protein levels through ERK1/2. We find a remarkable example of this circuitry in vivo in cells derived from patients affected by systemic sclerosis. This signaling pathway is initiated by stimulation of PDGF receptor and maintained by ROS-ERK1/2 signals. Systemic sclerosis cells produce excess of ROS (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar) and maintain active Ras-ERK1/2. These cells accumulate DNA damage, activate ROS-dependent genes and become prone to stress-induced apoptosis. Inhibition of ROS, Ras, or ERK1/2 down-regulates the loop and restores the normal phenotype in systemic sclerosis fibroblasts. These data point to Ras a key sensor of cellular ROS and suggest a molecular tool for the diagnosis and therapy of systemic sclerosis. Reagents—Dulbecco's modified Eagle's medium, FCS, l-glutamine, and pen-strept-anfotB solution were obtained from Invitrogen, Life Technologies. Recombinant platelet-derived growth factor BB (PDGF-BB) was purchased from Peprotech (Rocky Hill, NJ); FTI-277, farnesyl protein transferase inhibitor H-Ampamb-Phe-Met-OH, and PD 98059, were purchased from Calbiochem. Genistein was obtained from ICN Biomedicals (Aurora, OH). Anti-Ha-Ras (F235 or SC520), anti-Ki-Ras (F234), anti-pan-Ras (F132), and anti-Rac1 antibodies were purchased from Santa Cruz Biotechnology. Anti-phospho-p44/42 MAP kinase, anti-phospho-SAPK/JNK and anti-AKT from Cell Signaling Technology (Beverly, MA). Anti-H2AX and anti-p21WAF antibodies were obtained from Upstate Biotechnology (Charlottesville, VA); diphenylene iodonium (DPI) from Alexis Biomedicals (Lansen, CH), N-acetyl-l-cysteine (NAC), and cycloheximide from Sigma. U0126 from Promega (Madison, WI) and 2′,7′-dichlorofluorescein diacetate (DCFH-DA) from Molecular Probes (Eugene, OR). The following plasmids were employed: dominant-negative Ha-rasN17, V12 positive variant of human Ha-ras and V12 positive variant of human Ki-Ras (7Santillo M. Mondola P. Seru R. Annella T. Cassano S. Ciullo I. Tecce M.F. Iacomino G. Damiano S. Cuda G. Paterno R. Martignetti V. Mele E. Feliciello A. Avvedimento E.V. Curr. Biol. 2001; 11: 614-619Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar), dominant-negative Rac variant (Rac1N17), dominant-positive Rac variant (Rac1V12) (13Suzukawa K. Miura K. Mitsushita J. Resau J. Hirose K. Crystal R. Kamata T. J. Biol. Chem. 2000; 275: 13175-13178Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar), dominant-negative MEK variant pBabe-MKK-S217A (rat GenBank™ z30163). The cDNA for collagen α1(I) (Hf677 clone) and for collagen α2(I) (Hf32 clone) were kindly donated by Dr. Ch. M. Lapiere (Laboratorie de Biologie des Tissues Conjonctifs, University of Liege, Belgium). Primary Fibroblasts—Human skin fibroblasts were obtained from punch biopsies taken from the forearms of normal volunteers and from the involved skin of patients who fulfilled the preliminary criteria of the American Rheumatism Association for the diagnosis of systemic sclerosis as described (14Sambo P. Jannino L. Candela M. Salvi A. Donini M. Dusi S. Luchetti M.M. Gabrielli A. J. Investig. Dermatol. 1999; 112: 78-84Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Fibroblasts between the fourth and the sixth subpassage were used for all experiments. Flow Cytometric Analysis with Anti-Ha-Ras Antibody—Cells were grown to semiconfluency in 60-mm culture dishes. After trypsin detachment, 5 × 105 cells were suspended in 1 ml of phosphate-buffered saline (PBS) and fixed overnight with 1% formaldehyde at room temperature. Next, cells were permeabilized with 0.1% Triton X-100 for 40 min at 4 °C, washed four times with 2 ml of PBS containing 2% FCS, 0.01% NaN3, 0.1% Triton X-100 (buffer A), and incubated for 45 min at 4 °C with 1:50 dilution of monoclonal and polyclonal anti-Ha-Ras antibodies (Santa Cruz Biotechnology). The cells were then washed twice with the same buffer and incubated for 45 min at 4 °C with