Bcl-2 Undergoes Phosphorylation by c-Jun N-terminal Kinase/Stress-activated Protein Kinases in the Presence of the Constitutively Active GTP-binding Protein Rac1
1997; Elsevier BV; Volume: 272; Issue: 40 Linguagem: Inglês
10.1074/jbc.272.40.25238
ISSN1083-351X
AutoresKinsey Maundrell, Bruno Antonsson, Edith Magnenat, Montserrat Camps, Marco Muda, Christian Chabert, Corine Gilliéron, Ursula Boschert, Elizabeth Vial-Knecht, Jean‐Claude Martinou, Steve Arkinstall,
Tópico(s)Protein Kinase Regulation and GTPase Signaling
ResumoWe have studied the phosphorylation of the Bcl-2 family of proteins by different mitogen-activated protein (MAP) kinases. Purified Bcl-2 was found to be phosphorylated by the c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) p54-SAPKβ, and this is specific insofar as the extracellular signal-regulated kinase 1 (ERK1) and p38/RK/CSBP (p38) catalyzed only weak modification. Bcl-2 undergoes similar phosphorylation in COS-7 when coexpressed together with p54-SAPKβ and the constitutive Rac1 mutant G12V. This is seen by both 32PO4labeling and the appearance of five discrete Bcl-2 bands with reduced gel mobility. As anticipated, both intracellular p54-SAPKβ activation and Bcl-2 phosphorylation are blocked by co-transfection with the MAP kinase specific phosphatase MKP3/PYST1. MAP kinase specificity is also seen in COS-7 cells as Bcl-2 undergoes only weak phosphorylation when co-expressed with enzymatically activated ERK1 or p38. Four critical residues undergoing phosphorylation in COS-7 cells were identified by expression of the quadruple Bcl-2 point mutant T56A,S70A,T74A,S87A. Sequencing phosphopeptides derived from tryptic digests of Bcl-2 indicates that purified GST-p54-SAPKβ phosphorylates identical sitesin vitro. This is the first report of Bcl-2 phosphorylation by the JNK/SAPK class of MAP kinases and could indicate a key modification allowing control of Bcl-2 function by cell surface receptors, Rho family GTPases, and/or cellular stresses. We have studied the phosphorylation of the Bcl-2 family of proteins by different mitogen-activated protein (MAP) kinases. Purified Bcl-2 was found to be phosphorylated by the c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) p54-SAPKβ, and this is specific insofar as the extracellular signal-regulated kinase 1 (ERK1) and p38/RK/CSBP (p38) catalyzed only weak modification. Bcl-2 undergoes similar phosphorylation in COS-7 when coexpressed together with p54-SAPKβ and the constitutive Rac1 mutant G12V. This is seen by both 32PO4labeling and the appearance of five discrete Bcl-2 bands with reduced gel mobility. As anticipated, both intracellular p54-SAPKβ activation and Bcl-2 phosphorylation are blocked by co-transfection with the MAP kinase specific phosphatase MKP3/PYST1. MAP kinase specificity is also seen in COS-7 cells as Bcl-2 undergoes only weak phosphorylation when co-expressed with enzymatically activated ERK1 or p38. Four critical residues undergoing phosphorylation in COS-7 cells were identified by expression of the quadruple Bcl-2 point mutant T56A,S70A,T74A,S87A. Sequencing phosphopeptides derived from tryptic digests of Bcl-2 indicates that purified GST-p54-SAPKβ phosphorylates identical sitesin vitro. This is the first report of Bcl-2 phosphorylation by the JNK/SAPK class of MAP kinases and could indicate a key modification allowing control of Bcl-2 function by cell surface receptors, Rho family GTPases, and/or cellular stresses. Programmed cell death (PCD) 1The abbreviations used are: PCD, programmed cell death; MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase: JNK/SAPK, c-Jun N-terminal kinase/stress-activated protein kinase; SEK1, SAPK ERK kinase-1; MKP, MAP kinase phosphatase; MBP, myelin basic protein; ATF-2, activating transcription factor 2; HA, hemagglutinin; PCR, polymerase chain reaction; GST, glutathione S-transferase; EGF, epidermal growth factor; HPLC, high pressure liquid chromatography. is an essential process for tissue development and homeostasis as well as for elimination of damaged cells. Failure to control PCD appropriately can lead to diseases involving either inadequate or unwanted cell death (e.g.. cancers and neurodegeneration) (1Raff M.C. Nature. 