Portal de Periódicos da CAPES

An Essential Role in Molting and Morphogenesis of Caenorhabditis elegans for ACN-1, a Novel Member of the Angiotensin-converting Enzyme Family That Lacks a Metallopeptidase Active Site

2003; Elsevier BV; Volume: 278; Issue: 52 Linguagem: Inglês

10.1074/jbc.m308858200

1083-351X

Darren R. Brooks, Peter J. Appleford, Lindsay Murray, R. Elwyn Isaac,

Insect Utilization and Effects

Genome sequence analyses predict many proteins that are structurally related to proteases but lack catalytic residues, thus making functional assignment difficult. We show that one of these proteins (ACN-1), a unique multi-domain angiotensin-converting enzyme (ACE)-like protein from Caenorhabditis elegans, is essential for larval development and adult morphogenesis. Green fluorescent protein-tagged ACN-1 is expressed in hypodermal cells, the developing vulva, and the ray papillae of the male tail. The hypodermal expression of acn-1 appears to be controlled by nhr-23 and nhr-25, two nuclear hormone receptors known to regulate molting in C. elegans. acn-1(RNAi) causes arrest of larval development because of a molting defect, a protruding vulva in adult hermaphrodites, severely disrupted alae, and an incomplete seam syncytium. Adult males also have multiple tail defects. The failure of the larval seam cells to undergo normal cell fusion is the likely reason for the severe disruption of the adult alae. We propose that alteration of the ancestral ACE during evolution, by loss of the metallopeptidase active site and the addition of new protein modules, has provided opportunities for novel molecular interactions important for post-embryonic development in nematodes. Genome sequence analyses predict many proteins that are structurally related to proteases but lack catalytic residues, thus making functional assignment difficult. We show that one of these proteins (ACN-1), a unique multi-domain angiotensin-converting enzyme (ACE)-like protein from Caenorhabditis elegans, is essential for larval development and adult morphogenesis. Green fluorescent protein-tagged ACN-1 is expressed in hypodermal cells, the developing vulva, and the ray papillae of the male tail. The hypodermal expression of acn-1 appears to be controlled by nhr-23 and nhr-25, two nuclear hormone receptors known to regulate molting in C. elegans. acn-1(RNAi) causes arrest of larval development because of a molting defect, a protruding vulva in adult hermaphrodites, severely disrupted alae, and an incomplete seam syncytium. Adult males also have multiple tail defects. The failure of the larval seam cells to undergo normal cell fusion is the likely reason for the severe disruption of the adult alae. We propose that alteration of the ancestral ACE during evolution, by loss of the metallopeptidase active site and the addition of new protein modules, has provided opportunities for novel molecular interactions important for post-embryonic development in nematodes. The large number of protease genes in animal genomes reflects the widespread importance of proteolysis to animal physiology and development. The rich functional diversity of proteases can be attributed to the variety of catalytic mechanisms and protein structures, some of which are of a modular design, offering different levels of structural and functional complexity (1Puente X.S. Sanchez L.M. Overall C.M. Lopez-Otin C. Nat. Rev. Genet. 