Proteomics Characterization of Outer Membrane Vesicles from the Extraintestinal Pathogenic Escherichia coli ΔtolR IHE3034 Mutant
2007; Elsevier BV; Volume: 7; Issue: 3 Linguagem: Inglês
10.1074/mcp.m700295-mcp200
ISSN1535-9484
AutoresFrancesco Berlanda Scorza, Francesco Doro, Manuel J. Rodríguez‐Ortega, Maria Stella, Sabrina Liberatori, Anna Rita Taddei, Laura Serino, Danilo Gomes Moriel, Barbara Nesta, Maria Rita Fontana, Angela Spagnuolo, Mariagrazia Pizza, Nathalie Norais, Guido Grandi,
Tópico(s)Pneumonia and Respiratory Infections
ResumoExtraintestinal pathogenic Escherichia coli are the cause of a diverse spectrum of invasive infections in humans and animals, leading to urinary tract infections, meningitis, or septicemia. In this study, we focused our attention on the identification of the outer membrane proteins of the pathogen in consideration of their important biological role and of their use as potential targets for prophylactic and therapeutic interventions. To this aim, we generated a ΔtolR mutant of the pathogenic IHE3034 strain that spontaneously released a large quantity of outer membrane vesicles in the culture supernatant. The vesicles were analyzed by two-dimensional electrophoresis coupled to mass spectrometry. The analysis led to the identification of 100 proteins, most of which are localized to the outer membrane and periplasmic compartments. Interestingly based on the genome sequences available in the current public database, seven of the identified proteins appear to be specific for pathogenic E. coli and enteric bacteria and therefore are potential targets for vaccine and drug development. Finally we demonstrated that the cytolethal distending toxin, a toxin exclusively produced by pathogenic bacteria, is released in association with the vesicles, supporting the recently proposed role of bacterial vesicles in toxin delivery to host cells. Overall, our data demonstrated that outer membrane vesicles represent an ideal tool to study Gram-negative periplasm and outer membrane compartments and to shed light on new mechanisms of bacterial pathogenesis. Extraintestinal pathogenic Escherichia coli are the cause of a diverse spectrum of invasive infections in humans and animals, leading to urinary tract infections, meningitis, or septicemia. In this study, we focused our attention on the identification of the outer membrane proteins of the pathogen in consideration of their important biological role and of their use as potential targets for prophylactic and therapeutic interventions. To this aim, we generated a ΔtolR mutant of the pathogenic IHE3034 strain that spontaneously released a large quantity of outer membrane vesicles in the culture supernatant. The vesicles were analyzed by two-dimensional electrophoresis coupled to mass spectrometry. The analysis led to the identification of 100 proteins, most of which are localized to the outer membrane and periplasmic compartments. Interestingly based on the genome sequences available in the current public database, seven of the identified proteins appear to be specific for pathogenic E. coli and enteric bacteria and therefore are potential targets for vaccine and drug development. Finally we demonstrated that the cytolethal distending toxin, a toxin exclusively produced by pathogenic bacteria, is released in association with the vesicles, supporting the recently proposed role of bacterial vesicles in toxin delivery to host cells. Overall, our data demonstrated that outer membrane vesicles represent an ideal tool to study Gram-negative periplasm and outer membrane compartments and to shed light on new mechanisms of bacterial pathogenesis. Extraintestinal pathogenic Escherichia coli (ExPEC) 1The abbreviations used are: ExPEC, extraintestinal pathogenic E. coli; APEC, avian