1992; 356: 397-400Crossref PubMed Scopus (2507) Google Scholar, 2Thompson C.B. Science. 1995; 267: 1456-1462Crossref PubMed Scopus (6244) Google Scholar, 3Yang E. Korsmeyer S.J. Blood. 1996; 88: 386-401Crossref PubMed Google Scholar). Several intracellular molecules controlling PCD have now been identified. These include Bcl-2, which is a homologue of the Caenorhabditis elegans gene ced-9 and blocks apoptosis under a variety of conditions (3Yang E. Korsmeyer S.J. Blood. 1996; 88: 386-401Crossref PubMed Google Scholar, 4Garcia I. Martinou I. Tsujimoto Y. Martinou J.-C. Science. 1992; 258: 302-306Crossref PubMed Scopus (695) Google Scholar, 5Dubois-Dauphin M. Frankowski H. Tsujimoto Y. Huarte J. Martinou J.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3309-3313Crossref PubMed Scopus (243) Google Scholar, 6Hengartner M.O. Horvitz H.R. Cell. 1994; 76: 665-676Abstract Full Text PDF PubMed Scopus (1057) Google Scholar). In vertebrates, several Bcl-2 family members have now been identified and include both repressors (e.g. Bcl-2, Bcl-XL, Mcl-1, and A1) and promoters (e.g. Bax, Bcl-XS, Bak, and Bad) of PCD (3Yang E. Korsmeyer S.J. Blood. 1996; 88: 386-401Crossref PubMed Google Scholar, 7Farrow S.N. Brown R. Curr. Opin. Genet. Dev. 1996; 6: 45-49Crossref PubMed Scopus (243) Google Scholar). These genes are characterized by their ability to form complex networks of homo- and heterodimers, and their relative abundance probably plays a major role in determining sensitivity to apoptotic signals (3Yang E. Korsmeyer S.J. Blood. 1996; 88: 386-401Crossref PubMed Google Scholar, 8Sato T. Hanada M. Bodrug S. Irie S. Iwama N. Boise L. Thompson C. Golemis E. Fong L. Wang H.-G. Reed J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9238-9242Crossref PubMed Scopus (597) Google Scholar, 9Sedlak T. Oltvai Z. Yang E. Wang K. Boise L. Thompson C. Korsmeyer S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7834-7838Crossref PubMed Scopus (788) Google Scholar, 10Oltvai Z.N. Korsmeyer S.J. Cell. 1994; 79: 189-192Abstract Full Text PDF PubMed Scopus (778) Google Scholar). One major unanswered question in relation to control of apoptosis by Bcl-2 family members is of their regulation by extracellular signals or external environment and, importantly, whether receptor-linked transduction pathways target this gene family as a means of determining cell fate. Emerging data imply that the Bcl-2 gene family are targets for phosphorylation suggesting one potential mechanism of control. For instance, taxol is a chemotherapeutic agent known to promote death, and recent studies in leukemic, prostate, and nasopharyngeal carcinoma cells show that this is accompanied by Bcl-2 phosphorylation (11Haldar S. Jena N. Croce C.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (752) Google Scholar, 12Haldar S. Chintapalli J. Croce C.M. Cancer Res. 1996; 56: 1253-1255PubMed Google Scholar, 13Shu C.-H. Yang W.K. Huang T.-S. Apoptosis. 1996; 1: 141-146Crossref Google Scholar). Bcl-2 has also been reported to be phosphorylated in Jurkat cells (14Chen C.Y. Faller D.V. J. Biol. Chem. 1996; 271: 2376-2379Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar,15Chen C.Y. Faller D.V. Oncogene. 1996; 11: 1487-1498Google Scholar). Interestingly, Bcl-2 has been reported to associate with Raf-1, which targets this kinase to mitochondrial membranes where the Bcl-2 homologue Bad appears to be a phosphorylation target (16Wang H.-G. Rapp U.R. Reed J.C. Cell. 1996; 87: 629-638Abstract Full Text Full Text PDF PubMed Scopus (714) Google Scholar). Together, these observations support the notion that phosphorylation of Bcl-2 family members could be a pivotal mechanism for integrating pro- and anti-apoptotic signals. The molecular identity of protein kinases underlying such phosphorylation is a question of paramount importance to our understanding of PCD. MAP kinases comprise the extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK), and p38/RK/CSBP (p38) as three structurally and functionally distinct enzyme classes. Multiple genes and splice variants for each MAP kinase class have also been identified (17Cano E. Mahadevan