Integrase Mutants Defective for Interaction with LEDGF/p75 Are Impairedin Chromosome Tethering and HIV-1Replication
2005; Elsevier BV; Volume: 280; Issue: 27 Linguagem: Inglês
10.1074/jbc.m501378200
ISSN1083-351X
AutoresStéphane Emiliani, Aurélie Mousnier, Katrien Busschots, Marlène Maroun, Bénédicte Van Maele, Denis Tempé, Linos Vandekerckhove, Fanny Moisant, L. Benslama, Myriam Witvrouw, Frauke Christ, Jean‐Christophe Rain, Catherine Dargemont, Zeger Debyser, Richard Bénarous,
Tópico(s)CRISPR and Genetic Engineering
ResumoThe insertion of a DNA copy of its RNA genome into a chromosome of the hostcell is mediated by the viral integrase with the help of mostlyuncharacterized cellular cofactors. We have recently described that thetranscriptional co-activator LEDGF/p75 strongly interacts with HIV-1integrase. Here we show that interaction of HIV-1 integrase with LEDGF/p75 isimportant for viral replication. Using multiple approaches includingtwo-hybrid interaction studies, random and directed mutagenesis, we coulddemonstrate that HIV-1 virus harboring a single mutation that disruptsintegrase-LEDGF/p75 interaction, resulted in defective HIV-1 replication.Furthermore, we found that LEDGF/p75 tethers HIV-1 integrase to chromosomesand that this interaction may be important for the integration process and thereplication of HIV-1. The insertion of a DNA copy of its RNA genome into a chromosome of the hostcell is mediated by the viral integrase with the help of mostlyuncharacterized cellular cofactors. We have recently described that thetranscriptional co-activator LEDGF/p75 strongly interacts with HIV-1integrase. Here we show that interaction of HIV-1 integrase with LEDGF/p75 isimportant for viral replication. Using multiple approaches includingtwo-hybrid interaction studies, random and directed mutagenesis, we coulddemonstrate that HIV-1 virus harboring a single mutation that disruptsintegrase-LEDGF/p75 interaction, resulted in defective HIV-1 replication.Furthermore, we found that LEDGF/p75 tethers HIV-1 integrase to chromosomesand that this interaction may be important for the integration process and thereplication of HIV-1. Integration is an essential step inHIV-1 1The abbreviations used are: HIV-1, human immunodeficiency virus, type 1;IN, integrase; PIC, preintegration complex; LTR, long terminal repeat; HA,hemagglutinin; WT, wild type; GFP, green fluorescent protein.1The abbreviations used are: HIV-1, human immunodeficiency virus, type 1;IN, integrase; PIC, preintegration complex; LTR, long terminal repeat; HA,hemagglutinin; WT, wild type; GFP, green fluorescent protein. replicationcatalyzed by the virus-encoded integrase (IN) protein. The choice ofintegration sites in cellular chromosomes is affected by the heterogeneousstructure of the chromatin. While in vivo HIV-1 integration is notsequence-specific, transcriptionally inactive regions of the genome, such ascentromeres and telomeres, are disfavored targets(1Carteau S. Hoffmann C. Bushman F. J. Virol. 1998; 72: 4005-4014Crossref PubMed Google Scholar, 2Jordan A. Defechereux P. Verdin E. EMBO J. 2001; 20: 1726-1738Crossref PubMed Scopus (357) Google Scholar, 3Jordan A. Bisgrove D. Verdin E. EMBO J. 2003; 22: 1868-1877Crossref PubMed Scopus (648) Google Scholar).Integration of proviral HIV-1 DNA occurs preferentially into transcriptionalunits of active genes while the oncoretrovirus murine leukemia virus prefersto integrate near the transcription start site of actively transcribed genes(4Schroder A.R. Shinn P. Chen H. Berry C. Ecker J.R. Bushman F. Cell. 2002; 110: 521-529Abstract Full Text Full Text PDF PubMed Scopus (1402) Google Scholar,5Wu X. Li Y. Crise B. Burgess S.M. Science. 2003; 300: 1749-1751Crossref PubMed Scopus (1133) Google Scholar). The differences observedbetween the integration profiles of these two viruses strongly suggest thatcellular cofactors actively tether proviral DNA to specific regions of thegenome (6Bushman F.D. Cell. 2003; 115: 135-138Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). In vivo,integration is mediated by a large nucleoprotein complex called preintegrationcomplex (PIC) containing the viral cDNA, together with viral proteins: matrix(MA), nucleocapsid (NC), reverse transcriptase VPR, and IN. The PIC carriesout DNA cutting and joining reactions(7Bukrinsky M.I. Sharova N. McDonald T.L. Pushkarskaya T. Tarpley W.G. Stevenson M. Proc. Natl.Acad. Sci. U. S. A. 1993; 90: 6125-6129Crossref PubMed Scopus (387) Google Scholar,8Miller M.D. Farnet C.M. Bushman F.D. J. Virol. 