Portal de Periódicos da CAPES

Subcellular Localization and Targeting of N-Acetylglucosaminyl Phosphatidylinositol De-N-acetylase, the Second Enzyme in the Glycosylphosphatidylinositol Biosynthetic Pathway

2004; Elsevier BV; Volume: 279; Issue: 16 Linguagem: Inglês

10.1074/jbc.m313537200

1083-351X

Anita Pottekat, Anant K. Menon,

Glycosylation and Glycoproteins Research

The second step in glycosylphosphatidylinositol biosynthesis is the de-N-acetylation of N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI) catalyzed by N-acetylglucosaminylphosphatidylinositol deacetylase (PIG-L). Previous studies of mouse thymoma cells showed that GlcNAc-PI de-N-acetylase activity is localized to the endoplasmic reticulum (ER) but enriched in a mitochondria-associated ER membrane (MAM) domain. Because PIG-L has no readily identifiable ER sorting determinants, we were interested in learning how PIG-L is localized to the ER and possibly enriched in MAM. We used HeLa cells transiently or stably expressing epitope-tagged PIG-L variants or chimeric constructs composed of elements of PIG-L fused to Tac antigen, a cell surface protein. We first analyzed the subcellular distribution of PIG-L and Glc-NAc-PI-de-N-acetylase activity and then studied the localization of Tac-PIG-L chimeras to identify sequence elements in PIG-L responsible for its subcellular localization. We show that human PIG-L is a type I membrane protein with a large cytoplasmic domain and that, unlike the result with mouse thymoma cells, both PIG-L and GlcNAc-PI-de-N-acetylase activity are uniformly distributed between ER and MAM in HeLa cells. Analyses of a series of Tac-PIG-L chimeras indicated that PIG-L contains two ER localization signals, an independent retention signal located between residues 60 and 88 of its cytoplasmic domain and another weak signal in the luminal and transmembrane domains that functions autonomously in the presence of membrane proximal residues of the cytoplasmic domain that themselves lack any retention information. We conclude that PIG-L, like a number of other ER membrane proteins, is retained in the ER through a multi-component localization signal rather than a discrete sorting motif. The second step in glycosylphosphatidylinositol biosynthesis is the de-N-acetylation of N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI) catalyzed by N-acetylglucosaminylphosphatidylinositol deacetylase (PIG-L). Previous studies of mouse thymoma cells showed that GlcNAc-PI de-N-acetylase activity is localized to the endoplasmic reticulum (ER) but enriched in a mitochondria-associated ER membrane (MAM) domain. Because PIG-L has no readily identifiable ER sorting determinants, we were interested in learning how PIG-L is localized to the ER and possibly enriched in MAM. We used HeLa cells transiently or stably expressing epitope-tagged PIG-L variants or chimeric constructs composed of elements of PIG-L fused to Tac antigen, a cell surface protein. We first analyzed the subcellular distribution of PIG-L and Glc-NAc-PI-de-N-acetylase activity and then studied the localization of Tac-PIG-L chimeras to identify sequence elements in PIG-L responsible for its subcellular localization. We show that human PIG-L is a type I membrane protein with a large cytoplasmic domain and that, unlike the result with mouse thymoma cells, both PIG-L and GlcNAc-PI-de-N-acetylase activity are uniformly distributed between ER and MAM in HeLa cells. Analyses of a series of Tac-PIG-L chimeras indicated that PIG-L contains two ER localization signals, an independent retention signal located between residues 60 and 88 of its cytoplasmic domain and another weak signal in the luminal and transmembrane domains that functions autonomously in the presence of membrane proximal