2003; 4: 544-558Crossref PubMed Scopus (725) Google Scholar). The MEROPS data base (merops.sanger.ac.uk; release 6.3) (2Rawlings N.D. O'Brien E. Barrett A.J. Nucleic Acids Res. 2002; 30: 343-346Crossref PubMed Scopus (174) Google Scholar) catalogs 551, 553, 563, 366, and 367 proteases for human, mouse, Drosophila melanogaster, Anopheles gambiae, and Caenorhabditis elegans, respectively. The majority of these enzymes have not been studied at the physiological and biochemical level, but it has been possible to classify most of them into families based on statistically significant similarities in primary protein structure (2Rawlings N.D. O'Brien E. Barrett A.J. Nucleic Acids Res. 2002; 30: 343-346Crossref PubMed Scopus (174) Google Scholar). Surprisingly, a significant proportion (12-25%) of the total number of the predicted protease-like genes in the human, mouse, D. melanogaster, A. gambiae, and C. elegans genomes code for proteins that lack one or more catalytic residues and are therefore classified as "non-peptidase" family members. Some of these genes may be nonfunctional pseudogenes, but many have probably lost the catalytic activity of an ancestral protein while acquiring new functions. These non-peptidase proteins are structurally related to proteases distributed across all classes, but homologues of metallopeptidases are particularly well represented. One such protein is UNC-71, a C. elegans member of the ADAMs family, which lacks a zinc binding site and yet has acquired important roles in development (3Huang X. Huang P. Robinson M.K. Stern M.J. Jin Y. Development. 2003; 130: 3147-3161Crossref PubMed Scopus (58) Google Scholar). Our attention has recently been drawn to the fact that several invertebrate members of the angiotensin-converting enzyme (ACE) 1The abbreviations used are: ACEangiotensin-converting enzymeGPIglycosylphosphatidylinositoldsRNAdouble-stranded RNARNAiRNA interferenceESTexpressed sequence tagGFPgreen fluorescent protein.1The abbreviations used are: ACEangiotensin-converting enzymeGPIglycosylphosphatidylinositoldsRNAdouble-stranded RNARNAiRNA interferenceESTexpressed sequence tagGFPgreen fluorescent protein. (EC 3.4.15.1, peptidyl dipeptidase A) family from D. melanogaster and C. elegans lack crucial active site residues and are, therefore, predicted not to function as peptidases (4Isaac R.E. Siviter R.J. Stancombe P. Coates D. Shirras A.D. Biochem. Soc. Trans. 2000; 28: 460-464Crossref PubMed Google Scholar). Mammalian ACE is a cell surface zinc metallopeptidase that cleaves a C-terminal dipeptide from angiotensin I to generate the vasoconstrictor, angiotensin II (for reviews see Refs. 5Corvol P. Williams T.A. Soubrier F. Barrett, A.J. Methods in Enzymology. Peptidyl dipeptidase A: Angiotensin I-converting Enzyme. Vol. 248. Academic Press, London1995: 283-305Google Scholar and 6Turner A.J. Hooper N.M. Trends Pharmacol. Sci. 2002; 23: 177-183Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). Bradykinin, a vasodilator, and the hemoregulatory peptide N-acetyl-SDKP are also substrates for mammalian ACE. Somatic ACE comprises two catalytic units in tandem, which are anchored to the cell surface by a transmembrane region and a short C-terminal cytoplasmic domain. ACE knockout mice have, as expected, lower blood pressure but also have severe renal abnormalities and suffer from anemia (7Krege J.H. John S.W.M. Langenbach L.L. Hodgin J.B. Hagaman J.R. Bachman E.S. Jennette J.C. Obrien D.A. Smithies O. Nature. 1995; 375: 146-148Crossref PubMed Scopus (602) Google Scholar, 8Esther C.R. Howard T.E. Marino E.M. Goddard J.M. Capecchi M.R. Bernstein K.E. Lab. Investig. 1996; 74: 953-965PubMed Google Scholar). In mammalian testes, a single-domain ACE (germinal ACE, 100 kDa) is expressed in developing spermatids, and the lack of this isoform results in male infertility (7Krege J.H. John S.W.M. Langenbach L.L. Hodgin J.B. Hagaman J.R. Bachman E.S. Jennette J.C. Obrien D.A. Smithies O. Nature. 