Cy2-conjugated anti-mouse IgG antibodies (Amersham Biosciences) at 1:50 dilution. Control cells were incubated with Cy2-conjugated anti-mouse IgG antibodies alone. After two washes in buffer A, cells were resuspended in PBS and analyzed by flow cytometry using FACScan (BD, Heidelberg, Germany) and WinMDI software. ROS Determination—Fluorometric determination of intracellular ROS generated by fibroblasts was estimated after loading the cells with DCFH-DA (10 μm) for 15 min at 37 °C before assessing DCF fluorescence level (15Cuda G. Paterno R. Ceravolo R. Candigliota M. Perrotti N. Perticone F. Faniello M.C. Schepis F. Ruocco A. Mele E. Cassano S. Bifulco M. Santillo M. Avvedimento E.V. Circulation. 2002; 105: 968-974Crossref PubMed Scopus (84) Google Scholar). Superoxide anion release was estimated using the superoxide dismutase-inhibitable cytochrome c reduction (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar). H2O2 release from fibroblasts into the overlying medium was assayed using a modification of the method of Valletta and Berton (16Valletta E.A. Berton G. J. Immunol. 1987; 138: 4366-4373PubMed Google Scholar). Oxidative activity imaging in living, transfected cells was evaluated as described (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar, 17Orlandini G. Ronda N. Gatti R. Gazzola G.C. Borghetti A. Methods Enzymol. 1999; 307: 340-350PubMed Google Scholar). Immunoblotting—Cell culture plates were lysed with 0.3 ml of cold radioimmune precipitation assay buffer (1× PBS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 2 mm sodium orthovanadate, 2 μg/ml aprotinin, 1 mm phenylmethylsulfonyl fluoride) and processed as described (14Sambo P. Jannino L. Candela M. Salvi A. Donini M. Dusi S. Luchetti M.M. Gabrielli A. J. Investig. Dermatol. 1999; 112: 78-84Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Ras Immunoprecipitation—Ras proteins were immunoprecipitated from cultured fibroblasts with polyclonal anti-pan Ras antibody (Santa Cruz Biotechnology) following recommended procedures from the manufacturer. Immunocomplexes were isolated, electrophoresed, immunoblotted with anti-Ha-Ras or -Ki-Ras antibodies, and revealed by chemiluminescence (Amersham Biosciences). Immunofluorescence—Fibroblasts, cultured on Lab-Tek chamber glass slides (Nalge-Nunc) and starved 48 h before stimulation or addition of inhibitors, were fixed, permeabilized, and stained with a monoclonal antibody against Ha-Ras or Ki-Ras and then with a tetramethylrhodamine isothiocyanate-(TRITC; Molecular Probes, PoortGebouw, The Nederlands) conjugated secondary antibody. Slides were mounted with Vectorshield (H-100; Vector, Burlingame, CA) and examined by fluorescence microscope. Acquired images were analyzed using the Laser Sharp Processing Bio-Rad software (version 3.2). All images from different slides condition were acquired in a blinded fashion. Ras Activation Assay—Cells were washed in ice-cold PBS and lysed with 0.5 ml per plate of lysis buffer (20 mm Hepes, pH 7.4, 1% Nonidet P-40, 150 mm NaCl, 10 mm MgCl2, 10% glycerol, 1 mm EDTA, 1 mm sodium vanadate, 10 μg/ml leupeptin, and 10 μg/ml aprotinin). Lysates were cleared by centrifugation (13,000 rpm at 4 °C) and diluted to 1 mg/ml with lysis buffer. GST-RBD expression in transformed Escherichia coli was induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside for 1-2 h, and fusion protein was purified on glutathione-Sepharose beads. The beads were washed in a solution containing 20 mm Hepes, pH 7.4, 120 mm NaCl, 10% glycerol, 0.5% Nonidet P-40, 2 mm EDTA, 1 mm sodium vanadate, 10 μg/ml leupeptin, and 10 μg/ml aprotinin. For affinity precipitation, lysates were incubated with GST-RBD prebound to glutathione-Sepharose (30 ml of packed beads) for 60 min at 4 °C with rocking. Bound proteins were eluted with SDS-PAGE sample buffer, resolved on 12% acrylamide gels and subjected to Western blotting. Blots were probed