residues of the cytoplasmic domain that themselves lack any retention information. We conclude that PIG-L, like a number of other ER membrane proteins, is retained in the ER through a multi-component localization signal rather than a discrete sorting motif. Glycosylphosphatidylinositol (GPI) 1The abbreviations used are: GPI, glycosylphosphatidylinositol; CHX, cycloheximide; ER, endoplasmic reticulum; FLAG epitope tag, 8-amino acid sequence consisting of DYKDDDDK; GFP, green fluorescent protein; GlcNAc, N-acetylglucosamine; GlcN, glucosamine; MAM, mitochondria-associated membrane; PIG-L, N-acetylglucosaminylphosphatidylinositol deacetylase; V5 epitope tag, 14-amino acid sequence consisting of GKPIPNPLLGLDST; PI, phosphatidylinositol; Endo H, endoglycosidase H; Mito, mitochondria; NST, N-glycosylation sequon; T-L-T, TacectoL1–26Taccyto; CHO, Chinese hamster ovary; PLAP, placental alkaline phosphatase; FACS, fluorescence-activated cell sorting; PBS, phosphate-buffered saline. 1The abbreviations used are: GPI, glycosylphosphatidylinositol; CHX, cycloheximide; ER, endoplasmic reticulum; FLAG epitope tag, 8-amino acid sequence consisting of DYKDDDDK; GFP, green fluorescent protein; GlcNAc, N-acetylglucosamine; GlcN, glucosamine; MAM, mitochondria-associated membrane; PIG-L, N-acetylglucosaminylphosphatidylinositol deacetylase; V5 epitope tag, 14-amino acid sequence consisting of GKPIPNPLLGLDST; PI, phosphatidylinositol; Endo H, endoglycosidase H; Mito, mitochondria; NST, N-glycosylation sequon; T-L-T, TacectoL1–26Taccyto; CHO, Chinese hamster ovary; PLAP, placental alkaline phosphatase; FACS, fluorescence-activated cell sorting; PBS, phosphate-buffered saline. biosynthesis is initiated by transferring N-acetylglucosamine (GlcNAc) from UDP-Glc-NAc to PI to generate N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI). GlcNAc-PI is then de-N-acetylated and mannosylated. In mammalian cells and yeast, GlcN-PI must first be acylated on the inositol residue before mannose addition can occur. Mannosylated GPIs are substrates for phosphoethanolamine transferases that can add up to three phosphoethanolamine residues to the core glycan. GPIs containing a phosphoethanolamine cap may be enzymatically transferred to ER-translocated proteins with a C-terminal GPI signal sequence, thus generating a GPI-anchored protein destined for the cell surface (for review, see Refs. 1Kinoshita T. Inoue N. Curr. Opin. Chem. Biol. 2000; 4: 632-638Crossref PubMed Scopus (167) Google Scholar, 2McConville M.J. Menon A.K. Mol. Memb. Biol. 2000; 17: 1-16Crossref PubMed Scopus (124) Google Scholar, 3Tiede A. Bastisch I. Schubert J. Orlean P. Schmidt R.E. Biol. Chem. 1999; 380: 503-523Crossref PubMed Scopus (105) Google Scholar, 4Eisenhaber B. Maurer-Stroh S. Novatchkova M. Schneider G. Eisenhaber F. BioEssays. 2003; 25: 367-385Crossref PubMed Scopus (145) Google Scholar). The GPI biosynthetic pathway is structurally, topologically, and spatially complex. It requires the participation of ∼20 different gene products, some of which are organized as multi-subunit complexes (1Kinoshita T. Inoue N. Curr. Opin. Chem. Biol. 2000; 4: 632-638Crossref PubMed Scopus (167) Google Scholar, 4Eisenhaber B. Maurer-Stroh S. Novatchkova M. Schneider G. Eisenhaber F. BioEssays. 