1995; 375: 146-148Crossref PubMed Scopus (602) Google Scholar). Sperm from ACE (-/-) mice appear normal but fail to migrate beyond the extramural uterotubal junction of the oviduct of mated wild-type females, and in vitro experiments demonstrate that they have reduced binding to zonae pellucidae. The peptide substrate for the germinal enzyme has not been identified, and it has been suggested that the role of the gACE in reproduction might depend on direct molecular interactions at the cell surface rather than the hydrolysis of a peptide (7Krege J.H. John S.W.M. Langenbach L.L. Hodgin J.B. Hagaman J.R. Bachman E.S. Jennette J.C. Obrien D.A. Smithies O. Nature. 1995; 375: 146-148Crossref PubMed Scopus (602) Google Scholar). A new member of the ACE family, ACE2, has recently been characterized (9Tipnis S.R. Hooper N.M. Hyde R. Karran E. Christie G. Turner A.J. J. Biol. Chem. 2000; 275: 33238-33243Abstract Full Text Full Text PDF PubMed Scopus (1572) Google Scholar, 10Donoghue M. Hsieh F. Baronas E. Godbout K. Gosselin M. Stagliano N. Donovan M. Woolf B. Robison K. Jeyaseelan R. Breitbart R.E. Acton S. Circ. Res. 2000; 87: E1-E9Crossref PubMed Google Scholar). Although structurally similar to ACE, it is not a dipeptidyl carboxypeptidase, but a carboxypeptidase; it is expressed in cardiac cells, kidney, and the testes (6Turner A.J. Hooper N.M. Trends Pharmacol. Sci. 2002; 23: 177-183Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). Mice lacking ACE2 activity have defects in both the speed and overall percentage of heart contraction on aging (11Crackower M.A. Sarao R. Oudit G.Y. Yagil C. Kozieradzki I. Scanga S.E. Oliveira-dos-Santos A.J. da Costa J. Zhang L. Pei Y. Scholey J. Ferrario C.M. Manoukian A.S. Chappell M.C. Backx P.H. Yagil Y. Penninger J.M. Nature. 2002; 417: 822-828Crossref PubMed Scopus (1338) Google Scholar). angiotensin-converting enzyme glycosylphosphatidylinositol double-stranded RNA RNA interference expressed sequence tag green fluorescent protein. angiotensin-converting enzyme glycosylphosphatidylinositol double-stranded RNA RNA interference expressed sequence tag green fluorescent protein. A D. melanogaster ACE homologue, known as Ance, has very similar enzymatic properties to those of mammalian ACE and is required for completion of embryogenesis and for spermatogenesis in adult flies (12Williams T.A. Michaud A. Houard X. Chauvet M.T. Soubrier F. Corvol P. Biochem. J. 1996; 318: 125-131Crossref PubMed Scopus (61) Google Scholar, 13Hurst D. Rylett C.M. Isaac R.E. Shirras A.D. Dev. Biol. 2003; 254: 238-247Crossref PubMed Scopus (54) Google Scholar). Acer, a second D. melanogaster ACE homologue, is also catalytically active toward peptides but does not convert angiotensin I to angiotensin II (14Houard X. Williams T.A. Michaud A. Dani P. Isaac R.E. Shirras A.D. Coates D. Corvol P. Eur. J. Biochem. 1998; 257: 599-606Crossref PubMed Scopus (76) Google Scholar, 15Siviter R.J. Nachman R.J. Dani M.P. Keen J.N. Shirras A.D. Isaac R.E. Peptides. 2002; 23: 2025-2034Crossref PubMed Scopus (32) Google Scholar). Four other ACE-like genes (Ance-2, -3, -4, -5) are present in the D. melanogaster genome, but all four conceptual proteins are missing one or more of the active site residues required for catalysis by human ACE (16Coates D. Isaac R.E. Cotton J. Siviter R. Williams T.A. Shirras A. Corvol P. Dive V. Biochemistry. 