L.C. Trends Biochem. Sci. 1995; 20: 117-122Abstract Full Text PDF PubMed Scopus (1007) Google Scholar, 18Marshall C.J. Cell. 1995; 80: 179-185Abstract Full Text PDF PubMed Scopus (4287) Google Scholar, 19Cohen, P. (1997) Trends Cell Biol., in pressGoogle Scholar, 20Gupta S. Barrett T. Whitmarsh A.J. Cavanagh J. Sluss H.K. Derijard B. Davies R.J. EMBO J. 1996; 15: 2760-2770Crossref PubMed Scopus (1195) Google Scholar). The ability of different MAP kinases to phosphorylate Bcl-2 family members has not hitherto been reported. This is surprising given many reports of increased ERK activity by growth and survival factors and moreover, preferential activation of JNK/SAPK by several stimuli and cell stresses known to lead to PCD. In both Jurkat T cells and B104 lymphoma cells, for instance, sustained JNK/SAPK activation by some pro-apoptotic stimuli (γ radiation, UV-C, and anti-IgM) correlates with onset of PCD (21Chen Y.-R. Wang X. Templeton D. Davis R.J. Tan T.-H. J. Biol. Chem. 1996; 271: 31929-31936Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar,22Graves J.D. Draves K.E. Craxton A. Saklatvala J. Krebs E.G. Clark E.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13814-13818Crossref PubMed Scopus (158) Google Scholar). Consistent with this, overexpression of the kinase ASK-1 or the Fas-binding protein Daax leads to activation of JNK/SAPK as well as enhanced apoptosis in several cell lines (23Science 275, 90–94Ichijo, H., Nishida, E., Irie, K., Dijke, P. T., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K., and Gotoh, Y.Science , 275, 90–94Google Scholar, 24Yang X. Khosravi-Far R. Chang H.Y. Baltimore D. Cell. 1997; 89: 1067-1076Abstract Full Text Full Text PDF PubMed Scopus (841) Google Scholar). Moreover, in PC12 cells, use of mutant kinases indicates that activation of JNK/SAPK together with inhibition of ERK are critical for induction of apoptosis following nerve growth factor withdrawal (25Xia Z. Dickens M. Raingeaud J. Davis R.J. Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5074) Google Scholar). In addition, expression of dominant inhibitory mutant forms of the JNK/SAPK kinase SEK1 or of the Fas-interacting protein Daax blocks activation of JNK/SAPK and confers cellular resistance to the pro-apoptotic effects of Fas, cell stresses as well as the DNA-damaging drug cis-platinum (24Yang X. Khosravi-Far R. Chang H.Y. Baltimore D. Cell. 1997; 89: 1067-1076Abstract Full Text Full Text PDF PubMed Scopus (841) Google Scholar, 26Verheij M. Bose R. Lin X.H. Yao B. Jarvis W.D. Grant S. Birrer M.J. Szabo E. Zon L.I. Kyriakis J.M. Haimovitz-Friedman A. Fuks Z. Kolesnick R.N. Nature. 1996; 380: 75-79Crossref PubMed Scopus (1724) Google Scholar, 27Zanke B.W. Boudreau K. Rubie E. Winnett E. Tibbles L.A. Zon L. Kyriakis J. Liu F.-F. Woodgett J.R. Curr. Biol. 1996; 6: 606-613Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar). Somewhat surprisingly, although also consistent with a critical role for JNK/SAPK in processes controlling PCD, deletion of the SEK1 gene blocks activation of JNK/SAPK and protects thymocytes from Fas and CD3-mediated apoptosis (28Antonsson B. Conti F. Ciavatta A.-M. Montessuit S. Lewis S. Martinou I. Bernasconi L. Bernard A. Mermod J.-J. Mazzei G. Maundrell K. Gambale F. Sadoul R. Martinou J.-C. Science. 1997; 277: 370-372Crossref PubMed Scopus (937) Google Scholar). In this paper we report that JNK/SAPK, and not other classes of MAP kinase tested, is able to phosphorylate Bcl-2, suggesting a role as target substrate in pathways controlling apoptosis. Restriction and DNA modifying enzymes were purchased from New England Biolabs Inc. (Beverly, MA) or Life Technologies, Inc., and Taq DNA polymerase was from Perkin-Elmer. [γ-32P]ATP (5000 Ci/mmol), [γ-33P]ATP (1000 Ci/mmol), and [32P]orthophosphoric acid (8500 Ci/mmol) was from DuPont de Nemours International S. A. (Regensdorf, Switzerland). Dulbecco's modified Eagle's cell culture medium was purchased from Life Technologies, Inc. (Basel, Switzerland), protein A-Sepharose 4 Fast Flow from Pharmacia Biotech Inc. (Uppsala, Sweden), and murine EGF was from Promega (Madison, WI). Anti-Bcl-2 antibodies SC 509 and SC 492 were from Dr. Glaser AG (Basel, Switzerland), anti-Bcl-2 antibody OM-11–925 from AMS Biotechnology (Lugano, Switzerland), anti-HA.11 was from Rowag Diagnostics (Zurich, Switzerland), and horseradish peroxidase conjugates of goat anti-mouse IgG and goat anti-rabbit IgG were from Bio-Rad Laboratories (Glattbrugg, Switzerland). All other chemicals were obtained from Sigma (Buchs, Switzerland). The following plasmids were generous gifts obtained as follows: pcDNA1-HA-p44 ERK1 from J. Pouyssegur (CNRS, Nice, France), pMT2T-HA-p54-SAPKβ and pGEX-c-Jun-(5–89) from J. R. Woodgett (Ontario Cancer Institute, Toronto, Canada), pcDNA3-HA-p38 and pGEX-ATF-2-(1–96) from J. S. Gutkind (NIDR, National Institutes of Health, Bethesda, MD), pGEX-c-Jun-(1–79) from E. Bettini (Glaxo Wellcome, Verona, Italy), pGEX-ATF-2-(19–96) from N. Jones (ICRF, London, UK), pGEX-MAPKAP kinase 2 Δ3B from M. Gaestel (MDC, Berlin, Germany), pEBG-SEK1 from L. I. Zon (Howard Hughes Medical Institute Children's Hospital, Boston, MA), pEXV3-Myc-Ras (G12V) and pEXV3-Myc-Ras (T17N) from C. J. Marshall (Chester Beatty Labs, ICR, London, UK), and HA-tagged Rac1 (G12V) and Rac1 (T17N) cloned into pXJ40 from E. Manser (Glaxo-IMCB, Singapore, Singapore). Bcl-2 was cloned into theEcoRI site of pUC19 and PCR mutagenesis was used to delete nucleotides 118–273 corresponding to amino acids 39–90 of the Bcl-2 coding sequence. In addition, a single base pair change of C to G at position 113 created a unique ApaI restriction site at this position. PCR mutagenesis was performed in a two-step reaction using two oligonucleotide pairs, CGCGGGCCCGGGGGCGCGGCGCCACATC in combination with the −21M13 forward primer and CGCGGGCCCGTGGTCCACCTGGCCCTCCGC in combination with M13 reverse primer. The resulting products of 0.2 and 0.6 kilobases, respectively, were purified, cleaved with ApaI, ligated, and reamplified using original terminal primers −21M13 and M13 reverse. The predicted 0.8-kilobase PCR product was digested with EcoRI restriction endonuclease and cloned into the EcoRI site of pUC19. Sequence analysis revealed the expected deletion and creation of the unique ApaI site. Reconstitution of the deleted sequence in which codons for Thr56, Ser70, Thr74, and Ser87 were mutated to encode Ala residues was performed using four overlapping pairs of complementary oligonucleotides (CCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAG and GAGGAGAAGATGCCCGGTGCGGGGGCGGCCCCCGGGGGCC; CCCGGGCACGCGCCCCATCCAGCCGCATC and CGGCTGGATGGGGCGCGTGCCCGGGCTGG; CCGCGACCCGGTCGCCAGGACCGCGCCGCTGCAGGCCCCGGCTGC and CCGGGGCCTGCAGCGGCGCGGTCCTGGCGACCGGGTCGCGGGATG; and CCCCGGCGCCGACGCGGGGCCTGCGCTCGCCCCGGTGGGGCC and CCACCGGGGCGAGCGCAGGCCCCGCGTCGGCGCCGGGGGCAG) designed to leaveApaI compatible sequences at each end when ligated together. The eight oligonucleotides were annealed and ligated, and the resulting 156-base pair fragment was isolated and cloned in the correct orientation into the ApaI site of the Bcl-2 deletion mutant described above. The resulting quadruple point mutant was verifed by sequence analysis and subcloned into the mammalian expression vector pEE12. Human Bcl-2 lacking 34 amino acids at the C terminus was expressed in Escherichia coli and purified from the soluble cell fraction by sequential chromatography on Q-Sepharose, phenyl-Sepharose, heparin-Sepharose, and fast protein liquid chromatography Mono Q. Human Bax-α lacking 20 amino acids at its C terminus was expressed as a His-tagged protein inE. coli. Soluble His-tagged Bcl-2 was purified on Ni-NTA-agarose columns followed by fast protein liquid chromatography Mono Q. For both Bcl-2 and Bax the C-terminal truncations were necessary because solubility and yields of full-length recombinant proteins were unacceptably low. Mouse p54-SAPKβ subcloned into pGEX4T3 was expressed in E. coli, purified with glutathione-Sepharose beads (Pharmacia), and eluted using standard procedures. Mouse SEK1 expressed as a GST fusion protein in Chinese hamster ovary cells (pEBG-SEK1) was purified using glutathione-Sepharose beads following stimulation with tumor necrosis factor-α (50 ng/ml for 15 min) (29Sanchez I. Hughes R.T. Mayer B.J. Yee K. Woodgett J.R. Avruch J. Kyriakis J.M. Zon L.I. Nature. 