pathogenic E. coli; CDT, cytolethal distending toxin; IPEC, intestinal pathogenic E. coli; LT, heat-labile enterotoxin; OMV, outer membrane vesicle; kmr, kanamycin resistance; LB, Luria-Bertani; 2D, two-dimensional. are the most common enteric Gram-negative species causing a large variety of extraintestinal infections, including urinary tract infections, pneumonia, meningitis, osteomyelitis, and soft tissue infections (1Johnson J.R. Russo T.A. Uropathogenic Escherichia coli as agents of diverse non-urinary tract extraintestinal infections.J. Infect. Dis. 2002; 186: 859-864Crossref PubMed Scopus (71) Google Scholar, 2Johnson J.R. Russo T.A. Extraintestinal pathogenic Escherichia coli: "the other bad E coli".J. Lab. Clin. Med. 2002; 139: 155-162Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar, 3Xie Y. Kim K.J. Kim K.S. Current concepts on Escherichia coli K1 translocation of the blood-brain barrier.FEMS Immunol. Med. Microbiol. 2004; 42: 271-279Crossref PubMed Scopus (99) Google Scholar). Furthermore ExPEC is the leading cause of severe sepsis, accounting for several thousands of deaths every year in the United States alone (4Minino A.M. Heron M.P. Smith B.L. Deaths: preliminary data for 2004.Natl. Vital Stat. Rep. 2006; 54: 1-49Google Scholar, 5Minino A.M. Smith B.L. Deaths: preliminary data for 2000.Natl. Vital Stat. Rep. 2001; 49: 1-40Google Scholar). Because of its aggressiveness and because of the alarming incidence of antibiotic resistance encountered in several recent disease isolates, ExPEC has become the object of intense research aimed at the development of an efficacious prophylactic therapy. Different approaches have been undertaken in this direction (6Russo T.A. Johnson J.R. Extraintestinal isolates of Escherichia coli: identification and prospects for vaccine development.Expert Rev. Vaccines. 2006; 5: 45-54Crossref PubMed Scopus (25) Google Scholar), but none of them have so far led to a product sufficiently satisfactory for human use. A variety of whole-cell vaccine formulations, administered via vaginal or oral routes, have been assessed in animal models and human clinical trials in Europe (7Grischke E.M. Ruttgers H. Treatment of bacterial infections of the female urinary tract by immunization of the patients.Urol. Int. 1987; 42: 338-341Crossref PubMed Scopus (41) Google Scholar, 8Uehling D.T. Hopkins W.J. Elkahwaji J.E. Schmidt D.M. Leverson G.E. Phase 2 clinical trial of a vaginal mucosal vaccine for urinary tract infections.J. Urol. 2003; 170: 867-869Crossref PubMed Scopus (82) Google Scholar, 9Huber M. Krauter K. Winkelmann G. Bauer H.W. Rahlfs V.W. Lauener P.A. Blessmann G.S. Bessler W.G. Immunostimulation by bacterial components: II. Efficacy studies and meta-analysis of the bacterial extract OM-89.Int. J. Immunopharmacol. 2000; 22: 1103-1111Crossref PubMed Scopus (30) Google Scholar, 10Bauer H.W. Alloussi S. Egger G. Blumlein H.M. Cozma G. Schulman C.C. A long-term, multicenter, double-blind study of an Escherichia coli extract (OM-89) in female patients with recurrent urinary tract infections.Eur. Urol. 2005; 47: 542-548Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 11Bauer H.W. Rahlfs V.W. Lauener P.A. Blessmann G.S. Prevention of recurrent urinary tract infections with immuno-active E. coli fractions: a meta-analysis of five placebo-controlled double-blind studies.Int. J. Antimicrob. Agents. 2002; 19: 451-456Crossref PubMed Scopus (103) Google Scholar, 12Koukalova D. Krocova Z. Vitek P. Macela A. Hajek V. Immunostimulatory activity of the vaccine used in the treatment of recurrent urinary infections. II.Bratisl. Lek. Listy. 1999; 100: 215-217PubMed Google Scholar, 13Koukalova D. Reif R. Hajek V. Mucha Z. Vesely J. Viktorinova M. Lochman I. Immunomodulation of recurrent urinary tract infections with Urvakol vaccine.Bratisl. Lek. Listy. 