with anti-Ras, clone Ras10 (Upstate Biotechnology). Transfection—For transfection experiments, confluent fibroblasts were plated in 100-mm dishes in culture medium. After 24 h, the medium was discarded, replaced with fresh culture medium, and the cells transfected. Transfection experiments were carried out in duplicate using a liposomal method (Effectene, Qiagen, Hilden, Germany). In selected experiments the recombinant plasmid pGbC1A2-P obtained by cloning the promoter of human type I collagen α2 chain gene (COL1A2) (20Tuveson D.A. Shaw A.T. Willis N.A. Silver D.P. Jackson E.L. Chang S. Mercer K.L. Grochow R. Hock H. Crowley D. Hingorani S.R. Zaks T. King C. Jacobetz M.A. Wang L. Bronson R.T. Orkin S.H. DePinho R.A. Jacks T. Cancer Cell. 2004; 5: 375-387Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar) was co-transfected with either pS3CAT carrying human catalase gene (a kind gift of Dr. Irani, The Johns Hopkins, Baltimore) or a control vector following the procedure described above. The luciferase activities of the samples were measured with a TD-20/20 luminometer (Turner Design) and the ratio of Renilla to firefly luciferase values was used to normalize the co-transfection experiments. Apoptosis Assay—Normal and scleroderma fibroblasts were grown to 80-90% confluence and treated for 2 h with different concentrations of H2O2. When needed, cells were preincubated 30 min with PD 98059 (40 μmol/liter). Six hours after the removal of the stimulus, apoptosis was detected by FACS analysis using annexin V-Cy3 (Clontech, Palo Alto, CA). RNA Isolation and Northern Analysis—Total cellular RNA was extracted using the RNeasy Mini kit (Qiagen). Ten micrograms total RNA was then used for Northern blot analysis following a described procedure (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar). RT-PCR of Ha- and Ki-Ras mRNA—Total RNA and cDNA synthesis was performed as described (18Feliciello A. Gallo A. Mele E. Porcellini A. Troncone G. Garbi C. Gottesman M.E. Avvedimento E.V. J. Biol. Chem. 2000; 275: 303-311Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). 2 μl of cDNA products (derived from 2.5 μg of total RNA) were amplified with 1 unit of Ampli Taq Gold (PE Applied Biosystems) in the buffer provided by the manufacturer, which contains no MgCl2, and in the presence of the specific primers for Ha-, Ki-ras and actin genes (see below). The amount of dNTPs carried over from the reverse transcription reaction is fully sufficient for further amplification. Reactions were carried out in the GeneAmp PCR system 9600. A first cycle of 10 min at 95 °C, 45 s at 65 °C, and 1 min at 72 °C was followed by 45 s at 95 °C, 45 s at 65 °C, and 1 min at 72 °C for 30 cycles. The conditions were chosen so that none of the cDNAs analyzed reached a plateau at the end of the amplification protocol, i.e. they were in the exponential phase of amplification, and that the two sets of primers used in each reaction did not compete with each other. Each set of reactions always included a no-sample negative control. We usually performed a negative control containing RNA instead of cDNA to rule out genomic DNA contamination. The following primers were used: Ki-ras long, left primer: acatctctttgctgcccaat; right primer: gagcgagactctgacaccaa. Ki-ras short, left primer: tcgacacagcaggtcaagag; right primer: aggcatcatcaacaccctgt. Ha-ras, left primer: ccagctgatccagaaccatt; right primer: aggtctcgatgtaggggatg. Cytogenetic Analysis—Cytogenetic studies were performed on fibroblasts before and after a 24-h incubation with FTI-277 (20 μm). Fibroblasts were cultured on cover glasses placed in a 35-mm Petri dish. After adding 2 ml of Chang Medium® B the dishes were incubated for 48 h in a 5% CO2 incubator at 37 °C and the cultures harvested after adding Colcemid solution (0,1 μg/ml) for 90 min. The cover glasses were fixed and Q-banded following standard procedures. The evaluation was performed using