2000; 39: 8963-8969Crossref PubMed Scopus (62) Google Scholar). In contrast to flies and mammals, the nematode, C. elegans, has only one ACE-like gene (C42D8.5), which codes for an ACE-like protein lacking not only the HEXXH consensus metallopeptidase motif but also other active site residues found in the sequence HEA(I/V)XD of mammalian and insect ACEs (4Isaac R.E. Siviter R.J. Stancombe P. Coates D. Shirras A.D. Biochem. Soc. Trans. 2000; 28: 460-464Crossref PubMed Google Scholar). We now show that the C. elegans ACE-like protein, termed ACN-1 (for ACE-like non-metallopeptidase), plays an essential role in larval molting and adult morphogenesis, probably through novel molecular interactions. ACN-1 is the first member of the ACE family of proteins to be assigned an essential role that is independent of a functional metallopeptidase active site. Nematode Culture and Transformation—The C. elegans Bristol strain (N2) was grown at 20 °C on NGM agar (1.7% (w/v) agar, 25 mm potassium phosphate, pH 6.0, 50 mm NaCl, 2.5 μg ml-1 peptone, 5 μg ml-1 cholesterol, 1 mm MgCl2, 1 mm CaCl2) supplemented with Escherichia coli OP50. cDNA Cloning and Sequence Analysis—cDNA clones yk115b3 and yk63f5, derived from a C. elegans embryonic library, and yk759d02, from an L2 stage hermaphrodite larval library, were obtained from the laboratory of Professor Y. Kohara, National Institute of Genetics, Japan. The clones were sequenced by primer walking using Taq DyeDeoxy terminator cycle sequencing and the data analyzed with respect to DNA sequence present in the C. elegans data base. BLAST® similarity searching was performed from the NCBI suite of programs (www.ncbi.nlm.nih.gov/). The prediction of the signal peptide sequence and its cleavage site was performed using the SignalP V1.1 World Wide Web Prediction Server (www.cbs.dtu.dk/services/SignalP/ (17Nielsen H. Engelbrecht J. Brunak S. von Heijne G. Protein Eng. 1997; 10: 1-6Crossref PubMed Scopus (4911) Google Scholar)). The GPI Prediction Server (mendel.imp.univie.ac.at/sat/gpi/gpi_server.html) was used to predict a potential GPI modification to the protein (18Eisenhaber B. Bork P. Eisenhaber F. J. Mol. Biol. 1999; 292: 741-758Crossref PubMed Scopus (358) Google Scholar). Glycosylation sites were predicted using NetOGlyc 2.0 (www.cbs.dtu.dk/services/NetOGlyc) and NetNGlyc 1.0 (www.cbs.dtu.dk/services/NetNGlyc) prediction servers (19Hansen J.E. Lund O. Tolstrup N. Gooley A.A. Williams K.L. Brunak S. Glycoconj. J. 1998; 15: 115-130Crossref PubMed Scopus (447) Google Scholar). Construction and Expression of the acn-1::gfp Transgene—Green fluorescent protein (GFP) reporter gene fusions were generated for ACN-1 using a polymerase chain reaction (PCR)-based technique (20Hobert O. BioTechniques. 2002; 32: 728-730Crossref PubMed Scopus (500) Google Scholar). The entire acn-1 gene and 4.9 kb of sequence immediately upstream was PCR-amplified using Expand High Fidelity Taq (Roche Diagnostics GmbH) from the cosmid C42D8 (obtained from the Sanger Centre, Hinxton, Cambridgeshire, UK) using oligonucleotides (5′ to 3′) GATCAAGTGCATCTTCTTGTCG (C42D8, 23153-23132) and cgacctgcaggcatgcaagctCAAAGCAAAATAGATAATTAAC (C42D8, 13896-13917; the lowercase sequence is the reverse complement of GFP-5′). Following an initial denaturation at 94 °C for 5 min, the PCR comprised 25 cycles of 94 °C for 30 s, 50 °C for 30 s, and 68 °C for 9 min. The resultant 9.1-kb PCR product was mixed with a 1.8-kb PCR product encoding GFP, amplified from plasmid pPD95.75 (A. Fire Laboratory Vector Kit 1995, Department of Embryology, Carnegie Institution of Washington, Baltimore, MD) using oligonucleotides (5′ to 3′) GCTTGCATGCCTGCAGGTCG (GFP-5′) and AAGGGCCCGTACGGCCGACTAGTAGG (GFP-3′). This mixture was