1994; 372: 794-798Crossref PubMed Scopus (930) Google Scholar). COS-7 cells were grown under 7.5% CO2 in Dulbecco's modified Eagles's medium containing 10% (v/v) fetal calf serum and 2 mm glutamine. Cells were grown in 6-well plates (35 mm diameter) to 80% confluence and transfected using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's instructions. Transfections were performed using the following plasmid concentrations: 0.1 μg of pEE Bcl-2 or pEE Bcl-2 (T56A,S70A,T74A,S87A); 1.0 μg of pcDNA1-HA-p44 ERK1, pMT2T-HA-p54-SAPKβ, or pcDNA3-HA-p38; 1.0 μg of pXJ40-HA-Rac1 (G12V), pXJ40-HA-Rac1 (T17N), pEXV3-Myc-Ras (G12V), or pEXV3-Myc-Ras (T17N); and 0.05, 0.1, 0.25, or 1.0 μg of pMT-SM-Myc-MKP3, pMT-SM-Myc-MKP3 (C293S), or pMT-SM-Myc-MKP4 in the combinations indicated in the text. Total plasmid concentrations were maintained constant by supplementing with appropriate empty vectors. Following 6 h of incubation with LipofectAMINE and plasmid DNA, cells were washed and grown for 40 h before lysis and extraction. For acute stimulation of MAP kinase activation, cells were starved by incubation in serum-free medium for 2 h followed by exposure to EGF (10 nm), anisomycin (10 μg/ml), or H2O2 (0.5 mm) at 37 °C for 10–30 min as indicated. Cells were washed twice in 2 ml of ice-cold phosphate-buffered saline and scraped into Eppendorf tubes with 300 μl of buffer TPP (50 mm Tris-HCl, pH 7.5, containing 150 mm NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) SDS, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm benzamidine, 1 mmphenylmethylsulfonyl fluoride, 10 mm NaF, 1 mmsodium pyrophosphate, 1 mm sodium vanadate, 1 mm EDTA, 10 nm calyculin, and 25 mmβ-glycerophosphate). Cells were then homogenized using a sonicator probe at full power for 2 s on ice. For immunodetection of Bcl-2, aliquots of cell lysates (20 μg of protein) were diluted in 10 × Laemmli sample buffer (30Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215638) Google Scholar), heated at 95 °C for 3 min, and separated by SDS-polyacrylamide gel electrophoresis followed by electrotransfer to nitrocellulose membranes as described (31Muda M. Boschert U. Dickinson R. Martinou J.-C. Martinou I. Camps M. Schlegel W. Arkinstall S. J. Biol. Chem. 1996; 271: 4319-4326Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Bcl-2 was detected using anti-Bcl-2 antibodies SC 509 or SC 492 and goat anti-mouse or goat anti-rabbit IgG horseradish peroxidase conjugate with chemiluminescence. Levels of epitope-tagged MAP kinases and Ras family small GTPases were also monitored by Western analysis using monoclonal antibodies HA.11 (HA) and 9E10 (Myc) as described (31Muda M. Boschert U. Dickinson R. Martinou J.-C. Martinou I. Camps M. Schlegel W. Arkinstall S. J. Biol. Chem. 1996; 271: 4319-4326Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar,32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). For immunoprecipitation, aliquots (200 μl) of the COS-7 cell lysates were mixed with 800 μl of buffer TPP and rotary mixed for 1 h at 4 °C, after which time they were centrifuged at 100,000 ×g for 20 min at 4 °C. For Bcl-2 immunoprecipitation, supernatant was then mixed by rotary mixing for 2 h at 4 °C with 50 μl of a preformed Bcl-2 immunoprecipitating complex (50 μl of Bcl-2 monclonal antibody OM-11–925 preincubated with 300 μl of 50% (v/v) protein A-Sepharose and 300 μl of 50% (v/v) protein G-Sepharose beads in 10 mm Tris-HCl, pH 7.5, for 2 h at 4 °C). Beads were then sedimented by centrifugation at 10,000 × g for 3 min and washed four times in 1.0 ml of ice-cold buffer TPP followed by final resuspension in 25 μl of Laemmli sample buffer (30Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215638) Google Scholar). Immunoprecipitation of HA-tagged MAP kinases was performed with buffer TPP without deoxycholate or SDS using HA-epitope specific monoclonal HA.11 exactly as described (31Muda M. Boschert U. Dickinson R. Martinou J.