1997; 71: 5382-5390Crossref PubMed Google Scholar). In addition, severalcellular proteins join the PIC along its journey from the cytoplasm to thechromosomes such as the high mobility group protein HMGa1, which seemsrequired for integration in vitro(9Turlure F. Devroe E. Silver P.A. Engelman A. Front. Biosci. 2004; 9: 3187-3208Crossref PubMed Scopus (139) Google Scholar, 10Farnet C.M. Bushman F.D. Cell. 1997; 88: 483-492Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar, 11Hindmarsh P. Ridky T. Reeves R. Andrake M. Skalka A.M. Leis J. J. Virol. 1999; 73: 2994-3003Crossref PubMed Google Scholar, 12Li L. Yoder K. Hansen M.S. Olvera J. Miller M.D. Bushman F.D. J. Virol. 2000; 74: 10965-10974Crossref PubMed Scopus (83) Google Scholar)by a still unknown mechanism, barrier to autointegration factor and Ku(13Chen H. Engelman A. Proc.Natl. Acad. Sci. U. S. A. 1998; 95: 15270-15274Crossref PubMed Scopus (164) Google Scholar, 14Lin C.W. Engelman A. J.Virol. 2003; 77: 5030-5036Crossref PubMed Scopus (120) Google Scholar, 15Li L. Olvera J.M. Yoder K.E. Mitchell R.S. Butler S.L. Lieber M. Martin S.L. Bushman F.D. EMBO J. 2001; 20: 3272-3281Crossref PubMed Scopus (290) Google Scholar).In addition, INI-1/SNF5, a component of the chromatin remodeling complexSWI/SNF, is a binding partner for IN(16Kalpana G.V. Marmon S. Wang W. Crabtree G.R. Goff S.P. Science. 1994; 266: 2002-2006Crossref PubMed Scopus (457) Google Scholar), and HIV-1 infection mayinduce the cytoplasmic relocation of INI-1/SNF5, leading to its associationwith the incoming PIC (17Turelli P. Doucas V. Craig E. Mangeat B. Klages N. Evans R. Kalpana G. Trono D. Mol.Cell. 2001; 7: 1245-1254Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). Werecently identified LEDGF/p75 as a new cellular binding partner for HIV-1 IN(18Cherepanov P. Maertens G. Proost P. Devreese B. VanBeeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (567) Google Scholar,19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). LEDGF/p75, a member ofthe hepatoma-derived growth factor family is a transcriptional co-activatorwhich plays a protective role during stress-induced apoptosis(20Ganapathy V. Daniels T. Casiano C.A. Autoimmun. Rev. 2003; 2: 290-297Crossref PubMed Scopus (66) Google Scholar). LEDGF/p75 has beenreported as a component of the PIC, and when its expression is silenced IN isfound mostly in the cytoplasm(21Llano M. Vanegas M. Fregoso O. Saenz D. Chung S. Peretz M. Poeschla E.M. J. Virol. 2004; 78: 9524-9537Crossref PubMed Scopus (257) Google Scholar,22Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem. 2004; 279: 33421-33429Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Here, we report that the interaction of IN with LEDGF/p75 is involved inintegration and replication of HIV-1. A single mutation in IN,Gln168 to Ala, disrupted the interaction with LEDGF/p75 withoutaffecting its catalytic activity and abolished the chromosomal targeting of INresulting in integration and replication-deficient viruses. Furthermore, themutation did not affect the nuclear import of HIV-1 integrase. Taken together,our data indicate that integration of HIV-1 is under the control of thecellular cofactor LEDGF/p75. Integrase Mutant Library—Integrase bait plasmid wasamplified in mutagenic conditions (0.2 mm dGTP, 0.2 mmdATP, 1 mm dCTP, 1 mm dTTP, 3 mmMgCl2) according to Cadwell and Joyce(23Cadwell R.C. Joyce G.F. PCRMethods Appl. 1992; 2: 28-33Crossref PubMed Scopus (828) Google Scholar) using the followingoligonucleotides: GGGCTGGCGGTTGGGGTTATTCGCAACGGCGACTGGCTGGAATTC andATCATAAGAAATTCGCCCGGAATTAGCTTGGCTGCAGGTC. PCR product was digested by DpnI andtransformed in yeast with an open empty vector pB27 using classical lithiumacetate protocol. Mutant bait plasmids were obtained by homologousrecombination in yeast (GAP repair). 1.6 millions yeast clones were collected,pooled, and stored at –80 °C as equivalent aliquot fractions of thesame integrase mutant library. The mutation rate in the library was evaluatedby sequencing of 48 random non selected clones and was found to be of about0.5 mutation by the integrase clone. Yeast Two-hybrid Screening Procedure—Two-hybrid screens wereperformed using a cell-to-cell mating protocol(24Fromont-Racine M. Rain J.C. Legrain P. Methods Enzymol. 