2003; 25: 367-385Crossref PubMed Scopus (145) Google Scholar). Early biosynthetic steps occur on the cytoplasmic face of the ER, whereas later steps are located at the lumenal face (5Vidugiriene J. Menon A.K. J. Cell Biol. 1993; 121: 987-996Crossref PubMed Scopus (120) Google Scholar, 6Vidugiriene J. Menon A.K. J. Cell Biol. 1994; 127: 333-341Crossref PubMed Scopus (97) Google Scholar). This indicates that a GPI biosynthetic intermediate, likely GlcN-PI or GlcN-acyl PI, must flip across the ER membrane to be elaborated into a mature GPI structure (2McConville M.J. Menon A.K. Mol. Memb. Biol. 2000; 17: 1-16Crossref PubMed Scopus (124) Google Scholar, 7Murakami Y. Siripanyapinyo U. Hong Y. Kang J.Y. Ishihara S. Nakamuna H. Maeda Y. Kinoshita T. Mol. Biol. Cell. 2003; 14: 4285-4295Crossref PubMed Scopus (82) Google Scholar). Working with a mouse thymoma cell line (BW5147.3) we recently discovered that although the capacity to synthesize GlcNAc-PI appears to be uniformly distributed in the ER, the next five steps of GPI biosynthesis leading to the synthesis of the singly mannosylated GPI intermediate H5 (phosphoethanolamine-2Manα1–4GlcN-acyl-PI) is enriched in a domain of the ER that is associated with mitochondria (8Vidugiriene J. Sharma D.K. Smith T.K. Baumann N.A. Menon A.K. J. Biol. Chem. 1999; 274: 15203-15212Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). These mitochondria-associated ER membranes, or MAMs, correspond to a rapidly sedimenting ER fraction that is biochemically distinct from traditionally isolated endoplasmic reticula (9Vance J.E. J. Biol. Chem. 1990; 265: 7248-7256Abstract Full Text PDF PubMed Google Scholar, 10Lewis J.A. Tata J.R. J. Cell Sci. 1973; 13: 447-459PubMed Google Scholar, 11Meier P.J. Spycher M.A. Meyer U.A. Biochim. Biophys. Acta. 1981; 646: 283-297Crossref PubMed Scopus (83) Google Scholar). The mechanisms involved in the biogenesis and maintenance of the MAM domain are unknown. Evidence for compartmentation of GPI biosynthetic enzymes within the ER was also reported in a different mouse thymoma cell line (EL4) using a gradient centrifugation approach to separate ER-derived membrane fractions (12Stevens V.L. Zhang H. Kristyanne E.S. Biochem. J. 1999; 341: 577-584Crossref PubMed Google Scholar). The first of the MAM-enriched steps in the thymoma GPI biosynthetic pathway is the de-N-acetylation reaction that converts GlcNAc-PI to GlcN-PI (8Vidugiriene J. Sharma D.K. Smith T.K. Baumann N.A. Menon A.K. J. Biol. Chem. 1999; 274: 15203-15212Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). The reaction is catalyzed by PIG-L in mammals (Gpi12p in yeast) (1Kinoshita T. Inoue N. Curr. Opin. Chem. Biol. 2000; 4: 632-638Crossref PubMed Scopus (167) Google Scholar, 2McConville M.J. Menon A.K. Mol. Memb. Biol. 2000; 17: 1-16Crossref PubMed Scopus (124) Google Scholar, 3Tiede A. Bastisch I. Schubert J. Orlean P. Schmidt R.E. Biol. Chem. 1999; 380: 503-523Crossref PubMed Scopus (105) Google Scholar, 4Eisenhaber B. Maurer-Stroh S. Novatchkova M. Schneider G. Eisenhaber F. BioEssays. 2003; 25: 367-385Crossref PubMed Scopus (145) Google Scholar, 13Nakamura N. Inoue N. Watanabe R. Takahashi M. Takeda J. Stevens V.L. Kinoshita T. J. Biol. Chem. 1997; 272: 15824-15840Google Scholar, 14Watanabe R. Ohishi K. Maeda Y. Nakamura N. Kinoshita T. Biochem. J. 1999; 339: 185-192Crossref PubMed Scopus (76) Google Scholar). Human PIG-L is a 252-amino acid membrane protein with a large cytoplasmic domain. Although PIG-L shows little homology to other known proteins, it contains a HXXEH zinc binding motif characteristic of many de-N-acetylases, and it specifically restores cell surface expression of GPI-anchored proteins in a GlcNAc-PI de-N-acetylase-defective Chinese hamster ovary (CHO) mutant cell line (15Stevens V.L. Zhang H. Harreman M. J. Biochem. 1996; 313: 253-258Crossref Scopus (25) Google Scholar). Moreover, rat PIG-L protein, when expressed in and purified from Escherichia coli, possesses metal ion-dependent GlcNAc-PI de-N-acetylase activity (14Watanabe R. Ohishi K. Maeda Y. Nakamura N. Kinoshita T. Biochem. J. 1999; 339: 185-192Crossref PubMed Scopus (76) Google Scholar). Studies using substrate analogues show that human and Trypanosoma brucei PIG-L differ significantly in their substrate specificities, indicating that PIG-L may be an attractive target for the development of anti-parasite drugs (16Smith T.K. Sharma D.K. Crossman A. Dix A. Brimacombe J.S. Ferguson M.A.J. EMBO J. 1997; 16: 6667-6675Crossref PubMed Scopus (78) Google Scholar, 17Sharma D.K. Smith T.K. Weller C.T. Crossman A. Brimacombe J.S. Ferguson M.A.J. Glycobiology. 