1999; 100: 246-251PubMed Google Scholar, 14Marinova S. Nenkov P. Markova R. Nikolaeva S. Kostadinova R. Mitov I. Vretenarska M. Cellular and humoral systemic and mucosal immune responses stimulated by an oral polybacterial immunomodulator in patients with chronic urinary tract infections.Int. J. Immunopathol. Pharmacol. 2005; 18: 457-473Crossref PubMed Scopus (32) Google Scholar, 15Nenkov P. Mitov I. Marinova S. Markova R. Experimental investigations on the immunomodulating activity of polybacterial preparation for peroral immunotherapy and immunoprophylaxis of uroinfections.Int. J. Immunopharmacol. 1995; 17: 489-496Crossref PubMed Scopus (8) Google Scholar). These vaccines hold some promise but require further evaluation, particularly in consideration of the fact that whole cell-based vaccines are likely to elicit undesired immune responses against antigens shared with commensal E. coli strains. Capsular polysaccharide vaccines have been shown to confer protection in animal models. However, because E. coli polysaccharide exhibits high variability (E. coli has been classified in more than 80 capsular serotypes (16Jann B. Jann K. Structure and biosynthesis of the capsular antigens of Escherichia coli..Curr. Top. Microbiol. Immunol. 1990; 150: 19-42PubMed Google Scholar)), polysaccharide-based vaccines are unlikely to confer a sufficiently broad protection. Finally different toxins, such as the α-hemolysin (HlyA) (17Linggood M.A. Ingram P.L. The role of α haemolysin in the virulence of Escherichia coli for mice.J. Med. Microbiol. 1982; 15: 23-30Crossref PubMed Scopus (38) Google Scholar, 18O'Hanley P. Lalonde G. Ji G. α-Hemolysin contributes to the pathogenicity of piliated digalactoside-binding Escherichia coli in the kidney: efficacy of an α-hemolysin vaccine in preventing renal injury in the BALB/c mouse model of pyelonephritis.Infect. Immun. 1991; 59: 1153-1161Crossref PubMed Google Scholar, 19O'Hanley P. Marcus R. Baek K.H. Denich K. Ji G.E. Genetic conservation of hlyA determinants and serological conservation of HlyA: basis for developing a broadly cross-reactive subunit Escherichia coli α-hemolysin vaccine.Infect. Immun. 1993; 61: 1091-1097Crossref PubMed Google Scholar), the cytotoxic necrotizing factor-1 (20Rippere-Lampe K.E. O'Brien A.D. Conran R. Lockman H.A. Mutation of the gene encoding cytotoxic necrotizing factor type 1 (cnf1) attenuates the virulence of uropathogenic Escherichia coli..Infect. Immun. 2001; 69: 3954-3964Crossref PubMed Scopus (129) Google Scholar), and the cytolytic distending toxin (21Johnson W.M. Lior H. A new heat-labile cytolethal distending toxin (CLDT) produced by Escherichia coli isolates from clinical material.Microb. Pathog. 1988; 4: 103-113Crossref PubMed Scopus (136) Google Scholar, 22Kesty N.C. Mason K.M. Reedy M. Miller S.E. Kuehn M.J. Enterotoxigenic Escherichia coli vesicles target toxin delivery into mammalian cells.EMBO J. 2004; 23: 4538-4549Crossref PubMed Scopus (279) Google Scholar), have been identified in several ExPEC isolates and have been shown to contribute to pathogenesis, but their role as potential vaccines remains to be demonstrated. In summary, alternative strategies for vaccine candidate identification need to be undertaken. Because protection against ExPEC infections appears to be largely mediated by antibody responses both in the animal models and in humans (23Russo T.A. Beanan J.M. Olson R. Genagon S.A. Macdonald U. Cope J.J. Davidson B.A. Johnston B. Johnson J.R. A killed, genetically engineered derivative of a wild-type extraintestinal pathogenic E. coli strain is a vaccine candidate.Vaccine. 