2002; 350: 513-524Crossref PubMed Scopus (45) Google Scholar). A test screen wasperformed for each bait to adapt the screening conditions. The selectivity ofthe HIS3 reporter gene was eventually modulated with 3-aminotriazole (Sigma)to obtain a maximum of 285 histidine-positive clones for 50 millions diploidsscreened. For all the selected clones, LacZ activity was estimated byoverlay assay on solid media in a 96-well plate format. Inserts of all thepositive clones were amplified by PCR(24Fromont-Racine M. Rain J.C. Legrain P. Methods Enzymol. 2002; 350: 513-524Crossref PubMed Scopus (45) Google Scholar) and then sequenced on anABI 3700 automatic sequencer (Applied Biosystem). Screening of integrasemutant library was based on the loss of β-galactosidase activity. (i)After the mating experiment, yeasts were plated on DO-2 to select diploidscontaining bait and prey plasmids, then LacZ activity was evaluatedby overlay assay. (ii) 192 white and light blue colonies were selected from11,000 diploid yeast cells (containing integrase as bait and LEDGF/p75 as prey(amino acids 168–473). (iii) Inserts were amplified by PCR, sequenced,and analyzed. (iiii) Plasmids of interesting mutants were extracted andphenotypes confirmed by retransformation. Plasmid Construction and Mutagenesis—All mutations weregenerated by using the QuikChange mutagenesis kit (Stratagene). Mutations ofthe pBru molecular clone were performed as described previously(25Petit C. Schwartz O. Mammano F. J. Virol. 1999; 73: 5079-5088Crossref PubMed Google Scholar). The IN synthetic gene(INs) (26Cherepanov P. Pluymers W. Claeys A. Proost P. De Clercq E. Debyser Z. FASEB J. 2000; 14: 1389-1399PubMed Google Scholar)was PCR-amplified using the following primers:5′-GAAGATCTGGCGCTGGTGCATTCCTGGACGGCATTG-3′ and5′-CGGAATTCTTAGTCCTCATCTTGACGAGAG-3′. The resulting PCR fragmentwas subcloned between the BglII and EcoRI sites of pEGFP-C1 vector (Clontech)thus generating the GFP-INs expression vector. The recombinantINQ168L and INQ168A mutants were generated by mutagenesis. The plasmid usedfor the PCR was pRP1012 coding for integrase with a N-terminalHis6-tag (R. Plasterk, Dutch Cancer Institute, Amsterdam, TheNetherlands). The following primers were used: INTQ168L,5′-GTAAGAGATCTGGCTGAAC-3′; INTQ168A,5′-GTAAGAGATGCGGCTGAAC-3′; and INTrev2,5′-TGCTGGTCCTTTCCAAACTGG-3′. The resulting PCR fragments were thendigested with DpnI, generating the pKBINQ168L and pKBINQ168A expressionvectors, respectively. In Vitro Integration Assay—The DNA substrate used in theenzymatic assay corresponds to the U5 LTR end of the HIV-1 genome. The INT1(5′-TGTGGAAAATCTCTAGCAGT) and INT2 (5′-ACTGCTAGAGATTTTCCACA)oligonucleotides were purified by gel electrophoresis on a denaturing ureagel. 5′-End labeling of INT1 was done using polynucleotide T4 kinase and[γ-32P]ATP (Amersham Biosciences), followed by annealingequimolar amounts of INT1 and INT2 in the presence of 100 mm NaCl.The final reaction mixture for the integration assay contained 20mm HEPES (pH 7.5), 5 mm dithiothreitol, 10 mmMgCl2, 75 mm NaCl, 15% (v/v) polyethylene glycol 8000,15% dimethyl sulfoxide, 20 nm oligonucleotide substrate, and 1μm His-tagged IN (final volume of 10 μl). Reactions werestarted by addition of the enzyme and allowed to proceed at 37 °C for 60min. To stop the reactions, formamide loading buffer (95% formamide, 30mm EDTA, 0.1% xylene cyanol, 0.1% bromphenol blue, 0.1% sodiumdodecyl sulfate) was added. Subsequent products were separated in a 15%denaturing polyacrylamide-urea gel and visualized with a PhosphorImager. Cells, Viruses, and Infections—HeLa and 293 cells were grownin Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetalcalf serum (Invitrogen), 100 units of penicillin/ml (Invitrogen), and 100μg of streptomycin/ml (Invitrogen). CEM-A301 cells were grown in RIPA(Invitrogen) supplemented with 10% fetal calf serum (Invitrogen), 100 units ofpenicillin/ml (Invitrogen), and 100 μg of streptomycin/ml (Invitrogen).Virus stocks were produced by transfecting 293 cells with pBru-derivedmolecular clones. Supernatants were collected 3 days after transfection, andthe levels of HIV-1 p24 antigen were monitored by enzyme-linkedimmunoabsorbent assay (BD Biosciences). CEM-A301 cells were infected withviral doses corresponding to 30 ng of HIV-1 p24 antigen per 106cells. Nuclear Import Assay—Nuclear import assay of Cy3-labeledrecombinant IN was performed as described previously(27Depienne C. Mousnier A. Leh H. Le Rouzic E. Dormont D. Benichou S. Dargemont C. J. Biol.Chem. 2001; 276: 18102-18107Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) in the presence of anenergy-regenerating system and in the absence of HeLa cell cytosol. Cells weresubsequently fixed with 4% paraformaldehyde, and LEDGF/p75 