-C. Martinou I. Camps M. Schlegel W. Arkinstall S. J. Biol. Chem. 1996; 271: 4319-4326Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). For MAP kinase phosphorylation assays, final resuspension was in 50 μl of buffer K (50 mm HEPES, pH 7.4, containing 20 mmMgCl2, 200 μm sodium vanadate, 2 mm dithiothreitol, and 10 mmβ-glycerophosphate). Immune complex assays were performed by mixing 10 μl of bead suspension with 10 μl of 6 μm[γ-32P]ATP (∼300,000 dpm/pmol), 10 μl of substrate protein (10 μg of Bax, 10 μg of Bcl-2, 15 μg of MBP, 10 μg of GST-ATF-2, or 10 μg of GST-MAPKAP kinase 2 Δ3) and 30 μl of buffer K followed by incubation for 30 min at 30 °C. Reactions were terminated by adding 15 μl of 10 × Laemmli sample buffer (30Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (215638) Google Scholar) and heating for 5 min at 95 °C. Following centrifugation at 10,000 × g for 5 min, supernatants were analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography as described previously (31Muda M. Boschert U. Dickinson R. Martinou J.-C. Martinou I. Camps M. Schlegel W. Arkinstall S. J. Biol. Chem. 1996; 271: 4319-4326Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Bcl-2 phosphorylation was performed using purified free GST-p54-SAPKβ pre-activated by incubation with GST-SEK1 bound to glutathione-Sepharose beads as described (29Sanchez I. Hughes R.T. Mayer B.J. Yee K. Woodgett J.R. Avruch J. Kyriakis J.M. Zon L.I. Nature. 1994; 372: 794-798Crossref PubMed Scopus (930) Google Scholar). Immobilized SEK1 was subsequently removed by centrifugation at 10,000 × gfor 5 min. Purified Bcl-2 (100 μg) was phosphorylated by incubation with GST-p54-SAPKβ (10 μg) in a total volume of 240 μl of buffer K containing 100 μm [γ-33P]ATP (3000 dpm/pmol). Phosphorylated Bcl-2 was purified by HPLC, lyophilized, and digested by overnight incubation at 37 °C in 90 μl of 100 mm Tris-HCl pH 8.5 containing 1 m urea, 20 mm methylamine, 1 mm dithiothreitol, and 5 μg of trypsin (Boehringer Mannheim, sequencing grade). Peptides were separated by reverse-phase HPLC (Hewlett Packard HP1090) with a Brownlee C18 column (220 × 2.1 mm). Peptides were eluted with an acetonitrile gradient (in 0.1% trifluroacetic acid) from 0 to 55% over 60 min, followed by 55–70% over 5 min. Elution fractions were collected, and radioactive 33P-labeled phosphopeptides identified by scintillation spectrometry were sequenced by Edman degradation using an Applied Biosystems model 494 pulsed liquid phase protein sequencer with a model 148C on-line phenylthiohydantoin amino acid analyzer. To test for in vitro phosphorylation by different MAP kinases we first employed Bcl-2 and Bax proteins purified following expression in E. coli. HA-tagged ERK1, p54-SAPKβ, and p38 were expressed in COS-7 cells and activated by exposure to EGF (10 nm, 10 min), anisomycin (10 μg/ml, 30 min) and hydrogen peroxide (500 μm, 30 min), respectively, as described previously (33Muda M. Theodosiou A. Rodrigues N. Boschert U. Camps M. Gillieron C. Davies K. Ashworth A. Arkinstall S.J. J. Biol. Chem. 1996; 271: 27205-27208Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar). Following immunoprecipitation and incubation with their known substrates MBP, ATF-2, and MAP kinase-activated protein kinase-2 (MK2), all three MAP kinases were confirmed to be enzymatically activated by these stimuli (Fig.1 A). Despite this, no phosphorylation of Bax was detectable using any MAP kinase (not shown). In contrast, Bcl-2 phosphorylation was increased by up to 6-fold by incubation with activated p54-SAPKβ (Fig. 1 B). Bcl-2 phosphorylation by either ERK1 or p38 MAP kinases was limited to approximately 2-fold under identical conditions (Fig. 1 B). Bcl-2 was also phosphorylated 4-fold by immunoprecipitates of activated p46 JNK1 (SAPKγ) (not shown), suggesting selective phosphorylation by the JNK/SAPK class of MAP kinases. We next tested whether Bcl-2 could be phosphorylated by p54-SAPKβ within the environment of an intact mammalian cell. Human Bcl-2 was expressed in COS-7 cells and found to be immunodetectable as a 26-kDa protein (Fig. 2 A). To test for phosphorylation, Bcl-2 was co-expressed with both p54-SAPKβ and the constitutive Rho family G-protein Rac1 (G12V). This GTPase defective mutant has been shown previously to result in moderate activation of JNK/SAPK family members (34Coso O.A. Chiariello M. Yu J.