used as the template for PCR amplification with Expand High Fidelity Taq to generate the desired acn-1 reporter transgene. The oligonucleotides used were (5′ to 3′): a nested acn-1 promoter primer, AACGGGAAGAGTAGATGATGC (C42D8, 23058-23038), and a nested 3′ GFP primer, GGAAACAGTTATGTTTGGTATATTGGG. The PCR cycling parameters were as above with the extension time increased to 11 min. The products of this final PCR were directly microinjected into the syncytial gonad of young C. elegans adult hermaphrodites (Bristol strain, N2) together with the plasmid pRF4 (21Mello C.C. Kramer J.M. Stinchcomb D. Ambros V. EMBO J. 1991; 10: 3959-3970Crossref PubMed Scopus (2392) Google Scholar), which contains the dominant injection marker rol-6(su1006). Transformants were scored on the basis of the roller phenotype. The male expression pattern was generated by allowing hermaphrodite rollers to mate with wild-type Bristol strain (N2) males. Lines transmitting the acn-1::gfp construct were examined on a Zeiss Axioplan microscope (Carl Zeiss, Germany) at an excitation wavelength of 475 nm. Images were captured using a CCD camera and Openlab 3.0.4 image capture software (Improvision Inc., Lexington MA). dsRNA Preparation and Delivery—Exon 5 of acn-1 was PCR-amplified (initial denaturation of 94 °C for 5 min followed by 25 cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 45 s) from cosmid C42D8 using Taq DNA polymerase (Stratagene, La Jolla, CA) and oligonucleotides (5′ to 3′) taatacgactcactataggGGATTCCATTTTCCGCAAC (lowercase represents T7 promoter sequence) and aattaaccctcactaaagGACAAACATCTTCTTGGTCGTGTAG (lowercase represents T3 promoter sequence). The resulting 524-bp PCR product was purified using QIA-quick PCR purification columns (Qiagen GmbH, Hilden, Germany) and used as the template to transcribe sense and antisense RNAs with T3 and T7 MEGAscript™ in vitro transcription kits (Ambion, Austin, TX). Double-stranded RNA (dsRNA) was assembled by mixing equal amounts (5 μl) of sense and antisense RNAs followed by incubation at 68 °C for 10 min and then at 37 °C for 30 min. Annealed acn-1 dsRNA was directly injected into the syncytial gonad of young adult hermaphrodites (Bristol strain, N2). Injected animals were allowed to recover for 16 h at 20 °C in order to lay any eggs present in utero prior to injection and were then transferred onto fresh NGM agar plates. The resultant F1 progeny were assessed visually for changes in phenotype. For feeding acn-1 dsRNA, a 387-bp HindIII fragment, encompassing exon 7 to exon 9, was excised from the EST yk63f5 and subcloned into the corresponding site of plasmid pPD129.36 to generate pLS43. This construct was transformed into E. coli HT115(DE3), and expression of dsRNA was induced by adding 0.4 mm isopropyl-1-thio-β-d-galactopyranoside to a mid-log phase culture (22Fraser A.G. Kamath R.S. Zipperlen P. Martinez-Campos M. Sohrmann M. Ahringer J. Nature. 2000; 408: 325-330Crossref PubMed Scopus (1356) Google Scholar). At 4 h post-induction a further 0.4 mm isopropyl-1-thio-β-d-galactopyranoside was added to the culture, and the bacteria were then seeded onto NGM agar plates containing 1 mm isopropyl-1-thio-β-d-galactopyranoside. The C. elegans RNAi-sensitive mutant rrf-3 (23Simmer F. Tijsterman M. Parrish S. Koushika S.P. Nonet M.L. Fire A. Ahringer J. Plasterk R.H. Curr. Biol. 2002; 12: 1317-1319Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar) was allowed to feed at 20 °C on the dsRNA-induced bacteria, and phenotypic effects were observed. Controls were carried out in parallel using HT115(DE3) lacking pLS43 as the food source. The effect of