expression wasmonitored by indirect immunofluorescence staining. Indirect Immunofluorescence Staining—Transfected HeLa cellsgrown on coverslips were fixed with 3% paraformaldehyde prior topermeabilization with 0.1% Triton X-100. For synchronization, transfectedcells were accumulated in prometaphase by nocodazole treatment (0.04 μg/mlfor 4 h). Mitotic cells were selectively harvested by mechanical shock, washedwith nocodazole-free medium, and transferred ontopoly-l-lysine-coated glass slides for 45 min, the fixed with 4%paraformaldehyde for 10 min, and permeabilized with 0.05% Triton X-100. Rabbitpolyclonal antibody against IN (generous gift of J. F. Mouscadet) or mousemonoclonal anti-LEDGF (BD Biosciences) were applied for 30 min followed by a30-min incubation with Texas Red-conjugated donkey anti-rabbit IgG orfluorescein-conjugated donkey anti-mouse IgG, respectively (JacksonImmunoResearch). When indicated, DNA was stained with Hoechst 33258. Cellswere mounted in Mowiol (Hoechst) or in phosphate-buffered saline containing50% glycerol. Images were acquired with a Leica DMRB epifluorescencemicroscope equipped with a CCD camera (Princeton) controlled by Metaviewsoftware (Universal Imaging Corp.). Cell Transfection and Immunoprecipitation Experiments—293cells were transiently transfected by electroporation with 10 μg of IN-FLAGexpression vectors alone or co-transfected with 10 μg of a HA-SNF5expression vector (a kind gift from C. Muchardt, Pasteur Institute, Paris,France). Twenty-four hours later, cells were washed twice inphosphate-buffered saline and lysed in 400 mm NaCl, 50mm Tris-HCl (pH 7.6), 5 mm EDTA, 1% Triton X-100,containing 1 mm DTT and standard protease inhibitors (Sigma) for 30min on ice. Cell lysates were sonicated twice for 20 s, then debris waspelleted by centrifugation at 4 °C. Precleared supernatants were incubatedwith protein G-Sepharose loaded with anti-Flag M2 antibody (Sigma) at 4 °Covernight. The beads were washed four times in lysis buffer and analyzed byWestern blotting. Western Blotting—Proteins were separated by SDS-PAGE andrevealed by Western blotting using anti-FLAG M2 peroxidase-coupled antibody(Sigma), anti-LEDGF (BD Transduction Laboratories), or anti-HA (Roche AppliedScience). Quantification of Three Different Viral DNA Forms during HIV-1Replication—CEM-A301 cells were infected with HIV-1 Bru WT ormutants viruses in presence of 1 μm Saquinavir, to limit viralreplication to a single round, and harvested at 3, 9, 24, and 48 hpost-infection. Samples were washed in phosphate-buffered saline and treatedwith 500 units of DNase I (Roche Diagnostics) for 1 h at 37 °C, prior toDNA extraction using a QIAamp blood DNA minikit (Qiagen). The amounts of totalHIV-1 DNA, two-LTR circles, and integrated HIV-1 DNA were quantified byreal-time PCR performed with the Light Cycler instrument (Roche AppliedScience) as described previously(28Brussel A. Sonigo P. J.Virol. 2003; 77: 10119-10124Crossref PubMed Scopus (182) Google Scholar). Each sample was analyzedin duplicate. Briefly, the total HIV-1 DNA copy number was determined usingprimer that annealed in the U5 region of the LTR (MH531) and in the 5′region of the gag gene (MH532)(29Butler S.L. Hansen M.S. Bushman F.D. Nat. Med. 2001; 7: 631-634Crossref PubMed Scopus (577) Google Scholar). Two-LTR circles wereamplified using primers spanning the LTR-LTR junctions (HIV F and HIV R1)(28Brussel A. Sonigo P. J.Virol. 2003; 77: 10119-10124Crossref PubMed Scopus (182) Google Scholar). Integrated DNA wasquantified using an Alu-LTR-based nested PCR procedure. In a first round ofPCR, integrated HIV-1 sequences were amplified with two outward facing Aluprimers and a HIV-1 LTR-specific primer (L-M667) containing a λphage-specific sequence at the 5′-end of the oligonucleotide. In asecond round of PCR, we used specific primers for the λ sequence(λ T) and the LTR region (AA5M)(28Brussel A. Sonigo P. J.Virol. 2003; 77: 10119-10124Crossref PubMed Scopus (182) Google Scholar). To eliminate the signaldue to primer extension carried out by the L-M667 primer during the firstround PCR, a control PCR assay was performed without Alu primers. The signalof the nested PCR obtained in the absence of Alu primers was subtracted fromthe integrated HIV-1 DNA signal. Copy numbers of total DNA two-LTR circles andintegrated DNA were determined in reference to standard curves prepared byamplification of cloned DNA with matching sequences(28Brussel A. Sonigo P. J.Virol. 