Portal de Periódicos da CAPES

The Highly Conserved Stt3 Protein Is a Subunit of the Yeast Oligosaccharyltransferase and Forms a Subcomplex with Ost3p and Ost4p

1997; Elsevier BV; Volume: 272; Issue: 51 Linguagem: Inglês

10.1074/jbc.272.51.32513

1083-351X

Denise Karaoglu, Daniel J. Kelleher, Reid Gilmore,

Enzyme Structure and Function

The oligosaccharyltransferase has been purified from Saccharomyces cerevisiae as an hetero-oligomeric complex composed of four or six subunits. Here, the in vivosubunit composition and stoichiometry of the oligosaccharyltransferase were investigated by attaching an epitope coding sequence to a previously characterized subunit gene, OST3. Five (Ost1p, Wbp1p, Swp1p, Ost2p, and Ost5p) of the seven polypeptides that were coimmunoprecipitated with the epitope-tagged Ost3p were identical to those obtained by the conventional purification procedure. Two additional coprecipitating polypeptides with apparent molecular masses of 60 and 3.6 kDa were identified as the 78-kDa Stt3 protein and the 36-residue Ost4 protein, respectively. Stt3p and Ost4p were previously identified in screens for gene products involved in N-linked glycosylation. Quantification of the in vivo radiolabeled subunits and the radioiodinated purified enzyme shows that the yeast oligosaccharyltransferase is composed of equimolar amounts of eight subunits. Exposure of the immunoprecipitated oligosaccharyltransferase to mild protein denaturants yielded a subcomplex comprised of Stt3p, Ost3p, and Ost4p. These experiments, taken together with genetic and biochemical evidence for subunit interactions, suggest that the enzyme is composed of the following three subcomplexes: (a) Stt3p-Ost4p-Ost3p, (b) Swp1p-Wbp1p-Ost2p, and (c) Ost1p-Ost5p. The oligosaccharyltransferase has been purified from Saccharomyces cerevisiae as an hetero-oligomeric complex composed of four or six subunits. Here, the in vivosubunit composition and stoichiometry of the oligosaccharyltransferase were investigated by attaching an epitope coding sequence to a previously characterized subunit gene, OST3. Five (Ost1p, Wbp1p, Swp1p, Ost2p, and Ost5p) of the seven polypeptides that were coimmunoprecipitated with the epitope-tagged Ost3p were identical to those obtained by the conventional purification procedure. Two additional coprecipitating polypeptides with apparent molecular masses of 60 and 3.6 kDa were identified as the 78-kDa Stt3 protein and the 36-residue Ost4 protein, respectively. Stt3p and Ost4p were previously identified in screens for gene products involved in N-linked glycosylation. Quantification of the in vivo radiolabeled subunits and the radioiodinated purified enzyme shows that the yeast oligosaccharyltransferase is composed of equimolar amounts of eight subunits. Exposure of the immunoprecipitated oligosaccharyltransferase to mild protein denaturants yielded a subcomplex comprised of Stt3p, Ost3p, and Ost4p. These experiments, taken together with genetic and biochemical evidence for subunit interactions, suggest that the enzyme is composed of the following three subcomplexes: (a) Stt3p-Ost4p-Ost3p, (b) Swp1p-Wbp1p-Ost2p, and (c) Ost1p-Ost5p. N-Glycosylation of proteins is an essential, highly conserved protein modification reaction that occurs in all eukaryotic organisms. The oligosaccharyltransferase (OST) 1The abbreviations used are: OST, oligosaccharyltransferase; Endo H, endoglycosidase H; HA, influenza virus hemagglutinin; PVDF, polyvinylidene difluoride; bp, base pair(s); Tricine,N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; PAGE, polyacrylamide gel electrophoresis; nt, nucleotides. catalyzes the transfer of a preassembled