2007; 25: 3859-3870Crossref PubMed Scopus (28) Google Scholar, 24Evans Jr., D.J. Ruiz-Palacios G. Evans D.E. DuPont H.L. Pickering L.K. Olarte J. Humoral immune response to the heat-labile enterotoxin of Escherichia coli in naturally acquired diarrhea and antitoxin determination by passive immune hemolysis.Infect. Immun. 1977; 16: 781-788Crossref PubMed Google Scholar, 25Greatorex J.S. Thorne G.M. Humoral immune responses to Shiga-like toxins and Escherichia coli O157 lipopolysaccharide in hemolytic-uremic syndrome patients and healthy subjects.J. Clin. Microbiol. 1994; 32: 1172-1178Crossref PubMed Google Scholar, 26Leblanc J. Fliss I. Matar C. Induction of a humoral immune response following an Escherichia coli O157:H7 infection with an immunomodulatory peptidic fraction derived from Lactobacillus helveticus-fermented milk.Clin. Diagn. Lab. Immunol. 2004; 11: 1171-1181Crossref PubMed Scopus (86) Google Scholar), the detailed characterization of the outer membrane-associated proteins, the family of proteins which mostly contribute to humoral immunity, would be an important step forward in the identification of new vaccine candidates. Several proteomics approaches have been proposed for membrane protein characterization. Overall, these studies have led to a better understanding of bacterial membrane organization and topology (for a review, see Ref. 27Cordwell S.J. Technologies for bacterial surface proteomics.Curr. Opin. Microbiol. 2006; 9: 320-329Crossref PubMed Scopus (69) Google Scholar). However, the majority of these approaches suffer from the drawback of being somewhat poorly selective in that serious contaminations with proteins from the cytoplasmic compartment have been reported. Recently we have proposed a novel approach for the characterization of Gram-negative outer membrane proteins that is based on the selection of mutant strains releasing outer membrane vesicles (OMVs) in the culture supernatant (28Ferrari G. Garaguso I. Adu-Bobie J. Doro F. Taddei A.R. Biolchi A. Brunelli B. Giuliani M.M. Pizza M. Norais N. Grandi G. Outer membrane vesicles from group B Neisseria meningitidis Δgna33 mutant: proteomic and immunological comparison with detergent-derived outer membrane vesicles.Proteomics. 2006; 6: 1856-1866Crossref PubMed Scopus (139) Google Scholar, 29Adu-Bobie J. Lupetti P. Brunelli B. Granoff D. Norais N. Ferrari G. Grandi G. Rappuoli R. Pizza M. GNA33 of Neisseria meningitidis is a lipoprotein required for cell separation, membrane architecture, and virulence.Infect. Immun. 2004; 72: 1914-1919Crossref PubMed Scopus (50) Google Scholar). Gram-negative bacteria are known to release OMVs when grown in liquid culture, and vesicle production is considered to be a physiological process by which bacteria exert different functions (for recent reviews, see Kuehn and Kesty (30Kuehn M.J. Kesty N.C. Bacterial outer membrane vesicles and the host-pathogen interaction.Genes Dev. 2005; 19: 2645-2655Crossref PubMed Scopus (662) Google Scholar) and Mashburn-Warren and Whiteley (31Mashburn-Warren L.M. Whiteley M. Special delivery: vesicle trafficking in prokaryotes.Mol. Microbiol. 2006; 61: 839-846Crossref PubMed Scopus (302) Google Scholar)). However, the amount of OMVs released in the liquid culture is usually quite minute, and this had prevented their detailed biochemical characterization. In an attempt to increase the amount of OMV production in Neisseria meningitidis, we screened a panel of mutants and found that inactivation of the gna33 gene encoding a lytic transglycosylase, an enzyme involved in the integrity of the outer membrane, resulted in massive production of OMVs (29Adu-Bobie J. Lupetti P. Brunelli B. Granoff D. Norais N. Ferrari G. Grandi G. Rappuoli R. Pizza M. GNA33 of Neisseria meningitidis is a lipoprotein required for cell separation, membrane architecture, and virulence.Infect. Immun. 