a fluorescence microscope Zeiss Axioplan 2. The images were captured with a couple-charged camera device connected to a personal computer running MacKtype 5.4 software (Powergene Olympus Italy). Chromosome identification and karyotype designation were made following the criteria of the International System for Human Cytogenetic Nomenclature (ISCN). Chromatin Extraction and Immunoblot for Phosphorylated H2AX—Cell culture plates were lysed with 0.2 ml of buffer (120 mm NaCl, 40 mm Hepes, 5 mm MgCl2, 1 mm EGTA, 0.5 mm EDTA, 0.6% Triton X-100, 2 mm sodium orthovanadate, 2 μg/ml aprotinin, 1 mm phenylmethylsulfonyl fluoride) and centrifuged at 14,000 × g for 15 min at 4 °C, and the protein content was measured with the Bio-Rad protein assay (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar). The pellet was resuspended in 40 ml of buffer with 80-100 units of DNase, and incubated for 15 min on ice. Extracts were denatured and resolved in 12% SDS-PAGE. Immunoblot with specific antibodies was carried out as described above. Statistical Analysis—Data are expressed as mean ± 1 S.D. Mean values were compared using Student's paired and unpaired t test. p values less than 0.05 were considered significant. All values are two-tailed. Induction of Ras Protein Levels by PDGF—In quiescent primary human fibroblasts Ha-Ras protein was almost undetectable. To determine precisely the levels of Ki- and Ha-Ras protein, we immunoprecipitated total cell proteins, solubilized in 0.1% SDS (radioimmune precipitation assay buffer), with pan Ras antibody. The immunoprecipitates were separated by gel electrophoresis and blotted with specific Ras isoform antibodies. Stimulation of the cells with PDGF for 15 min was sufficient to induce Ha-Ras protein, which decreased to the initial level, 120 min after stimulation, notwithstanding the presence of the growth factor. Ki-Ras protein levels were also stimulated by PDGF but less efficiently and with a different kinetics. Ki-Ras was poorly induced and decayed slowly (3 h of PDGF stimulation) (Fig. 1A). Ha-Ras induction was also visible by fluorescence microscopy (Fig. 1B) or FACS analysis with anti-Ha-Ras monoclonal or polyclonal specific antibodies (Fig. 1C). Treatment of the cells with the translational inhibitor cycloheximide did not prevent Ha-Ras induction by PDGF (Fig. 1D). Moreover, PDGF treatment did not change mRNA levels of Ki- and Ha-Ras (Fig. 1E). To rule out that Ha-Ras induced by PDGF was an artifact, caused by association of the protein with the lipid-rich membrane fractions and consequently was not efficiently extracted by immunoprecipitation procedures, we treated the cells with 50 mm cyclodextrin to deplete cholesterol before immunoprecipitation. Treatment with cyclodextrin did not abolish PDGF induction of Ha-Ras (Fig. S1, supplemental material). Taken together, these data indicate that the levels of Ha- and Ki-Ras proteins are post-translationally regulated by PDGF in primary fibroblasts. PDGF Stimulation of ROS and ERK1/2—PDGF activates ROS production by stimulating NADPH oxidase (3Chen K.C. Zhou Y. Xing K. Krysan K. Lou M.F. Exp. Eye Res. 2004; 78: 1057-1067Crossref PubMed Scopus (69) Google Scholar, 19Kreuzer J. Viedt C. Brandes R.P. Seeger F. Rosenkranz A.S. Sauer H. Babich A. Nurnberg B. Kather H. Krieger-Brauer H.I. Faseb. J. 2003; 17: 38-40Crossref PubMed Scopus (72) Google Scholar). The kinetics of ROS production following PDGF stimulation replicated that of Ha-Ras induction (Figs. 1 and 2A). To determine if ROS were involved in Ha-Ras induction by PDGF, we treated the cells with a nonspecific ROS scavenger (NAC) or NADPH oxidase inhibitor (DPI) and measured Ha-Ras levels in the presence or absence of PDGF. Fig. 2B shows that NAC and DPI significantly inhibited PDGF induced Ha-Ras levels. This is also shown by immunofluorescence with anti-Ha-Ras antibodies (Fig. 2C). The kinetics of Ha-Ras induction by PDGF in normal