high mannose oligosaccharide (Glc3Man9GlcNAc2) onto Asn-X-Ser/Thr acceptor sites on nascent polypeptides as they are translocated into the lumen of the rough endoplasmic reticulum (for reviews see Refs. 1Herscovics A. Orlean P. FASEB J. 1993; 7: 540-550Crossref PubMed Scopus (441) Google Scholar, and 2Silberstein S. Gilmore R. FASEB J. 1996; 10: 849-858Crossref PubMed Scopus (207) Google Scholar). Biochemical, molecular biological, and genetic studies have led to the identification of a surprisingly large number of proteins that are required for the expression of wild-type OST activity. The yeast OST was initially purified as an oligomeric complex composed of six subunits that are designated as Ost1p (62/64 kDa), Wbp1p (45 kDa), Ost3p (34 kDa), Swp1p (30 kDa), Ost2p (16 kDa), and Ost5p (9 kDa) (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar). However, catalytically active tetrameric OST complexes that appear to lack Ost2p and Ost5p have also been described (4Pathak R. Hendrickson T.L. Imperiali B. Biochemistry. 1995; 34: 4179-4185Crossref PubMed Scopus (52) Google Scholar, 5Knauer R. Lehle L. FEBS Lett. 1994; 344: 83-86Crossref PubMed Scopus (59) Google Scholar). In addition, the 34-kDa Ost3 protein appears to be present in reduced amounts relative to the other three subunits in the purified OST tetramer (4Pathak R. Hendrickson T.L. Imperiali B. Biochemistry. 1995; 34: 4179-4185Crossref PubMed Scopus (52) Google Scholar), raising the possibility that oligomeric forms of the OST may exist that differ with respect to the presence of regulatory or accessory subunits. Prior to purification of the yeast enzyme, genetic and biochemical studies had established that Wbp1p and Swp1p were essential for in vivo and in vitro expression of OST activity (6te Heesen S. Knauer R. Lehle L. Aebi M. EMBO J. 1993; 12: 279-284Crossref PubMed Scopus (106) Google Scholar, 7te Heesen S. Janetzky B. Lehle L. Aebi M. EMBO J. 1992; 11: 2071-2075Crossref PubMed Scopus (118) Google Scholar). Mutations in genes encoding Ost1p, Ost2p, Ost3p, and Ost5p also cause substantial reductions in both the N-linked glycosylation of proteins in vivo and the transfer of dolichol-linked oligosaccharides to acceptor peptide substrates in vitro (8Silberstein S. Collins P.G. Kelleher D.J. Rapiejko P.J. Gilmore R. J. Cell Biol. 1995; 128: 525-536Crossref PubMed Scopus (60) Google Scholar, 9Silberstein S. Collins P.G. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 131: 371-383Crossref PubMed Scopus (106) Google Scholar, 10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar, 11Reiss G. te Heesen S. Gilmore R. Zufferey R. Aebi M. EMBO J. 1997; 16: 1164-1172Crossref PubMed Scopus (63) Google Scholar). Defects in the transfer and modification of N-linked oligosaccharides cause morphological, biochemical, and structural alterations in the yeast cell wall (12Klis F.M. Yeast. 1994; 10: 851-869Crossref PubMed Scopus (487) Google Scholar). Yeast mutants that are defective in the synthesis of the fully assembled dolichol oligosaccharide donor (alg mutants,i.e. asparagine-linkedglycosylation) or in the elongation of the N-linked oligosaccharide display an enhanced resistance to sodium vanadate (13Ballou L. Hitzeman R.A. Lewis M.S. Ballou C.E. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3209-3212Crossref PubMed Scopus (114) Google Scholar) and are hypersensitive to aminoglycoside antibiotics (14Dean N. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1287-1291Crossref PubMed Scopus (138) Google Scholar). The ost4 mutants, which were isolated based upon enhanced resistance to sodium vanadate, express greatly diminished OST activity in vivo and in vitro(15Chi J.H. Roos J. Dean N. J. Biol. Chem. 1996; 271: 3132-3140Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The OST4 gene encodes a 36-residue hydrophobic protein that was not detected when the OST was purified. The glycosylation defect caused by the wbp1-2 mutation is exaggerated when assembly of the optimal oligosaccharide donor (Dol-PP-GlcNAc2Man9Glc3) for the OST is prevented by a mutation in the ALG5 gene, resulting in a synthetic lethal phenotype (16Stagljar I. te Heesen S. Aebi M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5977-5981Crossref PubMed Scopus (93) Google Scholar). Based upon this observation, two genetic screens were devised, one of which was selective for mutations that affect assembly of the oligosaccharide donor (17Zufferey R. Knauer R. Burda P. Stagljar I. te Heesen S. Lehle L. Aebi M. EMBO J. 1995; 14: 4949-4960Crossref PubMed Scopus (170) Google Scholar), and a second that was selective for genes encoding the OST subunits (11Reiss G. te Heesen S. Gilmore R. Zufferey R. Aebi M. EMBO J. 1997; 16: 1164-1172Crossref PubMed Scopus (63) Google Scholar). In addition to mutant alleles of genes that encode six of the known OST subunits (Wbp1p, Swp1p, Ost1p, Ost2p, Ost3p, and Ost5p) the latter screen yielded mutants in the STT3 locus (11Reiss G. te Heesen S. Gilmore R. Zufferey R. Aebi M. EMBO J. 1997; 16: 1164-1172Crossref PubMed Scopus (63) Google Scholar). Because the 78-kDa Stt3 protein had not been detected as a subunit in the purified OST complex (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar, 4Pathak R. Hendrickson T.L. Imperiali B. Biochemistry. 1995; 34: 4179-4185Crossref PubMed Scopus (52) Google Scholar, 5Knauer R. Lehle L. FEBS Lett. 1994; 344: 83-86Crossref PubMed Scopus (59) Google Scholar), several alternative roles were proposed for the Stt3p (17Zufferey R. Knauer R. Burda P. Stagljar I. te Heesen S. Lehle L. Aebi M. EMBO J. 1995; 14: 4949-4960Crossref PubMed Scopus (170) Google Scholar). To determine the composition and subunit stoichiometry of the native yeast OST, we appended an epitope recognized by an antibody raised against the influenza virus hemagglutinin (HA) to either the C terminus of Ost3p or Stt3p and expressed the epitope-tagged proteins in Saccharomyces cerevisiae. Nondenaturing immunoprecipitation of the OST from radiolabeled cultures of a yeast strain expressing the epitope-tagged Ost3 protein showed that the yeast enzyme is composed of eight subunits (Stt3p, Ost1p, Wbp1p, Ost3p, Swp1p, Ost2p, Ost5p, and Ost4p) in approximately equimolar amounts. After exposure to mild denaturants Stt3p, Ost3p, and Ost4p remain bound to the immunoaffinity reagent suggesting that these subunits form a stable subcomplex within the oligosaccharyltransferase. These results are discussed in the context of a model for the structural organization of the OST complex. Standard yeast genetics (18Sherman F. Methods Enzymol. 1991; 194: 1-21PubMed Google Scholar) and molecular biology (19Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) techniques were used for all strain constructions. The termination codon (nt 1370–1372) of the OST3 gene was replaced with an MscI restriction site (underlined) by PCR-based site-directed mutagenesis (20Chen B. Przybyla A.E. BioTechniques. 