2004; 72: 1914-1919Crossref PubMed Scopus (50) Google Scholar). When thoroughly characterized by mono- and two-dimensional electrophoresis coupled to mass spectrometry, OMVs turned out to be almost exclusively composed by proteins belonging to the outer membrane and periplasmic compartments (28Ferrari G. Garaguso I. Adu-Bobie J. Doro F. Taddei A.R. Biolchi A. Brunelli B. Giuliani M.M. Pizza M. Norais N. Grandi G. Outer membrane vesicles from group B Neisseria meningitidis Δgna33 mutant: proteomic and immunological comparison with detergent-derived outer membrane vesicles.Proteomics. 2006; 6: 1856-1866Crossref PubMed Scopus (139) Google Scholar). Remarkably the OMVs purified from the culture supernatant of the mutant strain elicited a robust protective immune response in experimental animals as judged by the high bactericidal activity of sera from immunized animals against strains of different hypervirulent lineages. Production of OMVs by non-pathogenic E. coli strains mutated in proteins that interact with the murein layer and that form complexes cross-linking the inner and outer membranes was described a few years ago (32Bernadac A. Gavioli M. Lazzaroni J.C. Raina S. Lloubes R. Escherichia coli tol-pal mutants form outer membrane vesicles.J. Bacteriol. 1998; 180: 4872-4878Crossref PubMed Google Scholar, 33Suzuki H. Nishimura Y. Yasuda S. Nishimura A. Yamada M. Hirota Y. Murein-lipoprotein of Escherichia coli: a protein involved in the stabilization of bacterial cell envelope.Mol. Gen. Genet. 1978; 167: 1-9Crossref PubMed Scopus (116) Google Scholar, 34Yem D.W. Wu H.C. Physiological characterization of an Escherichia coli mutant altered in the structure of murein lipoprotein.J. Bacteriol. 1978; 133: 1419-1426Crossref PubMed Google Scholar, 35Cascales E. Bernadac A. Gavioli M. Lazzaroni J.C. Lloubes R. Pal lipoprotein of Escherichia coli plays a major role in outer membrane integrity.J. Bacteriol. 2002; 184: 754-759Crossref PubMed Scopus (209) Google Scholar). In particular, OMV-producing mutants were generated by inactivating genes coding for the Braun's (murein) lipoprotein (Lpp) and the proteins TolA, TolB, TolQ, TolR, and Pal belonging to the Tol-Pal system. However, no information on the protein content of these OMVs has been presented so far. With the aim of better understanding the membrane protein organization of E. coli and of identifying proteins to be included in vaccine formulations capable of preventing ExPEC infections, in this study we describe the inactivation of the tolR gene in the pathogenic E. coli strain IHE3034 and the detailed characterization of the protein content of the purified OMVs. Here we show that the vesicles are constituted by at least 100 proteins, the large majority of which belong to the category of outer membrane and periplasmic proteins. Interestingly among the identified proteins, the three-subunit cytolethal distending toxin (CDT) was present. The toxin was exclusively found associated to the vesicles, suggesting that OMVs may represent the natural vehicle through which CDT is delivered to the target cells. This mechanism is consistent with what has been published recently on the OMV-mediated release of the heat-labile enterotoxin (LT) and the cytotoxic necrotizing factor-1 (22Kesty N.C. Mason K.M. Reedy M. Miller S.E. Kuehn M.J. Enterotoxigenic Escherichia coli vesicles target toxin delivery into mammalian cells.EMBO J. 2004; 23: 4538-4549Crossref PubMed Scopus (279) Google Scholar, 36Kouokam J.C. Wai S.N. Fallman M. Dobrindt U. Hacker J. Uhlin B.E. Active cytotoxic necrotizing factor 1 associated with outer membrane vesicles from uropathogenic Escherichia coli..Infect. Immun. 