cells replicated also ERK1/2 activation profile (data not shown), suggesting a relation between MEK-ERK1/2 and induction of Ha-Ras. To get an insight into this process, we measured Ha-Ras in cells pretreated with a chemical inhibitor of ERK1/2 signaling (PD 98059), which inhibits MEK (MAPKK), a kinase located upstream of ERK1/2 (MAPK). Treatment of the cells with PD98059 inhibited Ha-Ras induction by PDGF (Fig. 2D). In the same extracts, subjected to immunoprecipitation with anti-Ras antibodies, we measured PDGF receptor. Fig. 2D shows that PDGF treatment down-regulated the receptor, independently on ERK1/2 activation (Fig. 2D). To determine if ERK1/2 activation by PDGF was also sensitive to ROS depletion, we treated the cells with PDGF in the presence of a general ROS scavenger (NAC) or the NADPH oxidase inhibitor (DPI). Fig. 2E shows that ERK1/2 activated by PDGF was sensitive to NAC and DPI, indicating that ROS depletion interfered with ERK1/2 activation by PDGF. However, we noticed that a fraction of ERK1/2 induced by PDGF was resistant to NAC or DPI (Fig. 2E). ROS Induce Ha-Ras Level—The data presented above indicate that PDGF via ROS and ERK1/2 induce Ha-Ras protein levels in primary fibroblasts. To investigate the mechanism and the link between PDGF and ROS, we stimulated the cells with H2O2 in the presence of chemical and biological inhibitors of ERK1/2 signaling. To this end, we employed 1) PD 98059 and U0126 (2 h and 15 min of incubation, respectively), which inhibit MEK (MAPKK); and 2) a dominant-negative MEK variant that inhibits cellular MEK (see "Materials and Methods"). The results, shown in Fig. 3, A-C, demonstrate that induction of Ha-Ras by H2O2 was abolished by MEK inhibition. To confirm that H2O2 was down-stream PDGF, we treated the cells with genistein, a tyrosine kinase inhibitor, in the presence of PDGF or H2O2. The data shown in Fig. 3D indicate that H2O2 was a powerful inducer of Ha-Ras, also in the presence of genistein. As expected, the drug inhibited the induction of Ha-Ras by PDGF. However, longer incubation periods (90 min) in the presence of genistein inhibited Ha-Ras and ERK1/2 induced by H2O2, indicating that long term effects of H2O2 required active PDGF receptor (data not shown). Taken together the data, illustrated in Figs. 2 and 3, indicate that PDGF via ERK1/2 and via ROS induced Ha-Ras protein. ROS are downstream the PDGF receptor, because they induced Ha-Ras independently on the activation of the receptor. Down-regulation of ERK1/2 (Figs. 2, D and E and 3) reduced Ha-Ras levels. Maintaining ERK1/2 high, by expressing constitutively active Ha-Ras or a dominant-positive MEK protein, ROS production was high and Ha-Ras did not decay (Fig. S2B, supplemental material). Only Ha-Ras was stabilized, since Ki-Ras levels were marginally affected by ERK1/2 inhibition in primary fibroblasts. More importantly, Ha-Ras stabilization was peculiar to primary cells, because immortalized cells such as 3T3 fibroblasts, CHO, PC12, and COS7 contained stable and high levels of Ha-Ras, which were insensitive to ERK1/2 inhibition. 4S. Cassano, unpublished observation. Also, expression of constitutive MEK-ERK2 or prolonged treatment of fibroblasts with H2O2 did not change Ha-Ras mRNA levels (Fig. S3, supplementary material). The data shown above do not clearly indicate the mechanism responsible for Ha-Ras stabilization induced by PDGF-ROS-ERK1/2. To this end, we treated the cells with MG132, a widely used proteasome inhibitor and monensin, a toxin known to inhibit receptor recycling through the inhibition of endosome acidification. Fig. 3E shows that MG132 induced Ha-Ras, and its effect was not additive when administered with PDGF or H2O2. Conversely, monensin had no effect alone or with PDGF or H2O2 on Ha-Ras levels. Under the same conditions, Ki-Ras or PDGFR protein levels were not influenced by MG132 treatment (Fig. 3F). Amplification of ROS-Ras Signaling in Vivo in Scleroderma Fibroblasts—To determine if the signaling pathway connecting ROS to Ras was relevant in vivo, we took advantage of fibroblasts derived from patients affected by systemic sclerosis. These cells produce high levels of ROS (12Sambo P. Baroni S.S. Luchetti M. Paroncini P. Dusi S. Orlandini G. Gabrielli A. Arthritis Rheum. 