2003; 77: 10119-10124Crossref PubMed Scopus (182) Google Scholar). Results were normalizedby the number of cells and the amount of cellular DNA quantified by PCR of theβ-globin gene according manufacturer's instructions (Roche AppliedScience). Glutamine 168 of IN Is Involved in Interaction withLEDGF/p75—To demonstrate the role of the interaction ofHIV-1 IN with LEDGF/p75 in the viral replication cycle, we first mapped byyeast two-hybrid screening the IN interacting domain on LEDGF/p75 to adiscrete region of 102 amino acids in the C-terminal domain of the p75 isoformof LEDGF, located between amino acids 340 and 442 (data not shown). These dataare in agreement with the results from Cherepanov et al.(30Cherepanov P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: 48883-48892Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar) showing that theinteracting binding domain of LEDGF/p75 with IN is comprised between residues347 and 429. Then, we characterized the interacting domain for LEDGF/p75 onHIV-1 IN using yeast two-hybrid screening of a highly complex library of HIV-1random fragments obtained after nebulization of the HIV-1 DNA and inserted inthe prey plasmid (data not shown and see additional methods given in the supplemental material). By this technique, we could map the LEDGF/p75interacting domain in the catalytic core of IN between amino acids 56 and 182.Then, to identify the amino acids of IN required for interaction withLEDGF/p75, we screened by two-hybrid a library of HIV-1 IN random mutantsobtained by PCR random mutagenesis using LEDGF/p75 as bait. Several mutationsimpairing LEDGF/p75 interaction were characterized in the core region of IN,in particular two different mutants at position Gln168. Thesemutations were introduced in molecular clones of HIV-1 Bru, and viral stockswere tested for replication in A301 cells. With the notable exception of theGln168 mutants, all the other mutations affected the synthesis ofviral cDNA (data not shown). So we choose to focus our studies on the mutantsQ168P and Q168L, since the isolation of two independent mutants at thisposition is a strong indication about the importance of this residue forinteraction with LEDGF/p75. Effectively, both of these mutants were impairedfor LEDGF/p75 interaction, as estimated by a quantitative β-galactosidaseassay (Fig. 1A) and bythe lack of co-immunoprecipitation of LEDGF/p75 with IN-Flag168L(Fig. 1B and data notshown). In addition, we generated a more conservative mutation Q168A toconfirm that the lack of interaction with LEDGF/p75 is linked to the absenceof the WT residue Gln168 (Fig.1, A and B). We verified that these mutants weredefective for interaction with LEDGF/p75 but were still able to interact withSNF5/Ini1, another partner of IN (Fig.1C). We next tested whether these mutants remainedenzymatically active in vitro. Recombinant WT and mutant integraseswere purified from Escherichia coli, and both 3′ processing andstrand transfer activities were assayed in the presence of Mg2+.While both INQ168L and INQ168A displayed a wild type3′ processing activities, only the Q168A mutant displayed strandtransfer activity similar to that of WT IN(Fig. 1D). Notunexpectedly, the Q168P mutant was defective for both 3′ processing andstrand transfer activities (data not shown). To correlate the lack of interaction of IN with LEDGF/p75 to a potentialdefect in HIV-1 replication, the Q168A and Q168L mutations were inserted inreplication competent molecular clones of HIV-1 Bru, and viral stocks wereproduced. No difference in virus release was observed between these mutantsand the WT virus, suggesting that none of these mutations impair virusassembly or release (data not shown). In contrast, both of these viruses werefound completely defective for replication over 2 weeks in A301 cells andother T cell lines including Jurkat (Fig.2A and data not shown). Taken together, these resultsdemonstrate that disruption of the IN-LEDGF/p75 interaction by a singlemutation in integrase completely inhibits the replication of HIV-1. Viruses Defective for the LEDGF/p75 Interaction ArePredominantly Blocked at Integration—To determine whether in theabsence of interaction of IN with LEDGF/p75 the integration step isspecifically blocked during the replication cycle of HIV-1, total HIV-1 DNA,two-LTR circles, and integrated forms of proviral DNA were measured byquantitative PCR on cell extracts from A301 cells infected, respectively, withtwo LEDGF/p75 interaction deficient mutant viruses Bru IN Q168A(HIVQ168A) and Bru IN Q168L (HIVQ168L), whileHIVWT Bru