1994; 17: 657-659PubMed Google Scholar) to obtain the sequence 5′ AAATTGGCCAG 3′ using the plasmid pOST3-1 (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar) as the template. The resulting PCR fragment (nt 1098–1545) was subcloned into EcoRI-XbaI-digested pRS306OST3 (nt 1–1654 of the OST3 gene) to obtain pRS306OST3-M. A 90-bp DNA fragment encoding three tandem copies of the influenza virus hemagglutinin epitope (21Wilson I.A. Niman H.L. Houghten R.A. Cherenson A.R. Connolly M.L. Lerner R.A. Cell. 1984; 37: 767-778Abstract Full Text PDF PubMed Scopus (658) Google Scholar) was obtained by PCR amplification of plasmid pGTEP1 (22Tyers M. Tokiwa G. Nash R. Futcher B. EMBO J. 1992; 11: 1773-1784Crossref PubMed Scopus (339) Google Scholar) using (5′ TACCCATACGATGTTCCTGAC 3′) and (5′ TCAGTGGCCATTAAGCGTAATCTGGAACGTCATA3′) as primers. The PCR product encoding the HA epitope was fused to a 269-bp PCR fragment corresponding to nucleotides 1098–1367 of the OST3 gene and amplified using a PCR ligation-PCR mutagenesis procedure (23Ali S.A. Steinkasserer A. BioTechniques. 1995; 18: 746-750PubMed Google Scholar). The final DNA fragment was digested with EcoRI and MscI and cloned into the EcoRI-MscI-digested pRS306OST3-M to obtain plasmid pRS306OST3-HA3 encoding Ost3p bearing a C-terminal triple HA epitope tag. After digestion with MluI and EcoRI to delete nucleotides 287–1098 in the OST3 gene, pRS306OST3-HA3 was used to transform strain RGY323 (MATα ura3-52 leu2-Δ1 lys2-801 ade2-101 trp1-Δ1 his3-Δ200) (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar), MA9-D (MAT a wbp1-2 ura3-52 lys2-801 ade2-101 his3-Δ200), and MA7-B (MATa wbp1-1 ura3-52 lys2-801 ade2-101 his3-Δ200) (7te Heesen S. Janetzky B. Lehle L. Aebi M. EMBO J. 1992; 11: 2071-2075Crossref PubMed Scopus (118) Google Scholar) to uracil prototrophy. The resulting strains are designated RGY330, RGY331, and RGY332, respectively. DNA fragments corresponding to the 5′ (−218 to 143) and 3′ (1633 to 2154) regions of the STT3 gene (24Yoshida S. Ohya Y. Nakano A. Anraku Y. Gene (Amst.). 1995; 164: 167-172Crossref PubMed Scopus (35) Google Scholar) were amplified using S. cerevisiaegenomic DNA as a template. The PCR products were ligated and further amplified as described above. The resulting DNA fragment was digested with HindIII and subcloned into HindIII-MscI-digested pRS306OST3-HA3 to obtain pRS306ΔSTT3-HA3. The latter plasmid contains the STT3 gene bearing an internal deletion fused to the triple HA tag followed by 175 bp of the 3′-untranslated sequence from the OST3 gene. After digestion with EcoRI, pRS306ΔSTT3-HA3 was used to transform strains RGY323, RGY322 (MATaΔost3::LEU2 ura3–52 leu2-Δ1 lys2-801 ade2-101 trp1-Δ1 his3-Δ200) (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar), MA9-D, and MA7-B (7te Heesen S. Janetzky B. Lehle L. Aebi M. EMBO J. 1992; 11: 2071-2075Crossref PubMed Scopus (118) Google Scholar) to uracil prototrophy. The resulting strains are designated RGY340, RGY341, RGY342, and RGY343, respectively. A two-step PCR-based gene disruption method (25Wach A. Brachat A. Alberti-Segui C. Rebischung C. Philippsen P. Yeast. 1997; 13: 1065-1075Crossref PubMed Scopus (508) Google Scholar) was used to produce a linear DNA fragment containing a heterologous HIS3 marker flanked by 5′ (−215 to 88) and 3′ (199 to 398) untranslated homology regions from the OST4gene (15Chi J.H. Roos J. Dean N. J. Biol. Chem. 1996; 271: 3132-3140Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The pFA6a-HIS3MX6 plasmid, which was used as a template for the PCR reaction, was provided by Dr. Peter Philippsen (University of Basel, Switzerland). RGY330 and RGY340 were transformed to histidine prototrophy using the PCR product to obtain strains designated as RGY333 and RGY344. Integration of the HIS3 marker into the OST4 gene was confirmed by PCR. A 1655-bp HindIII-StyI fragment derived from pOST3-1 (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar) was subcloned into the HindIII-SmaI-digested 2-μm plasmid pRS426 (26Christianson T.W. Sikorski R.S. Dante M. Shero J.H. Hieter P. Gene (Amst.). 