2001; 44: 2653-2664Crossref PubMed Scopus (213) Google Scholar) and are subjected to constitutive stimulation in vivo of PDGF signaling for the presence in the serum of patients of stimulating anti-PDGF receptor antibodies. 5S. Svegliati, M. R. Santillo, F. Bevilacqua, M. Luchetti, T. Spadoni, M. Mancini, A. Funaro, A. Kazlavskas, V. E. Avvedimento, and A. Gabrielli, submitted manuscript. Fig. 4A shows that three fibroblast lines derived from these patients contain high ROS, superoxide, and H2O2 levels. ROS accumulation was severely inhibited by farnesyl transferase and MEK inhibitors (Fig. 4A). Moreover, these cells contained higher levels of Ha-Ras protein, compared with normal controls (Fig. 4B). Ras activity was also increased relative to normal control cells (Fig. 4C). We have recently completed the analysis of 46 patients affected by systemic sclerosis, and in all cases the ratio Ha/Ki protein levels was higher than 2. 5S. Svegliati, M. R. Santillo, F. Bevilacqua, M. Luchetti, T. Spadoni, M. Mancini, A. Funaro, A. Kazlavskas, V. E. Avvedimento, and A. Gabrielli, submitted manuscript. The analysis of downstream Ras effectors (AKT and ERK1/2) or other stress kinases (JNK) indicated that only ERK1/2 were selectively activated (Fig. 4D). ROS, Ras, and ERK1/2 activation were linked, because MEK inhibitors, ROS scavengers, or farnesyl transferase inhibitors were able to reduce Ras P-ERK1/2 and ROS levels (Figs. 3, A and B and 4A). ROS, Ha-Ras and active ERK1/2 slowly decayed in cells cultured in low serum and in 1-2 days returned to the baseline (data not shown). Biological Consequences of Ha-Ras Stabilization in Vivo Are High ROS, High ERK, DNA Damage, Collagen Synthesis, and Senescence—We next asked if ROS-Ras amplification was affecting the phenotype of these cell lines. To this end, we determined: 1) activation of DNA damage checkpoints and chromosomal alterations; 2) stress-induced apoptosis; 3) activation of transcription of collagen genes by ROS. Fig. 5 shows that scleroderma cells contained: 1) activated ATM, assayed by phosphorylation of histone H2AX; 2) accumulation of p21 WAF (Fig. 5A), and 3) damaged chromosomes (Fig. 5B). The chromosomal aberrations were present in vivo before the expansion in culture and were continuously generated in culture. These alterations were amplified by ROS and resulted in negative selection of these cells (data not shown). This explains why the number of altered metaphases was significantly reduced by incubating the cells with farnesyl transferase inhibitors or ROS scavengers during the first and second day of culture (Fig. 5B). These cells were extremely sensitive to oxidative stress-induced apoptosis, which was inhibited by pretreatment with MEK inhibitor, PD98059 (Fig. 5C). Finally, transcription of collagen genes, which was exquisitely sensitive to ROS, was greatly stimulated (Fig. 5, D and E). All these features were inhibited by treatment of the cells with either MEK or farnesyl transferase inhibitors or ROS scavengers (Fig. 5, B-E). To date we have replicated these data in ∼15 independent fibroblast lines derived from systemic sclerosis patients (data not shown). As a complementary approach, we transfected normal fibroblasts with Ha- or Ki-Ras at approximately the same ratio present in scleroderma cells (3:1). We found that ROS production was significantly stimulated by Ha-Ras expression. We replicated in normal fibroblasts all the features indicated in Fig. 5 (collagen induction, DNA damage, H2O2-induced apoptosis) by expressing Ha-Ras in a ratio 5:1 relative to Ki-Ras (Fig. S2, supplementary material and Ref. 15Cuda G. Paterno R. Ceravolo R. Candigliota M. Perrotti N. Perticone F. Faniello M.C. Schepis F. Ruocco A. Mele E. Cassano S. Bifulco M. Santillo M. Avvedimento E.V. Circulation. 