-C. Teramoto H. Crespo P. Xu N. Miki T. Gutkind J.S. Cell. 1995; 81: 1137-1146Abstract Full Text PDF PubMed Scopus (1576) Google Scholar, 35Minden A. Lin A. Claret F.-X. Abo A. Karin M. Cell. 1995; 81: 1147-1157Abstract Full Text PDF PubMed Scopus (1451) Google Scholar), and this is confirmed here with p54-SAPKβ (Fig. 2 B). Consistent with in vitroobservations using purified protein, Bcl-2 becomes highly phosphorylated under these conditions. This can be readily detected using Western blot analysis as a band shift of immunodetectable Bcl-2 protein (Fig. 2 A). Decreased gel mobility of phosphorylated Bcl-2 is consistent with previous reports of a Bcl-2 band shift upon phosphorylation by an unidentified kinase (11Haldar S. Jena N. Croce C.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (752) Google Scholar, 12Haldar S. Chintapalli J. Croce C.M. Cancer Res. 1996; 56: 1253-1255PubMed Google Scholar). Up to five distinct bands are clearly visible using this technique. The same bands can also be seen, although with poorer resolution, upon autoradiographic analysis of Bcl-2 immunoprecipitated from COS-7 cells prelabeled with [32P]H3PO4 (not shown). This phosphorylation appears dependent on enzymatic activation of p54-SAPKβ because no band shifts are visible when Bcl-2 is expressed either alone with p54-SAPKβ or with p54-SAPKβ together with the dominant inhibitory mutant Rac1 (T17N) (Fig. 2, A andB). Limited Bcl-2 phosphorylation observed upon co-expression with Rac G12V alone probably reflects activation of endogenous JNK/SAPK. Because purified Bcl-2 is phosphorylated most effectively in vitro by JNK/SAPK family members (see above), we set out to test whether similar MAP kinase specificity can be demonstrated within cells. Bcl-2 was coexpressed with combinations of HA-tagged ERK1 as well as constitutively activated Ras (G12V) or dominant inhibitory Ras (T17N) (Fig. 2 C). Under conditions leading to ERK1 activation by Ras (G12V) (Fig. 2 D), Bcl-2 phosphorylation was barely detectable as indicated by the appearance of only two weak immunodetectable Bcl-2 bands displaying slowed gel mobility (Fig.2 C). This effect was not seen when Bcl-2 was expressed alone with either Ras (G12V) or ERK1, or in combination with ERK1 and inactive Ras (T17N) (Fig. 2 C). We have also performed similar experiments where Bcl-2 is coexpressed with p38 MAP kinase alone or together with Rac1 (G12V) or Rac1 (T17N). In these experiments (not shown), despite p38 MAP kinase activation, no phosphorylation was seen over and above that noted when Bcl-2 was expressed alone with Rac1 (G12V) (not shown). To confirm that Bcl-2 phosphorylation in the presence of p54-SAPKβ and Rac1 (G12V) is a reflection of intracellular MAP kinase activation, we assessed Bcl-2 phosphorylation in COS-7 cells coexpressing the MAP kinase phosphatases MKP3/PYST1 and MKP4 (31Muda M. Boschert U. Dickinson R. Martinou J.-C. Martinou I. Camps M. Schlegel W. Arkinstall S. J. Biol. Chem. 1996; 271: 4319-4326Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 36Groom L.A. Sneddon A.A. Alessi D.R. Dowd S. Keyse S.M. EMBO J. 1996; 15: 3621-3632Crossref PubMed Scopus (373) Google Scholar). In addition to Bcl-2, p54-SAPKβ, and Rac1 (G12V), cells were also transfected with increasing quantities of plasmid encoding MKP3/PYST1 or MKP4 (0.05–1.0 μg of plasmid/well). This resulted in a dose-dependent increase in levels of immunodetectable MKP3/PYST and MKP4 protein (see Ref. 32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar), and this was accompanied by both a graded inhibition of p54-SAPKβ enzymatic activity and a complete disappearance of four of the five additional Bcl-2 bands detected by Western analysis (not shown). The fifth Bcl-2 band showing reduced gel mobility was also weakened considerably by the highest level of MKP3 (not shown). The three-dimensional structure of the Bcl-2 homologue Bcl-XL reveals an unstructured 60-residue flexible loop connecting two α-helices localized immediately N-terminal of the conserved BH3 homology domain (37Muchmore S.W. Sattler M. Liang H. Meadows R.P. Harlan J.E. Yoon H.S. Nettesheim D. Chang B.S. Thompson C.B. Wong S.-L. Ng S.-C. Fesik S.W. Nature. 