1992; 110: 119-122Crossref PubMed Scopus (1438) Google Scholar). The resulting plasmid, pRS426OST3, or the vector pRS426 was transformed into the strains MA7-B and MA9-D (7te Heesen S. Janetzky B. Lehle L. Aebi M. EMBO J. 1992; 11: 2071-2075Crossref PubMed Scopus (118) Google Scholar). Transformants selected at 25 °C on synthetic complete media lacking uracil were tested for growth at 25 and 37 °C. An HindIII-BamHI fragment from pRS426OST3, containing the OST3 gene (nt 1–1655), was subcloned into HindIII-BamHI-digested pGEM-4Z (Promega Biotech, Madison, WI) to obtain pOST3-2. The HpaI-SmaI fragment of the URA3 gene from YEp352 (27Hill J.E. Myers A.M. Koerner T.J. Tzagoloff A. Yeast. 1986; 2: 163-167Crossref PubMed Scopus (1083) Google Scholar) was ligated into MluI-AccI-digested blunt-ended pOST3-2, thereby replacing nucleotides 287–1187 of the OST3 gene with a URA3 marker. The resulting plasmid, pΔOST3URA3, was digested with SspI and EcoRI prior to transformation of RGY323 and MA-9D strains. Transformants selected at 25 °C on synthetic complete media lacking uracil were tested for growth on YPD plates at 25 and 30 °C. Yeast cells were grown for 15–20 h at 25 °C in synthetic minimal media (2% glucose) supplemented with the appropriate amino acids until mid log phase (A 600 of 0.8–1.6). Cells were collected by centrifugation and resuspended at 5A 600/ml in minimal medium. Cells were labeled for 20 min or 1 h, as indicated, with 100 μCi of [35S]methionine (>1000 Ci/mmol, NEN Life Science Products) per A 600 units of cells. Labeling was terminated by the addition of NaN3 to 10 mm. Hereafter, all the procedures were carried out at 4 °C. To prepare lysates for nondenaturing immunoprecipitation, cells were washed once with 20 mm Tris-Cl (pH 7.4), 100 mm NaCl, and resuspended in 5% glycerol, 20 mm Tris-Cl (pH 7.4), 5 mm MgCl2, 1 mm EDTA, 1 mm EGTA, 1 mm phenylmethylsulfonyl fluoride, and a protease inhibitor mixture (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar). After rapid lysis of cells with glass beads, the homogenates were adjusted to 1.5% digitonin, 0.5m NaCl, 20 mm Tris-Cl (pH 7.4), 3.5 mm MgCl2, and 1 mmMnCl2. The extracts were centrifuged for 20 min at 135,000 × g in an airfuge (Beckman Instruments, Palo Alto, CA) using a A-100/30 rotor, and the clarified supernatants were used for immunoprecipitations. For immunoprecipitation with the HA.11 antibody (Babco, Richmond, CA), cell lysates from radiolabeled cells were mixed with unlabeled lysates prepared from an equal quantity of cells that do not express the HA-tagged protein. Extracts that were precleared by prior incubation with protein A-Sepharose beads were incubated overnight with the HA.11 antibody. After a 2-h incubation with the protein A-Sepharose beads, the beads were recovered by centrifugation and washed three times with Nikkol buffer (1m NaCl, 50 mm Tris-Cl (pH 7.4), 1 mm MgCl2, 1 mm MnCl2, 1 mm CaCl2, 0.02% Nikkol (Nikko Chemical Co., Ltd., Tokyo, Japan)) and once with 50 mm Tris-Cl (pH 7.4), 150 mm NaCl, 5 mm EDTA. Denaturing immunoprecipitations were performed as described previously (28Rothblatt J. Schekman R. Methods Cell Biol. 1989; 32: 3-36Crossref PubMed Scopus (63) Google Scholar). Endoglycosidase H (Endo H; New England Biolabs, Beverly, MA) digestions were performed according to the manufacturer's recommendations. Immunoprecipitated proteins were incubated for 30 min at 55 °C in SDS sample buffer and resolved on either Tris glycine-buffered or Tris-Tricine-buffered SDS-polyacrylamide gels (29Schägger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10505) Google Scholar). Microsomal