2006; 74: 2022-2030Crossref PubMed Scopus (77) Google Scholar). To the best of our knowledge, this is the first detailed proteomics characterization of E. coli outer membrane and periplasmic proteins. The ΔtolR mutant was produced by replacing tolR coding sequence with a kanamycin resistance (kmr) cassette (37Derbise A. Lesic B. Dacheux D. Ghigo J.M. Carniel E. A rapid and simple method for inactivating chromosomal genes in Yersinia..FEMS Immunol. Med. Microbiol. 2003; 38: 113-116Crossref PubMed Scopus (199) Google Scholar). To this aim, we used a three-step PCR protocol to fuse the tolR upstream and downstream regions to the kmr gene. Briefly the 528-bp upstream and 466-bp downstream regions of the tolR gene were amplified from IHE3034 genomic DNA with the primer pairs UpF (TCTGGAATCGAACTCTCTCG)/UpR-kan (ATTTTGAGACACAACGTGGCTTTCATGGCTTACCCCTTGTTG) and DownF-kan (TTCACGAGGCAGACCTCATAAACATCTGCGTTTCCCTTG)/DownR (TTGCTTCTGCTTTAACTCGG), respectively. In parallel, the kmr cassette was amplified from plasmid pUC4K (38Taylor L.A. Rose R.E. A correction in the nucleotide sequence of the Tn903 kanamycin resistance determinant in pUC4K.Nucleic Acids Res. 1988; 16: 358Crossref PubMed Scopus (136) Google Scholar) using the primers kan-F (ATGAGCCATATTCAACGGGAAAC) and kan-R (TTAGAAAAACTCATCGAGCATCAAA). Finally the three amplified fragments were fused together by mixing 100 ng of each in a PCR containing the UpF/DownR primers. The linear fragment (1 μg), in which the kmr gene was flanked by the tolR upstream and downstream regions, was used to transform the recombination-prone IHE3034 E. coli strain (50 μl at 1010 cells/ml, made electrocompetent by three washing steps in ice-cold 10% glycerol), and ΔtolR mutants were selected by plating transformed bacteria on Luria-Bertani (LB) plates containing 25 μg/ml kanamycin. Recombination-prone IHE3034 cells were produced by using the highly proficient homologous recombination system (red operon) (39Maxson M.E. Darwin A.J. Identification of inducers of the Yersinia enterocolitica phage shock protein system and comparison to the regulation of the RpoE and Cpx extracytoplasmic stress responses.J. Bacteriol. 2004; 186: 4199-4208Crossref PubMed Scopus (68) Google Scholar). Briefly electrocompetent bacterial cells (50 μl at 1010 cells/ml) were transformed with 5 μg of plasmid pAJD434 by electroporation (5.9 ms at 2.5 kV). Bacteria were then grown for 1 h at 30 °C in 1 ml of SOC broth (39Maxson M.E. Darwin A.J. Identification of inducers of the Yersinia enterocolitica phage shock protein system and comparison to the regulation of the RpoE and Cpx extracytoplasmic stress responses.J. Bacteriol. 2004; 186: 4199-4208Crossref PubMed Scopus (68) Google Scholar) and then plated on LB plates containing trimethoprim (100 μg/ml). One transformed colony was grown in LB (5 ml) with trimethoprim (100 μg/ml) at 30 °C until A600 = 0.2. Expression of the red genes carried by pAJD434 was induced by adding 0.2% l-arabinose to the medium for 3 h. The gene deletion of the tolR gene was confirmed by PCR genomic DNA amplification using primers specifically annealing to tolR (TolR_ko_-7 (ACGTACTGCTGGTGCTGTTG) and TolR_ko_-8 (AGAAAGACCGTTTTCGGGTT)) and to kanamycin resistance gene (Kan-int-For (TCGCGATAATGTCGGGCAATCAG) and Kan-int-Rev (GAGGCAGTTCCATAGGATGGCAAG)). The deletion was confirmed also using the primers tolR-F (CGGACCCGTATTCTTAAC) and tolR-R (GCCTTCGCTTTAGCATCT) annealing further upstream and downstream from the 5′- and 3′-flanking regions, respectively. Genomic DNA was prepared from overnight liquid culture of IHE3034 and its isogenic tolR mutant using the NucleoSpin Tissue kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany). 