1999; 9: 415-422Crossref PubMed Scopus (36) Google Scholar, 18Smith T.K. Crossman A. Borrissow C.N. Peterson M.J. Dix A. Brimacombe J.S. Ferguson M.A.J. EMBO J. 2001; 13: 3322-3332Crossref Scopus (48) Google Scholar). We are interested in learning how PIG-L is localized to the ER and whether it contains signals or structural motifs that contribute to its presumed enrichment in the MAM. PIG-L, like other enzymes in the mammalian GPI biosynthetic pathway, has no readily identifiable sorting determinants such as the di-lysine or di-arginine motifs that have been shown to act as retrieval signals for certain ER membrane proteins (19Teasdale R.D. Jackson M.R. Annu. Rev. Cell Dev. Biol. 1996; 12: 27-54Crossref PubMed Scopus (439) Google Scholar). Thus, the mechanism by which PIG-L is localized to the ER is unclear. To address this issue, we analyzed PIG-L localization and targeting in HeLa cells, a cell type that has been used to assay inhibitors of PIG-L activity in vitro (16Smith T.K. Sharma D.K. Crossman A. Dix A. Brimacombe J.S. Ferguson M.A.J. EMBO J. 1997; 16: 6667-6675Crossref PubMed Scopus (78) Google Scholar, 17Sharma D.K. Smith T.K. Weller C.T. Crossman A. Brimacombe J.S. Ferguson M.A.J. Glycobiology. 1999; 9: 415-422Crossref PubMed Scopus (36) Google Scholar, 18Smith T.K. Crossman A. Borrissow C.N. Peterson M.J. Dix A. Brimacombe J.S. Ferguson M.A.J. EMBO J. 2001; 13: 3322-3332Crossref Scopus (48) Google Scholar) as well as to study aspects of GPI biosynthesis (20Vainauskas S. Maeda Y. Kurniawan H. Kinoshita T. Menon A.K. J. Biol. Chem. 2002; 277: 30535-30542Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 21Vainauskas S. Menon A.K. J. Biol. Chem. 2004; 279: 6540-6545Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar) and intracellular transport (22Baumann N.A. Vidugiriene J. Machamer C.E. Menon A.K. J. Biol. Chem. 2000; 275: 7378-7389Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). We first carried out experiments to establish the subcellular distribution of PIG-L and GlcNAc-PI-de-N-acetylase activity in these cells using immunofluorescence microscopy and subcellular fractionation and then analyzed the subcellular distribution of various chimeric constructs to identify sequence elements in PIG-L responsible for its subcellular localization. Our results show that although it is possible to generate a characteristic MAM fraction from HeLa cells, neither epitope-tagged PIG-L protein (transiently or stably expressed) nor Glc-NAc-PI de-N-acetylase activity is enriched in this fraction. Instead, both PIG-L and GlcNAc-PI de-N-acetylase activity are uniformly concentrated in the ER and MAM. Thus, the sub-ER compartmentation of GPI synthesis observed previously in analyses of mouse thymoma cells (8Vidugiriene J. Sharma D.K. Smith T.K. Baumann N.A. Menon A.K. J. Biol. Chem. 1999; 274: 15203-15212Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 12Stevens V.L. Zhang H. Kristyanne E.S. Biochem. J. 1999; 341: 577-584Crossref PubMed Google Scholar) appears not to be a feature of HeLa cells. We discuss this result in the context of precedents for cell type-specific differences in the fine subcellular distribution of a number of enzymes. To identify sequence elements in PIG-L responsible for its ER localization, we first established that PIG-L is a type I membrane protein and then analyzed the subcellular distribution of chimeric proteins consisting of PIG-L fragments fused to Tac antigen, a cell surface-expressed, N- and O-glycosylated type I membrane protein (23Leonard W.J. Depper J.M. Crabtree G.R. Rudikoff S. Pumphrey J. Robb R.J. Krönke M. Svetlik P.B. Peffer N.J. Waldmann T.A. Greene W.C. Nature. 