2002; 105: 968-974Crossref PubMed Scopus (84) Google Scholar). These data establish a link between ROS-Ras amplification and the complex phenotype of scleroderma fibroblasts in vivo. Moreover, they provide the tools for a possible diagnosis and a targeted therapy of this so far not curable illness. The data reported here indicate a novel level of regulation of Ras proteins, so far unknown. In established and immortal cell lines, Ras is solely regulated by GTP-GDP binding activity. Because widespread expression of Ha- or Ki-Ras is not tolerated during development or in adult organisms, in primary cells the levels of the proteins are maintained low (20Tuveson D.A. Shaw A.T. Willis N.A. Silver D.P. Jackson E.L. Chang S. Mercer K.L. Grochow R. Hock H. Crowley D. Hingorani S.R. Zaks T. King C. Jacobetz M.A. Wang L. Bronson R.T. Orkin S.H. DePinho R.A. Jacks T. Cancer Cell. 2004; 5: 375-387Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar). We have evidence that Ras induction by growth factors and ROS is not unique to primary fibroblasts. In peripheral lymphocytes, primary mouse neurons and astrocytes ROS induce Ha- or Ki-Ras protein levels. 6E. Janda and A. Porcellini, personal communication. In primary fibroblasts, the accumulation of Ras protein is triggered by PDGF and ERK1/2 (Figs. 1 and 2). ROS induced by PDGF maintain ERK1/2 active (Fig. 2). ROS induction of Ha-Ras is independent on PDGF stimulation and can be maintained by ROS (Fig. 3). However, in the absence of PDGF stimulation, H2O2 is not able to maintain high Ha-Ras levels for longer periods (2 h). As to the mechanism underlying Ha-Ras induction by PDGF and ROS, the data shown in Fig. 3F indicate that the Ha-Ras protein is degraded by the 26 S proteasome and that ERK1/2 protect Ha-Ras from degradation (Fig. 3, A-C). Because MG132 and PDGF effects were not additive, we suggest that PDGF via ERK1/2 inhibits proteasome degradation of Ha-Ras. At present, we do not know if proteasome directly degrades Ras protein. There is a similar example of proteasomal degradation inhibited by ERK1/2 signaling: c-Myc is degraded by the proteasome (21Bonvini P. Nguyen P. Trepel J Neckers L.M. Oncogene. 1998; 16: 131-139Crossref PubMed Scopus (41) Google Scholar) and is stabilized by stress via MEKK1 (22Alarcon-Vargas1 D. Tansey W.P. Ronai Z. Oncogene. 2002; 21 (2002): 4384-4391Crossref PubMed Scopus (30) Google Scholar). ROS and ERK1/2 result in increased Ha-Ras protein levels. Under these conditions, Ha-Ras is more likely to be activated by low PDGF levels. A schematic diagram illustrating the link between ROS and Ha-Ras protein levels is shown in Fig. 6. We propose that ROS increase Ras protein levels and amplify PDGF signaling. Down-regulation of Ras levels protects primary cells from excessive stimulation by growth factors, which may result in DNA damage, oxidative stress, and ultimately in apoptosis. Amplification of ROS-Ras Signaling in Vivo—The pathway we have described is relevant in vivo, because we find that cells isolated from lesions of patients affected by systemic sclerosis, contain the key elements indicated in Fig. 6. Systemic sclerosis is an autoimmune disease, characterized by extensive fibrosis of the skin and internal organs, because of exaggerated production of collagen by fibroblasts (23Kahari V.M. Vuorio T. Nanto-Salonen K. Vuorio E. Biochim. Biophys. Acta. 1984; 781: 183-186Crossref PubMed Scopus (66) Google Scholar). Fibroblasts, derived from systemic sclerosis patients, contain high Ha-Ras and ROS levels and constitutive activation of ERK1/2. These features are the hallmarks of the signaling pathway we have described above in normal fibroblasts stimulated with