5 μg of each DNA were digested overnight with AvaII restriction enzyme at 37 °C and loaded on a 0.7% agarose gel with appropriate DNA size markers. A 622-bp DNA probe partially overlapping the kanamycin resistance gene was prepared by PCR from pUC4K vector (38Taylor L.A. Rose R.E. A correction in the nucleotide sequence of the Tn903 kanamycin resistance determinant in pUC4K.Nucleic Acids Res. 1988; 16: 358Crossref PubMed Scopus (136) Google Scholar) with the primers Kan-int-For and Kan-int-Rev. Southern blot was performed with the ECL Direct Nucleic Acid Labeling and Detection Systems kit (GE Healthcare) as described by the manufacturer. IHE3034 ExPEC strain (serotype O18:K1:H7) was isolated in 1976 from a case of human neonatal meningitis (40Achtman M. Mercer A. Kusecek B. Pohl A. Heuzenroeder M. Aaronson W. Sutton A. Silver R.P. Six widespread bacterial clones among Escherichia coli K1 isolates.Infect. Immun. 1983; 39: 315-335Crossref PubMed Google Scholar), and CFT073 strain (serotype O6:K2:H1) was isolated from a case of acute pyelonephritis (41Mobley H.L. Green D.M. Trifillis A.L. Johnson D.E. Chippendale G.R. Lockatell C.V. Jones B.D. Warren J.W. Pyelonephritogenic Escherichia coli and killing of cultured human renal proximal tubular epithelial cells: role of hemolysin in some strains.Infect. Immun. 1990; 58: 1281-1289Crossref PubMed Google Scholar). The wild type strains and the respective isogenic ΔtolR mutants were grown on an LB agar plate at 37 °C or LB medium, in a rotary shaker, to reach A600 = 0.4. From liquid cultures, bacteria were collected by 10-min centrifugation at 4000 × g. Culture media of wild type and ΔtolR strains were filtered through a 0.22-μm-pore size filter (Millipore, Bedford, MA). The filtrates were subjected to high speed centrifugation (200,000 × g for 90 min), and the pellets containing the OMVs were washed with PBS and finally resuspended with PBS. OMVs were fixed overnight in 2.5% glutaraldehyde in PBS and then washed and resuspended in the same buffer. A drop of suspension was placed on Formvar/carbon-coated grids, and OMVs were adsorbed for 5 min. Grids were then washed with distilled water and blotted with a filter paper. For negative staining, grids were treated with 2% uranyl acetate for 1 min, air-dried, and viewed with a Jeol JEM 1200 EXII electron microscope operating at 80 kV. OMVs were denatured for 3 min at 95 °C in SDS-PAGE sample buffer containing 2% (w/v) SDS. 20 μg of proteins were loaded onto 4–12% (w/v) polyacrylamide gels (Bio-Rad). Gels were run in MOPS buffer (Bio-Rad) and were stained with Coomassie Blue R-250. Two hundred micrograms of OMVs were separated by two-dimensional electrophoresis as described in Ferrari et al. (28Ferrari G. Garaguso I. Adu-Bobie J. Doro F. Taddei A.R. Biolchi A. Brunelli B. Giuliani M.M. Pizza M. Norais N. Grandi G. Outer membrane vesicles from group B Neisseria meningitidis Δgna33 mutant: proteomic and immunological comparison with detergent-derived outer membrane vesicles.Proteomics. 2006; 6: 1856-1866Crossref PubMed Scopus (139) Google Scholar). Briefly proteins were separated in the first dimension on a non-linear pH 3–10 gradient and in the second dimension on a linear 9–16% polyacrylamide gradient. Gels were stained with colloidal Coomassie Blue-G250 (42Doherty N.S. Littman B.H. Reilly K. Swindell A.C. Buss J.M. Anderson N.L. Analysis of changes in acute-phase plasma proteins in an acute inflammatory response and in rheumatoid arthritis using two-dimensional gel electrophoresis.Electrophoresis. 