1984; 311: 626-631Crossref PubMed Scopus (603) Google Scholar, 24Bonifacino J.S. Suzuki C.K. Klausner R.D. Science. 1990; 247: 79-82Crossref PubMed Scopus (160) Google Scholar). Using immunofluorescence microscopy and endoglycosidase treatment we analyzed the subcellular distribution of a series of transiently expressed chimeric proteins in which the Tac cytoplasmic tail and/or transmembrane domain were replaced with C-terminal truncation fragments of the PIG-L cytoplasmic domain. Our results show that the ER sorting information in human PIG-L is located in the cytoplasmic tail of the protein, with the sequence between residues 60 and 88 especially important. We also show that the PIG-L transmembrane span, although unable to act as an independent localization signal, can act in concert with severely truncated, non-functional cytoplasmic tail sequences to localize the corresponding chimeric constructs to the ER. We conclude that PIG-L, like a number of other ER membrane proteins, is retained in the ER through a multi-component localization signal rather than a discrete sorting motif. Materials—Dulbecco's modified Eagle's medium, Ham's F-12 medium, fetal bovine serum, and penicillin/streptomycin were purchased from Invitrogen. Goat serum and cycloheximide were purchased from Sigma. Restriction enzymes, DNA modifying enzymes, and DNA polymerase were purchased from MBI Fermentas (Amherst, NY) and New England Biolabs (Beverly, MA). Protease inhibitor mixture and DNase I were purchased from Calbiochem and Amersham Biosciences, respectively. UDP-[3H]GlcNAc (60 Ci/mmol) was from American Radiolabeled Chemicals (St. Louis, MO). Glass-backed silica 60 thin layer plates were from Merck. Antibodies—Mouse monoclonal antibodies against FLAG and V5 epitope tags, green fluorescent protein (GFP), and human calnexin were purchased from Sigma, Invitrogen, MBL (Nagoya, Japan) and Transduction Laboratories (Lexington, KY), respectively. Mouse monoclonal anti-Tac antibodies 3G10 and anti-human placental alkaline phosphatase (PLAP) antibodies (clone 8B6) were purchased from Caltag Laboratories (Burlingame, CA) and DAKO (Carpinteria, CA), respectively. Rabbit polyclonal anti-V5 and anti-ribophorin I antibodies were kindly provided by Dr. Karen Colley (University of Illinois, Chicago, IL) and Dr. Christopher Nicchitta (Duke University Medical Center, Durham, NC), respectively. Rabbit polyclonal anti-Gpi8 antibodies were generated by Dr. Saulius Vainauskas in our laboratory using an E. coli-expressed polypeptide corresponding to residues 31–322 of human Gpi8. Horseradish peroxidase-conjugated anti-rabbit and anti-mouse antibodies were from Promega Corp. (Madison, WI). Goat anti-mouse and anti-rabbit IgGs conjugated with Alexa Fluor 568 or Alexa Fluor 488 were from Molecular Probes (Eugene, OR). Plasmid Construction—Human PIG-L cDNA was obtained by PCR using a HeLa cell cDNA library as template (Invitrogen). To generate cDNA encoding N-terminal FLAG-tagged human PIG-L, a sense primer-containing sequence encoding a FLAG epitope tag (TGGAATTCCATCATGGACTACAAGGACGACGATGACAAGGAAGCAATGTGGCTCCTGTGT) was used in the PCR reaction in conjunction with an antisense primer (GAGGAAGCTTAGTGAGTTGATTCTCATGTAC). To generate cDNAs encoding FLAG-PIG-L-V5 and FLAG-PIG-L-GFP, the PCR fragment was cloned into a pEF6/V5 His vector (Invitrogen) using the TOPO cloning kit from Invitrogen or cloned into a pEGFPN1 vector (Clontech) using EcoRI and BamHI sites, respectively. An N-glycosylation site (ANSTS) was appended to the N terminus of FLAG-PIG-L-GFP using specific primers to obtain ANSTS-FLAG-PIG-L-GFP. Human Tac cDNA, a gift from Dr. Thomas Waldmann (NIH), was subcloned into pEF6/V5 His vector using BamHI and XbaI sites. Plasmids encoding chimeras of Tac and PIG-L were generated using PCR by the overlap extension method (25Horton R. Hunt H. Ho S. Pullen J. Pease L. Gene (Amst.). 