H2O2. In Fig. S2 (supplementary materials) we show that we can convert normal in scleroderma fibroblasts by overexpressing Ha-Ras. Conversely, overexpression of Ki-Ras or catalase inhibited the scleroderma phenotype in fibroblasts, isolated from scleroderma lesions. We have recently found that the triggers of the scleroderma phenotype are stimulating antibodies against PDGF receptor. Systemic sclerosis patients synthesize stimulating antibodies to the PDGF receptor. These antibodies stimulate fibroblasts and monocytes to produce high ROS (14Sambo P. Jannino L. Candela M. Salvi A. Donini M. Dusi S. Luchetti M.M. Gabrielli A. J. Investig. Dermatol. 1999; 112: 78-84Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), which set off ERK1/2 and induce Ha-Ras. 5S. Svegliati, M. R. Santillo, F. Bevilacqua, M. Luchetti, T. Spadoni, M. Mancini, A. Funaro, A. Kazlavskas, V. E. Avvedimento, and A. Gabrielli, submitted manuscript. Inhibition of any of the components of this loop (ERK1/2, Ras, ROS) down-regulated the system and abolished the biological effects of Ras-ROS activation, such as accelerated senescence of fibroblasts, which characterizes the phenotype of systemic sclerosis cells (23Kahari V.M. Vuorio T. Nanto-Salonen K. Vuorio E. Biochim. Biophys. Acta. 1984; 781: 183-186Crossref PubMed Scopus (66) Google Scholar, 24Ohtsuka T. Dermatology. 1998; 196: 204-207Crossref PubMed Scopus (2) Google Scholar). This phenotype is characterized by: 1) high susceptibility to apoptosis; 2) severe DNA damage, 3) vigorous transcription of collagen genes. In this framework, fibrosis is the consequence of loss of cells (apoptosis) and deposition of collagen (23Kahari V.M. Vuorio T. Nanto-Salonen K. Vuorio E. Biochim. Biophys. Acta. 1984; 781: 183-186Crossref PubMed Scopus (66) Google Scholar, 24Ohtsuka T. Dermatology. 1998; 196: 204-207Crossref PubMed Scopus (2) Google Scholar). The loop triggered initially by PDGF receptor activation, is reinforced by high ROS produced by activation of NADPH oxidase by Ha-Ras-ERK1/2 (24Ohtsuka T. Dermatology. 1998; 196: 204-207Crossref PubMed Scopus (2) Google Scholar). Thus, inhibition of either ROS, or ERK1/2 or Ras converts scleroderma to normal fibroblasts. However, we find that PDGF signaling is required for long term ROS production, because inhibition of PDGF receptor for 4-12 h reduced Ras-ROS-ERK1/2-collagen levels (Fig. 6 and data not shown). In the presence of physiological stimuli, we believe that the regulation of Ras protein levels protects primary cells from excessive or inappropriate signals. Coupling ROS to Ras highlights the primary role of Ras proteins as sensors and regulators of redox signals. The different turn-over in primary cells and the different effects on ROS levels by Ha- and Ki-Ras (7Santillo M. Mondola P. Seru R. Annella T. Cassano S. Ciullo I. Tecce M.F. Iacomino G. Damiano S. Cuda G. Paterno R. Martignetti V. Mele E. Feliciello A. Avvedimento E.V. Curr. Biol. 2001; 11: 614-619Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar) (Fig. S2, supplementary materials) suggest that the activation of these 2 isoforms signals to different cell compartments the type and the levels of ROS generated; i.e. the metabolic state, and availability of nutrients. Constitutive or mutationally activation of Ras-ERK1/2 signaling results in loss of this type of metabolic regulation. This may explain the opposite life-span phenotypes of S. cerevisiae expressing ras2Val19 or ras2 wild-type gene (11Sun J. Kale S.P. Childress A.M. Pinswasdi C. Jazwinski S.M. J. Biol. Chem. 1994; 269: 18638-18645Abstract Full Text PDF PubMed Google Scholar). In primary cells, senescence or growth or differentiation are critically dependent on the integrity of this circuitry. We thank Dr. Marcello Melone at the Institute of Physiology of the University of Ancona for help with fluorescence microscopy. Download .pdf (.11 MB) Help with pdf files

Referência(s)