1998; 19: 355-363Crossref PubMed Scopus (160) Google Scholar). Protein spots were excised from the gels, washed with 50 mm ammonium bicarbonate (Fluka Chemie AG, Buchs, Switzerland), acetonitrile (J. T. Baker Inc.) (50:50, v/v), washed once with pure acetonitrile, and air-dried. Dried spots were digested for 2 h at 37 °C in 12 μl of 0.012 μg/μl sequencing grade modified trypsin (Promega, Madison, WI) in 5 mm ammonium bicarbonate. After digestion, 0.6 μl was loaded on a matrix PAC target (Prespotted AnchorChip 96, set for proteomics, Bruker Daltonics, Bremen, Germany) and air-dried. Spots were washed with 0.6 μl of a solution of 70% ethanol, 0.1% trifluoroacetic acid. Mass spectra were acquired on an Ultraflex MALDI-TOF-TOF mass spectrometer (Bruker Daltonics) in reflectron, positive mode in the mass range of 900–3500 Da. Spectra were externally calibrated by using a combination of standards prespotted on the target (Bruker Daltonics). MS spectra were analyzed with flexAnalysis (flexAnalysis version 2.4, Bruker Daltonics). Monoisotopic peaks were annotated with flexAnalysis default parameters and manually revised. Protein identification was carried from the generated peak list using the Mascot program (Mascot server version 2.2.01, Matrix Science). Mascot was run on a public database (National Center for Biotechnology Information non-redundant (NCBInr), Gram-negative, release June 19, 2007; 5,043,617 sequences) or a database containing protein sequences (18,478 sequences) deduced from four sequenced E. coli genomes downloaded from NCBInr. We used the genome of the two commensal E. coli K-12 strains MG1655 and W3110 (accession numbers NC_000913 and AC_000091, respectively (43Blattner F.R. Plunkett >III, G. Bloch C.A. Perna N.T. Burland V. Riley M. Collado-Vides J. Glasner J.D. Rode C.K. Mayhew G.F. Gregor J. Davis N.W. Kirkpatrick H.A. Goeden M.A. Rose D.J. Mau B. Shao Y. The complete genome sequence of Escherichia coli K-12.Science. 1997; 277: 1453-1474Crossref PubMed Scopus (6056) Google Scholar, 44Riley M. Abe T. Arnaud M.B. Berlyn M.K. Blattner F.R. Chaudhuri R.R. Glasner J.D. Horiuchi T. Keseler I.M. Kosuge T. Mori H. Perna N.T. Plunkett >III, G. Rudd K.E. Serres M.H. Thomas G.H. Thomson N.R. Wishart D. Wanner B.L. Escherichia coli K-12: a cooperatively developed annotation snapshot—2005.Nucleic Acids Res. 2006; 34: 1-9Crossref PubMed Scopus (428) Google Scholar)) and the two extraintestinal pathogenic strains E. coli 536 (accession number NC_008253) and CFT073 (accession number NC_004431 (45Welch R.A. Burland V. Plunkett >III, G. Redford P. Roesch P. Rasko D. Buckles E.L. Liou S.R. Boutin A. Hackett J. Stroud D. Mayhew G.F. Rose D.J. Zhou S. Schwartz D.C. Perna N.T. Mobley H.L. Donnenberg M.S. Blattner F.R. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli..Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 17020-17024Crossref PubMed Scopus (1153) Google Scholar)). Search parameters were as follows: fixed modifications, propionamide (Cys); variable modifications, oxidation (Met); cleavage by trypsin (cuts C-terminal side of Lys and Arg unless next residue is Pro); mass tolerance, 300 ppm; missed cleavage, 0; mass values, MH+ monoisotopic. Known contaminant ions (trypsin, m/z = 842.509400, 1045.563700, 1165.585300, 1179.601000, 1300.530200, 1713.808400, 1716.851700, 1774.897500, 1993.976700, 2083.009600, 2211.104000, 2283.180200, and 2825.405600) were excluded. Identifications were validated when the Mowse score was significant according to Mascot (46Pappin D.J. Peptide mass fingerprinting using MALDI-TOF mass spectrometry.Methods Mol. Biol. 2003; 211: 211-219PubMed Google Scholar). If peptides matched to multiple members of a protein family we reported the accession number of the protein identified as the first hit (top rank) by Mascot. Strain of reference, accession number, annotation, Mowse score, percentage of protein coverage, number of unique peptides matched, number of masses not matched, score for the highest ranked hit to a non-homologous protein, and score for search in a decoy database (Mascot) are reported in Supplemental Table 1. Prediction of protein localization was carried out using the PSORTb algorithm (47Gardy J.L. Laird M.R. Chen F. Rey S. Walsh C.J. Ester M. Brinkman F.S. PSORTb v. 2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparat
Referência(s)