1989; 77: 61-68Crossref PubMed Scopus (2612) Google Scholar) and cloned into a pEF6/V5 His vector using BamHI and XbaI. Plasmid preparation and transformation were carried out according to standard protocols, and all constructs were verified by sequencing. Cell Culture and cDNA Transfection—HeLa cells were cultured at 37 °C in a humidified 5% CO2 atmosphere in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum and penicillin/streptomycin. The CHO-K1 cell lines G9PLAP (stably expressing human placental alkaline phosphatase (PLAP) and its derivative G9PLAP 0.85 (a mutant lacking PIG-L protein (15Stevens V.L. Zhang H. Harreman M. J. Biochem. 1996; 313: 253-258Crossref Scopus (25) Google Scholar)) were kindly provided by Dr. Victoria Stevens (Emory University School of Medicine, Atlanta, GA). CHO K1 cells were cultured in Ham's F-12 medium supplemented with 10% fetal bovine serum and penicillin/streptomycin. For transfections, exponentially growing cells were trypsinized and washed once with cytomix buffer (120 mm KCl, 0.15 mm CaCl2, 25 mm Hepes/KOH, pH 7.6, 2 mm EGTA, 5 mm MgCl2). The cells were resuspended at a density of 1 × 107 cells/ml in the same buffer, and 400 μlof suspension was transferred to a 0.4-cm electroporation cuvette (Invitrogen). 35 μg of DNA was added to the cell suspension in the cuvette and mixed well. The mixture was then exposed to a single electric pulse of 300 V with a capacitance of 1000 microfarads using an Invitrogen pulse system. The cells were allowed to recover in culture medium at 37 °C (5% CO2 atmosphere) for 48 h before harvesting for biochemical analyses or immunofluorescence microscopy. HeLa cells stably expressing FLAG-PIG-L-GFP were selected by growing cells in 600 μg/ml G418 for 4 weeks and by subsequently maintaining the cultures in 250 μg/ml G418. Flow Cytometric Analyses—G9PLAP 0.85 cells were transfected with 35 μg of vector DNA or epitope-tagged PIG-L constructs as described above. After ∼48 h the cells were harvested and washed with fluorescence-activated cell sorting (FACS) buffer (phosphate-buffered saline (PBS) containing 5% fetal bovine serum, 0.1% sodium azide, 1 mm EDTA). The cells were stained with monoclonal anti-human PLAP (10 μg/ml) followed by 2 μg/ml phycoerythrin-conjugated goat anti-mouse secondary antibodies (Caltag Laboratories). Surface expression of PLAP was detected using a fluorescence-activated cell sorter (FACScan, BD Biosciences). Similar analyses were carried out with untransfected G9PLAP 0.85 or wild-type G9PLAP cells. Fluorescence Microscopy—Transiently transfected HeLa cells were grown on coverslips for ∼48 h in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and penicillin/streptomycin. Cells were either treated with 100 μg/ml cycloheximide (CHX) for 2.5 h at 37 °C and then fixed or directly fixed with 4% paraformaldehyde for 15 min at ambient temperature. After three washes with ice-cold PBS, cells were either treated with digitonin (3 μg/ml in cytomix buffer with 0.3 m sucrose) for 30 min at 4 °C to selectively permeabilize the plasma membrane or with Triton X-100 (0.3% in PBS) for 25 min on ice to permeabilize all cellular membranes. For non-permeabilized samples, cells were left in cold PBS at 4 °C for 25 min. Permeabilized or non-permeabilized cells were then washed three times with PBS and incubated with 10% goat serum albumin in PBS for 1 h. This was followed