and the catalytically IN inactive D116A mutant (BruHIVD116A) were used as controls(Fig. 2A). In thisexperiment, HIV-1 replication was restricted to a single round infection byaddition of a protease inhibitor. At 3-h post-infection, reverse transcriptionproducts peaked, and levels of early reverse transcriptase (strong stop cDNA)(data not shown) or late reverse transcriptase (total HIV cDNA) were similar(HIVD116A and HIVQ168L) or even higher(HIVQ168A) than that of the WT virus(Fig. 2B). Theseresults show that none of these mutations impaired reverse transcription. At 9h post-infection, the amount of total HIV cDNA dropped for the mutantHIVQ168L, while the amount of cDNA remained high for Q168A until 24h post-infection. We next monitored the formation of two-LTR circles that aregenerally accepted to reflect PIC nuclear import. All viruses were able toform two-LTR circles at about the same level at 9 h post-infection(Fig. 2C), indicatingthat all PICs were imported into the nucleus. Compared with the WT virus, a2–3-fold reduction in two-LTR circles formation was observed for theHIVQ168L virus after 24 h, while the HIVQ168A virusdisplayed normal levels. Because HIVQ168A made twice as much totalHIV cDNA as the WT virus, it was also 2-fold defective for two-LTR circles.The catalytic mutant D116A accumulated about 5 times more two-LTR circles thanthe WT virus, as described previously(31Limon A. Devroe E. Lu R. Ghory H.Z. Silver P.A. Engelman A. J. Virol. 2002; 76: 10598-10607Crossref PubMed Scopus (87) Google Scholar). Finally, by quantifyingintegrated proviruses at 24 and 48 h post-infection, both HIVQ168Land HIVQ168A mutants were deficient for integration much like theD116A mutant (Fig.2D). These results show that the mutant virusHIVQ168A encoding a fully active integrase that does not interactwith LEDGF/p75 is specifically blocked at the integration step. These results suggest that the IN-LEDGF/p75 interaction is involved in themechanism controlling integration of the proviral DNA. In addition theysuggest that this interaction does not participate per se to thenuclear translocation of the PIC. LEDGF/p75 Tethers IN to Chromatin—We previouslyreported that in the absence of endogenous LEDGF/p75, nuclear localization ofIN was aborted (19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar),suggesting a potential role of LEDGF/p75 in IN nuclear import. However, wealso noticed that silencing of endogenous LEDGF/p75 greatly decreased GFP-INexpression level in the nucleus(19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). Here we show thattreatment by the proteasome inhibitor MG132 restored a normal level of nuclearGFP-IN WT in cells that were silenced for LEDGF/p75 expression(Fig. 3). This suggests thatthe defect in nuclear accumulation of GFP-IN observed after transientsilencing of LEDGF/p75 expression could be an indirect consequence ofproteasome-dependent degradation of IN within the nucleus in the absence ofLEDGF/p75 expression. Using an in vitro nuclear import assay based ondigitonin-permeabilized HeLa cells(27Depienne C. Mousnier A. Leh H. Le Rouzic E. Dormont D. Benichou S. Dargemont C. J. Biol.Chem. 2001; 276: 18102-18107Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), we found thatrecombinant IN was imported with the same efficiency in cells treated withLEDGF/p75 siRNA or control siRNAs (Fig.4A, compare upper and lower rightpanels). In addition, both Q168L and Q168A IN mutants fused to GFPaccumulated also in the nucleus even if some diffuse pattern is visible in thecytoplasm (Fig. 4B).This confirms that interaction with LEDGF/p75 does not seem to be required fornuclear import of IN. Alternatively, LEDGF/p75, which is known to be stronglyassociated with chromosomes in mitotic cells(19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar,32Nishizawa Y. Usukura J. Singh D.P. Chylack Jr., L.T. Shinohara T. Cell Tissue Res. 2001; 305: 107-114Crossref PubMed Scopus (72) Google Scholar, 33Vojtek A.B. Hollenberg S.M. Methods Enzymol. 1995; 255: 331-342Crossref PubMed Scopus (235) Google Scholar, 34Fromont-Racine M. Rain J.C. Legrain P. Nat. Genet. 