membranes were isolated from wild-type or mutant cells as described (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar). Microsomes or samples from nondenaturing immunoprecipitations were resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were probed with antibodies to Ost1p, Wbp1p, the HA epitope, Swp1p, Ost2p, and Ost5p as described (10Karaoglu D. Kelleher D.J. Gilmore R. J. Cell Biol. 1995; 130: 567-577Crossref PubMed Scopus (71) Google Scholar). Antibody to Ost5p was raised against the N-terminal sequence that precedes the first membrane spanning segment and was provided by Dr. Markus Aebi (ETH, Zurich, Switzerland). Horseradish peroxidase-conjugated secondary antibodies were visualized using enhanced chemiluminescence (ECL Western blotting detection kit, Amersham Corp.). Radioiodination of the purified yeast OST complex using a chloramine-T oxidation procedure was performed after denaturation in SDS as described previously for the canine OST (30Kelleher D.J. Gilmore R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4994-4999Crossref PubMed Scopus (159) Google Scholar). A 30-amino acid sequence corresponding to three tandem repeats of the HA epitope was appended to the C terminus of Ost3p to serve as an affinity tag for immunopurification of the yeast OST. A one-step allele replacement method was used to substitute the epitope-tagged OST3 allele for the chromosomal copy of OST3 in a haploid yeast strain. Replacement of the wild-type Ost3 protein with the epitope-tagged Ost3 protein had no detectable effect on cell growth or in vivoOST activity indicating that HA-tagged Ost3p is fully functional (not shown). Protein immunoblot and denaturing immunoprecipitation experiments showed that the monoclonal anti-HA antibody recognized a protein of about 36 kDa in total cell extracts prepared from a strain that expresses the HA-tagged Ost3 protein but not from a strain that expresses untagged Ost3p (not shown). To identify proteins that were specifically associated with Ost3p under nondenaturing conditions, total cell homogenates prepared from [35S]methionine-labeled yeast cultures were solubilized with the nonionic detergent digitonin. Six radiolabeled polypeptides ranging in molecular mass from 3.6 to 64 kDa were immunoprecipitated using the monoclonal antibody to the HA epitope from extracts containing the HA-tagged Ost3p (Fig.1 A). Coimmunoprecipitation of the radiolabeled polypeptides with the HA-tagged Ost3 protein was specific, as none of the proteins were recovered in immunoprecipitates from the control strain that expresses untagged Ost3p. To facilitate the assignment of the previously characterized OST subunits, we transferred the immunoprecipitated proteins from a polyacrylamide gel onto a PVDF membrane for protein immunoblot analysis (Fig.1 B). Each of the six polypeptides that had been described as subunits of the OST complex (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar) were unambiguously identified. The single N-terminal methionine residue in the Ost5p sequence is removed from the mature protein (11Reiss G. te Heesen S. Gilmore R. Zufferey R. Aebi M. EMBO J. 1997; 16: 1164-1172Crossref PubMed Scopus (63) Google Scholar); therefore, Ost5p was not detected as a radiolabeled product in the immunoprecipitate from [35S]methionine-labeled cells (Fig. 1 A) but was detected when cultures were labeled with a mixture of [35S]cysteine and [35S]methionine (not shown). Protein immunoblots using an antibody raised against the N terminus of Ost5p revealed an immunoreactive 9-kDa protein. We hypothesized that the polypeptide that migrates slightly slower than the 3.4-kDa molecular weight