by incubation for 1 h at room temperature with anti-FLAG monoclonal antibody at 1 μg/ml, rabbit anti-V5 antibody at a 1:500 dilution, or anti-Tac monoclonal antibody at a 1:500 dilution. The cells were then washed with PBS three times and incubated with Alexa Fluor 568-conjugated goat anti-mouse IgG or goat Alexa Fluor 488-conjugated anti-rabbit IgG at a dilution of 1:500 for 1 h at room temperature. After four washes with PBS, the coverslips were mounted onto glass slides with a drop of Vectashield (Vector Laboratories, Burlingame, CA) and taken for confocal microscopy using a Bio-Rad confocal microscope (type MRC 1000). Immunoprecipitation—Transfected HeLa cells (1–2 × 107) were scraped 2 days post-transfection, washed once with PBS, resuspended in 1 ml of MSB buffer (40 mm Hepes-KOH, pH 7.4, 150 mm NaCl, 0.5% (w/v) Nonidet P-40, and 1× protease inhibitor mixture (Calbiochem), and solubilized on ice for 30 min. The cell lysates were clarified by centrifugation at 10,000 × g for 20 min. The S10 supernatant thus obtained was further centrifuged at 100,000 × g for 45 min at 4 °C. To the supernatant fraction 30 μl of anti-FLAG M2-agarose (Sigma) slurry was added, and the sample was incubated at 4 °C overnight with gentle agitation. The agarose beads were pelleted by centrifugation (15 s, 10,000 × g) and washed 4 times with 1 ml of MSB buffer. Bound antigen was released by incubating the beads with FLAG peptide (250 μg/ml) in MSB buffer. For immunoprecipitation with anti-V5 or anti-Tac antibodies, the S10 supernatant was pre-cleared by incubating it with 20 μl of protein G-Sepharose resin slurry (Pierce) at 4 °C for 1 h. After a brief centrifugation (15 s, 10,000 × g) the supernatant was incubated with 1.5 μg of mouse monoclonal anti-V5 for 2 h at 4 °C. Protein G-Sepharose (20 μl of slurry) was then added, and the sample was incubated on a rotator at 4 °C overnight. The beads were pelleted, then washed 4 times with 1 ml of MSB buffer. Protein bound to the protein G-slurry was eluted by boiling in 1× denaturing buffer containing 0.5% SDS and 1% 2-mercaptoethanol for 5 min at 100 °C. Glycosidase Treatment and Immunoblotting—cDNA corresponding to ANSTS-FLAG-PIG-L-GFP was electroporated into HeLa cells, and a lysate was prepared by resuspending cells in MSB buffer. The sample was denatured by adding 0.1 volume of 10× endoglycosidase H (Endo H) denaturation buffer (5% SDS, 10% 2-mercaptoethanol) and boiling for 5 min. Then 0.1 volume of 10× Endo H reaction buffer (0.5 m sodium citrate, pH 5.5) was added to the denatured sample followed by incubation with 250 units of Endo H for 2 h at 37 °C. Anti-V5 immunoprecipitates of Tac chimeras expressed in HeLa cells were similarly treated with Endo H. For peptide N-glycosidase F treatment of immunoprecipitated Tac chimeras, samples were eluted from antibody beads by boiling with 1× denaturation buffer, cooled to room temperature, and incubated with 0.1 volume of 10× peptide N-glycosidase F reaction buffer (0.5 m sodium phosphate, pH 7.5) containing 1% (w/v) Nonidet P-40. Samples were digested with 500 units of peptide N-glycosidase F for 2 h at 37 °C. After digestion, treated and untreated samples were boiled with SDS sample buffer containing 2-mercaptoethanol for 5 min. Treated and control samples were analyzed by SDS-PAGE and immunoblotting with mouse anti-GFP or rabbit anti-V5 antibodies. Immunoblots were visualized using ECL reagents from Pierce and quantitated using Image Quant software (Molecular Dynamics, Inc., Sunnyvale, CA). Fractionation and GPI Assays—HeLa cells were grown on 12 × 150-mm plates to confluency. Cells from each plate (∼1 × 107) were electroporated with 35 μg of DNA in a 0.4-cm cuvette and then re-plated to allow the cells to recover. Two days post-transfection