1997; 16: 277-282Crossref PubMed Scopus (706) Google Scholar), could act at the level ofretention of IN within the nucleus rather than at the level of nuclear importper se. Of note, the retention phenomenon seems particularly crucialwhen IN is not fused to GFP, since the Q168L IN-Flag mutant protein is morehomogeneously distributed between nuclear and cytoplasmic compartmentscompared with the WT IN-Flag or to the GFP-IN Q168L mutant(Fig. 4B).Fig. 4Interaction with LEDGF/p75 is not required for nuclear localization ofIN. A, knock-down of p75 by specific siRNA does not inhibit INnuclear import in vitro. HeLa cells transfected with p75-specific orcontrol (p75inv) siRNA, as indicated, were digitonin-permeabilizedand incubated with Cy3-labeled IN and an energy-regenerating system (ATP, GTP,creatine phosphate, and creatine phosphokinase). Cells were then fixed, andLEDGF/p75 expression was monitored by immunofluorescence staining, whereas INimport was visualized by direct fluorescence. B, mutation ofGln168 does not impair IN nuclear localization. HeLa cells weretransiently transfected with INs-FLAG or GFP-INsexpression vectors coding for the wild type or mutated Q168L, Q168A, and D116AIN, as indicated. Cells were then fixed, and IN localization was followed byan anti-IN antibody or alternatively by direct GFP fluorescence asindicated.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To further analyze the role of LEDGF/p75 in the nuclear localization of IN,we studied the binding of the Q168L IN mutant fused to GFP to chromosomes inmitotic HeLa cells. While GFP-IN WT fully co-localized with chromosomal DNA inmitotic cells (Fig. 5),strikingly mutants GFP-IN Q168L and Q168A displayed a diffuse staining andwere no longer able to bind with condensed chromosomes(Fig. 5). In sharp contrast,the enzymatically inactive form of integrase, GFP-IN D116A, is still able tobind to mitotic chromosomes. From these experiments, we conclude thatLEDGF/p75 is not involved in active nuclear import of IN but rather directlytargets IN to the chromosomes of the host cell thereby influencing theretention of this protein in the nucleus. By a combination of multiple complementary approaches based on interactionstudies using random and directed mutagenesis, we could demonstrate thatinteraction of IN with LEDGF/p75 is important for integration and replicationof HIV-1. Our results show that LEDGF/p75 plays the role of a chromosomalligand allowing the binding of IN to the chromosomes and could be involved intargeting the HIV-1 PIC to favorable chromatin regions(6Bushman F.D. Cell. 2003; 115: 135-138Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). The LEDGF/p75 interacting domain maps within the core region of IN wherethe catalytic site is also located. Using two-hybrid screening, we found thatmutations of Gln168 of IN impaired LEDGF/p75 interaction. Althoughthe Q168A mutation that disrupts the IN-LEDGF/p75 interaction has no effect onthe catalytic activity of IN in vitro, the proximity of these twodomains could explain why, at least in vitro, LEDGF/p75 is able tomodulate and enhance the catalytic activity of IN(18Cherepanov P. Maertens G. Proost P. Devreese B. VanBeeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (567) Google Scholar,30Cherepanov P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: 48883-48892Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). Importantly, we foundthat the mutant Q168A was still catalytically active, although it wasdefective for tethering IN to cellular chromosomes. On the other hand, themutant D116A was still able to be targeted to chromosomes, although it wascatalytically dead. These results demonstrate that the tethering of IN to thechromosomes and the catalytic activity of integration are governed by twoindependent determinants in the protein. These results also underline theimportance of LEDGF/p75 function in targeting IN to cellular chromosomes, asan independent step prior to the enzymatic reaction that integrates theproviral cDNA into the host genome. However, one cannot rule out that, oncethe HIV-1 preintegration complex is targeted via LEDGF/p75 at the site ofintegration, LEDGF/p75 could also act as a cofactor for the enhancement of theenzymatic activity of HIV-1 integrase. Our results on the nuclear import of IN using either in vitronuclear import or GFP-IN fusion proteins indicate that LEDGF/p75 is notrequired for active nuclear import of IN. In infected cells, we observed a2-fold reduction of two-LTR circle formation (relative to the amount of totalHIV-1 cDNA), as well as an inhibition of integrated copies ofHIV-1Q168A and HIV-1Q168L. This phenotype is differentfrom that observed with the catalytic mutant of IN, which displayed a 5-foldincrease of two-LTR circles formation as well as inhibition of integratedforms (Fig. 2, B andC). LEDGF/p75 silencing led to proteasome-dependentdegradation of IN (Fig. 3).Furthermore, we observed a decrease in the half-life of IN Q168L and IN Q168Acompared with the WT protein, while IN D116A wasstable. 