marker is the 36-residue Ost4 protein. Support for this conclusion is presented in Fig. 4.Figure 4Loss of Ost4p destabilizes a Stt3p-Ost4p-Ost3p subcomplex. The OST was immunoprecipitated with the anti-HA antibody under nondenaturing conditions from radiolabeled cultures of the wild-type (WT) and the Δost4mutant strains that express either HA-tagged Ost3p (+) or HA-tagged Stt3p (+). The immunoprecipitates were washed with either Nikkol buffer (lanes a, b, d, and e), or Triton X-100/SDS-mixed micelle buffer (50 mm Tris-Cl (pH 7.4), 150 mmNaCl, 5 mm EDTA, 1% Triton X-100, and 0.2% SDS) supplemented with 2 m urea (lanes c, f, and g). The OST subunits were resolved in SDS-PAGE.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To calculate the relative molar amounts of the OST subunits in the immunoprecipitates, polyacrylamide gels (Fig. 1 A) containing [35S]methionine-labeled samples were quantified. The relative intensity of each radiolabeled polypeptide should be directly proportional to the methionine content of each subunit provided that the subunits are present in equimolar amounts. The calculated amounts of the OST subunits relative to the tagged Ost3p protein were as follows: Ost1p (3.2), Wbp1p (2.4), Ost3p (1.0), Swp1p (0.9), Ost2p (1.5), and Ost4p (0.4). The apparent excess of Ost1p and Wbp1p relative to the other subunits prompted further examination of this region of the autoradiogram. Protein immunoblots of the native immunoprecipitate revealed a glycoform doublet for Ost1p (Fig. 1 B) rather than the broad band that was visible in the native immunoprecipitate (Fig.1 A). A successive immunoprecipitation experiment was performed to determine whether the excess radiolabel in the Ost1p region of the gel could be explained by a fortuitous comigration of Ost1p with another polypeptide. After the OST was immunoprecipitated under nondenaturing conditions from the HA-tagged Ost3p strain (Fig.2 A, lane b), the immune complexes were denatured in SDS and subjected to a second immunoprecipitation using an antibody to Ost1p. The Ost1p glycoform doublet that was recovered after denaturing immunoprecipitation (Fig.2 A, lane c) migrated slightly slower than an intensely labeled diffuse band that was recovered in the unbound fraction with the other OST subunits (Fig. 2 A, lane d). Given the genetic evidence supporting a role for the Stt3 protein in N-linked glycosylation (11Reiss G. te Heesen S. Gilmore R. Zufferey R. Aebi M. EMBO J. 1997; 16: 1164-1172Crossref PubMed Scopus (63) Google Scholar), the 78-kDa Stt3 protein (17Zufferey R. Knauer R. Burda P. Stagljar I. te Heesen S. Lehle L. Aebi M. EMBO J. 1995; 14: 4949-4960Crossref PubMed Scopus (170) Google Scholar) was the most likely candidate for the diffusely migrating polypeptide. To obtain more direct evidence that Stt3p is a subunit of the OST, total cell extracts were prepared from [35S]methionine-labeled cultures of a yeast strain that expresses HA-tagged Stt3p (Fig.2 B). At least four of the polypeptides (Wbp1p, Swp1p, Ost2p, and Ost4p) that copurified with HA-tagged Ost3p (Fig. 2 B, lane b) comigrated precisely with proteins that copurified with HA-tagged Stt3p (Fig. 2 B, lane c). The identity of the HA-tagged Stt3 protein was confirmed by immunoprecipitating the tagged protein from SDS-denatured cell extracts (Fig. 2 B, lane d). The addition of the 3-kDa affinity tag to the C terminus of Stt3p is responsible for the decreased mobility of HA-tagged Stt3p relative to untagged Stt3p (Fig. 2 B, compare lanes b and c). Endoglycosidase H digestion of the HA-tagged Stt3p (Fig.2 B, lane e) increased the mobility of the protein consistent with a previous report that