cells were washed with PBS, resuspended in Buffer A (0.25 m sucrose, 10 mm Hepes/NaOH, pH 7.5, 1 mm dithiothreitol, and protease inhibitors) at a density of ∼1 × 107 cells/ml and lysed by nitrogen bomb cavitation at 400 p.s.i. for 30 min on ice. Subcellular fractionation of lysed cells was carried out as previously described (8Vidugiriene J. Sharma D.K. Smith T.K. Baumann N.A. Menon A.K. J. Biol. Chem. 1999; 274: 15203-15212Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Protein content of SDS-solubilized fractions was measured using the Micro-BCA protein assay reagent (Pierce). Samples for SDS-PAGE and immunoblot analysis were prepared by heating samples with SDS sample buffer for 1 h at 60 °C. Blot signals from different protein loadings and film exposure were quantitated using Image Quant software. Fractions were characterized by measuring organelle-specific markers NADPH-cytochrome reductase c (ER marker) and succinate-cytochrome reductase c (inner membrane mitochondria marker). NADPH-cytochrome c reductase (ER marker) activity was measured spectrophotometrically by following the reduction of cytochrome c at 550 nm for 5 min. Different subcellular fractions were incubated in 1 ml of assay mixture containing 0.05 m phosphate buffer, 0.1 mm EDTA, pH 7.7, 36 μm cytochrome c at room temperature for 5 min with 2 μg/ml rotenone to inhibit the mitochondrion-specific NADH dehydrogenase. The reaction was initiated by adding 100 μlof1mm NADPH. Succinatecytochrome c reductase, a mitochondrial inner membrane marker, was assayed as follows. Subcellular fractions were incubated with 1 ml of assay buffer containing 25 mm potassium phosphate, pH 7.2, 5 mm MgCl2, 3 mm KCN, 20 mm succinate, and 2 μg/ml rotenone. The reaction was initiated by adding 39 μlof1mm cytochrome c, and the increase in absorbance was monitored for 5 min. GlcNAc-PI de-N-acetylase activity was assayed by incubating subcellular fractions (10 μg) with [3H]GlcNAc-PI (∼2000 cpm) that had been previously solubilized in 0.1% Nonidet P-40 for 30 min at room temperature. Reactions were carried out at 37 °C in 200 μl of buffer containing 50 mm Hepes/NaOH, pH 7.4, 25 mm KCl, 5 mm MgCl2, 5 mm MnCl2, 0.5 mm dithiothreitol, 0.1 mm 1-chloro-3-tosylamido-7-amino-2-heptanone, and 1 μg/ml leupeptin. Reactions were stopped by placing the tubes on ice, and a single phase lipid extract was obtained by adding 160 μl of water, 40 μl of 1 n HCl, and 1.5 ml of ice-cold chloroform/methanol (v/v). A 2-phase mixture was induced by adding 0.5 ml of chloroform and 0.5 ml of water. The lipid-containing chloroform-rich lower phase was washed several times with 1.0 ml of mock upper phase, dried, and dissolved in water-saturated n-butyl alcohol. The radiolabeled lipids in the butanol extract were resolved by thin layer chromatography (silica gel 60; chloroform, methanol, 1 m ammonium hydroxide 10:10:3 (v/v/v)) and detected with a thin layer chromatography (TLC) radioscanner (Berthold Analytical Instruments, Inc. Nashua, NH). Incorporation of radioactivity into individual species ([3H]GlcNAc-PI and [3H]GlcN-PI) was determined using the integration software provided with the scanner. GlcNAc-PI de-N-acetylase activity was also measured indirectly by incubating isolated fractions (100 μg of protein) with UDP-[3H]GlcNAc (1 μCi) in buffer A in the presence of 5 mm EDTA and 1 μg/ml PI dissolved in 0.1% Nonidet P-40 (total reaction volume, 200 μl). After 20 min of incubation at 37 °C samples were subjected to lipid extraction and analysis as described above. Epitope-tagged PIG-L Constructs Are Functional—We generated several tagged versions of human PIG-L protein for use in the studies described in this paper. We determined that the tagged proteins were functional by testing their abi