3D. Tempe., S. Emiliani, and R. Benarous, unpublished data. These datasuggest that by inhibiting its interaction with LEDGF/p75, IN becomes moreprone to degradation in the nucleus, leading to a decrease of the two-LTRcircles forms associated with preintegration complexes. Although we cannotrule out that the isolated IN and the PIC could display distinct karyophilicbehavior, our results show that HIV-1Q168L andHIV-1Q168A are predominantly blocked at the integration step,suggesting that IN-LEDGF/p75 interaction is not directly required forimporting the HIV-1 PIC in the nucleus. Maertens et al.(22Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem. 2004; 279: 33421-33429Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar) found that overexpressionof LEDGF/p75 mutated in the nuclear localization signal resulted in theaggregation of IN-LEDGF/p75 complexes in the cytoplasm. This is fullyconsistent with our own conclusions in favor of a role of LEDGF/p75 in thetargeting of IN to chromatin rather than in nuclear import. In fact,overexpression of a nuclear localization signal mutant of LEDGF/p75 excludedfrom the nucleus but still able to bind to IN will act as a transdominant,trapping IN in the cytoplasm, even if the nuclear import of IN is notcontrolled by interaction with LEDGF/p75. Surprisingly, it was recently reported that replication of HIV-1 in Jurkatcells silenced for LEDGF/p75 was not impaired, despite the fact that in theseconditions, integrase was found delocalized in the cytoplasm(21Llano M. Vanegas M. Fregoso O. Saenz D. Chung S. Peretz M. Poeschla E.M. J. Virol. 2004; 78: 9524-9537Crossref PubMed Scopus (257) Google Scholar). One cannot rule out thatthe functions of LEDGF/p75 in viral replication and chromosomal targeting ofIN could be redundant and that another protein could substitute for LEDGF/p75in certain cell types. Interestingly, it has been proposed that HRP2(hepatoma-derived growth factor protein 2), another hepatoma-derived growthfactor-related protein, is also able to interact with HIV-1 integrase andcould be a substitute for some of LEDGF/p75 functions(30Cherepanov P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: 48883-48892Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). However, we havegenerated several cell lines stably depleted for LEDGF/p75, and we constantlyobserved a reduction of HIV-1 replication in the absence of LEDGF/p75 that wasrestored when the protein wasre-expressed. 4L. Vandekerckhove, F. Christ, M. Michiels, B. Van Maele, J. De Rijck, R.Gijsbers, C. Vandenhaute, and Z. Debyser, submitted for publication.Furthermore, as indicated above, we found that HIV-1Q168L andHIVQ168A viruses were also replication-defective in Jurkatcells. Two other mutations of IN impairing interaction with LEDGF/p75 wererecently described. The point mutation H12N in the zinc binding domain of INwas shown to reduce its affinity for LEDGF/p75 in vitro(19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). V165A, another INmutant, was also shown to be defective for LEDGF/p75 interaction(9Turlure F. Devroe E. Silver P.A. Engelman A. Front. Biosci. 2004; 9: 3187-3208Crossref PubMed Scopus (139) Google Scholar). A virus harboring theV165A mutation was replication-deficient(31Limon A. Devroe E. Lu R. Ghory H.Z. Silver P.A. Engelman A. J. Virol. 2002; 76: 10598-10607Crossref PubMed Scopus (87) Google Scholar). Analysis of the INstructure shows that residues Val165 and Gln168 are inclose contact within the monomer. However, Val165 is partiallyburied within the protein, therefore less accessible for interaction withLEDGF/p75 than Gln168, which is exposed at the surface of theprotein. Altogether, these findings support the notion that LEDGF/p75 is animportant cofactor of HIV-1 integrase involved in its chromosomal targetingand required for integration and replication of HIV-1. Taking into account thefull defect in viral replication resulting from lack of interaction of IN withLEDGF/p75, one can postulate that a compound capable of disrupting orpreventing the interaction of IN with LEDGF/p75 would display a very potentanti-viral activity. We thank Caroline Petit and Lang-Xia Liu for helpful discussions, RikGijsbers for critical reading of the manuscript and EmmanuelSégéral, and Linda Desender and Nathalie Simoes for excellenttechnical assistance. Download .pdf (.51 MB) Help with pdf files
Referência(s)