1996; 381: 335-341Crossref PubMed Scopus (1298) Google Scholar). Structural modeling of Bcl-2 predicts a similar unstructured loop, and within this region we identified two serines (residues 70 and 87) and two threonines (residues 56 and 74), each preceding prolines that we reasoned represent potential sites for phosphorylation by p54-SAPKβ. In support of this, expression of the Bcl-2 mutant T56A,S70A,T74A,S87A in COS-7 cells abolished four of the five additional Bcl-2 bands normally observed upon coexpression with p54-SAPKβ and Rac1 (G12V) (Fig.3). This experiment indicates that one or more of these residues represent essential target sites for phosphorylation following activation of p54-SAPKβ within COS-7 cells. The site of the modification underlying the single remaining low mobility band is unknown. To test whether p54-SAPKβ is able to modify these sites directly, we next phosphorylated Bcl-2 in vitroin the presence of [33P]ATP using purified active GST-p54-SAPKβ. Following trypsin digestion of phosphorylated Bcl-2, HPLC separation resolved 13 peptides (Fig.4 A), although only two peaks of 33P-radioactivity were detected in the entire elution profile (Fig. 4 B). These peaks correspond to peptides 6 and 10, which were sequenced by Edman degradation and found to be amino acids 27–68 and 69–98 of Bcl-2, respectively (Fig. 4 C). Together, these two peptides include all four residues undergoing phosphorylation following p54-SAPKβ activation in intact cells.Figure 4Bcl-2 phosphopeptide analysis. Bcl-2 was phosphorylated in vitro by purified preactivated GST-p54-SAPKβ in the presence of [γ-33P]ATP. Phosphorylated Bcl-2 was then purified and subjected to trypsin digestion. A, reverse-phase HPLC separation of peptides derived from Bcl-2 tryptic digest. Peaks were detected by absorption at 214 nm. Duration of chromatogram shown represents 60 min. B,33P radioactivity (cpm) detected in column fractions collected every minute throughout the separation shown in A. Radioactive peaks correspond to peptides 6 and 10 in chromatogramA. C, peptides 6 and 10 were sequenced by Edman degradation and correspond to amino acids 27–68 and 69–98 of Bcl-2, respectively. Threonine 56 (peptide 6) as well as serine 70, threonine 74, and serine 87 (peptide 10) identified as sites of phosphorylation in intact cells are underlined.View Large Image Figure ViewerDownload Hi-res image Download (PPT) While these studies were in progress a report appeared describing Bcl-2 expression in the immature B cell line WEHI-231 exposed to anti-IgM (38Chang B.S. Minn A.J. Muchmore S.W. Fesik S.W. Thompson C.B. EMBO J. 1997; 16: 968-977Crossref PubMed Scopus (264) Google Scholar). In these cells full-length Bcl-2 was ineffective at suppressing cell death and strikingly also undergoes extensive phosphorylation visible as multiple bands with retarded gel mobility. A Bcl-2 deletion mutant lacking the predicted flexible loop region was not phosphorylated and remarkably was able to block apoptosis in these cells. Although the kinase responsible for phosphorylating Bcl-2 was not identified in this report (46), our results suggest that JNK/SAPK family members may be responsible. Indeed, in another B cell line (B104) cross-linking mIgM triggers sustained activation of JNK/SAPK, and this is accompanied by cellular apoptosis (32Muda M. Boschert U. Smith A. Antonsson B. Gillieron C. Chabert C. Camps M. Martinou I. Ashworth A. Arkinstall S. J. Biol. Chem. 1997; 272: 5141-5151Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Together with our data, these observations are consistent with a model whereby pro-apoptotic signals such as mIgM cross-linking activate members of the JNK/SAPK MAP kinase family, which then disable Bcl-2 through phosphorylation within its flexible loop region. Such Bcl-2 inactivation would be expected to reinforce pro-apoptotic processes such as mitochondrial membrane depolarization, generation of reactive oxygen intermediates, and activation of cysteine proteases of the caspase family. We thank Dr. B. Allet for the expression vector pEE12 and Chris Herbert for photographic work. We are also grateful to Dr. J. DeLamarter for continued support and encouragement.
Referência(s)