the lumenal domain of Stt3p contains at least one N-linked oligosaccharide (17Zufferey R. Knauer R. Burda P. Stagljar I. te Heesen S. Lehle L. Aebi M. EMBO J. 1995; 14: 4949-4960Crossref PubMed Scopus (170) Google Scholar). Deglycosylated Stt3p migrated as a broad band indicating that heterogeneous glycosylation is not responsible for the diffuse electrophoretic migration of the polypeptide. As expected, the untagged Ost3 protein migrated slightly slower than Swp1p (Fig. 2 B, lane c). Although the preceding experiments demonstrated that the immunopurified OST complex contains Stt3p, a protein of this size had not been detected when the hexameric or tetrameric OST complexes were resolved by SDS-PAGE and stained with either Coomassie Blue or with Silver (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar, 4Pathak R. Hendrickson T.L. Imperiali B. Biochemistry. 1995; 34: 4179-4185Crossref PubMed Scopus (52) Google Scholar, 5Knauer R. Lehle L. FEBS Lett. 1994; 344: 83-86Crossref PubMed Scopus (59) Google Scholar). To resolve this discrepancy, the OST was purified as described previously (3Kelleher D.J. Gilmore R. J. Biol. Chem. 1994; 269: 12908-12917Abstract Full Text PDF PubMed Google Scholar), denatured in SDS, and radiolabeled with125I. Resolution of the radioiodinated OST subunits by PAGE in SDS revealed an intensely labeled polypeptide that migrated in the vicinity of Ost1p (Fig. 2 B) rather than the well resolved Ost1p glycoform doublet that we detect by staining with Coomassie Blue. Radiolabeled bands corresponding to the other OST subunits (Wbp1p, Ost3p, Swp1p, Ost2p, and Ost5p) were also detected. Radiolabeled aprotinin (∼6.5 kDa), a protease inhibitor that is included in the buffer used for the OST purification (Fig. 2 B), was not effectively separated from 9.5-kDa Ost5p on this gel but was resolved on a 7.5–17.5% polyacrylamide gel (see Fig.3). We were not able to unambiguously assign a radiolabeled band to Ost4p due, in part, to the presence of a single tyrosine residue in this protein. The subunit stoichiometry of the yeast OST was recalculated in light of the discovery that Stt3p was not resolved from Ost1p in Fig. 1. The value presented in Table I for the molar ratio of Ost1p and Stt3p relative to Ost3p assumes that equal amounts of Ost1p and Stt3p are present. The results of this analysis suggest that the OST subunits are present in equimolar amounts in the immunopurified complex. Wbp1p and Ost2p each contain a single methionine residue; consequently, the values we obtain for these subunits are subject to the greatest error. The subunit stoichiometry was also calculated after quantification of the radioiodinated OST subunits (Fig. 2 B and Fig. 3). If the OST complex contains equimolar amounts of the subunits, the incorporation of125I should be proportional to the tyrosine content of the subunits provided that the radioiodination efficiency of individual tyrosine residues is comparable after denaturation with SDS. Quantification of the 125I-labeled OST subunits also indicated that the seven larger OST subunits are present in roughly equimolar amounts in the purified yeast OST complex (Table I).Table IYeast OST complex subunit stoichiometrySubunitMolecular massNumber of methioninesMolar ratio1-aThe relative molar amounts of OST subunits, labeled either with [35S]methionine (Fig. 1 A) or with125I (Fig. 2 B and Fig. 3), were estimated by scanning polyacrylamide gels using a PhosphorImager. The signal produced by each of the subunits was normalized to the number of methionine or tyrosine residues predicted by the amino acid sequence of the mature protein as indicated.Number of tyrosinesMolar ratio1-aThe