RNAi on males was assessed by allowing rrf-3 adult males and hermaphrodites to mate on NGM agar plates containing OP50 bacteria and then transferring the L1/L2 progeny to dsRNA feeding plates as described above. To assess the effect of acn-1(RNAi)on seam cell adherens junctions, the strain SU93 (24Mohler W.A. Simske J.S. Williams-Masson E.M. Hardin J.D. White J.G. Curr. Biol. 1998; 8: 1087-1090Abstract Full Text Full Text PDF PubMed Google Scholar) was fed on bacteria expressing acn-1 dsRNA as described above. Bacterial strains used to express dsRNA targeting nhr-23 and nhr-25 were obtained from Dr. J. Ahringer (University of Oxford) (22Fraser A.G. Kamath R.S. Zipperlen P. Martinez-Campos M. Sohrmann M. Ahringer J. Nature. 2000; 408: 325-330Crossref PubMed Scopus (1356) Google Scholar). Induction of dsRNA in these strains was as described above. To study the effect of silencing the nhr genes on acn-1 and ltd-1 expression in seam cells, six young adult hermaphrodites from acn-1::gfp and ltd-1::gfp transgenic lines (25Vargas J.D. Culetto E. Ponting C.P. Miguel-Aliaga I. Davies K.E. Sattelle D.B. Mech. Dev. 2002; 117: 289-292Crossref PubMed Scopus (7) Google Scholar) were transferred to individual culture plates seeded with E. coli HT115 (DE3) either expressing nhr dsRNA or carrying no plasmid. After 3 days at 20 °C, larvae were scored for the defective cuticle phenotype and seam cell fluorescence. Because of mosaicism, not all seam cells of an individual necessarily expressed the GFP reporter. Therefore, larvae were scored even if GFP-induced fluorescence was observed in only one seam cell. Scanning Electron Microscopy—Nematodes were fixed for 2 h in 2.5% (v/v) glutaraldehyde, 0.1 m phosphate buffer, pH 6.9, and then washed twice with 0.1 m phosphate buffer prior to overnight fixation in 1% (w/v) osmium tetroxide, 0.1 m phosphate buffer. Nematodes were washed with distilled water and then dehydrated for 1 h in an ascending concentration of acetone (20-100%). Samples were critical point dried with a Polaron E3000 critical point drying apparatus using CO2 as the transition fluid and then mounted on 13-mm diameter pin stubs. Nematodes were coated with gold to a thickness of 50 nm using a Polaron freeze dryer sputter-coating unit and observed and imaged with a CamScan 3-30BM scanning electron microscope. The Primary Structure of C. elegans ACN-1—The sequencing of the full-length EST clone yk759d02 encoding ACN-1 (C42D8.5) confirmed the open reading frame predicted for this gene by the C. elegans sequencing consortium (GenBank™ accession number 25151554) (Fig. 1). The translated protein (CE30627) is 906 amino acids long with an N-terminal signal peptide that is predicted to be removed by cleavage between amino acids 19 and 20 (VFT↓QE). In comparison with human germinal ACE and Drosophila ANCE, it is evident that conserved residues (25% common identity and 46% similarity) extend along a central 600-amino acid region of ACN-1 (Fig. 1). However, the overall structure of the nematode protein differs from other single domain ACEs in several important respects. All enzymatically active ACE proteins possess the HEXXH and HEA(I/V)XD motifs. However, in ACN-1 the highly conserved amino acids within these motifs have been substituted with unrelated residues, apart from Glu-559, which is replaced with an Asp. The size of the conceptual ACN-1 is larger than the single domain human ACE and Drosophila ANCE, due in part to a N-terminal extension rich in Pro and Glu (24 residues across a region of 68 amino acids). There is also a C-terminal extension that contains a cysteine-rich region juxtaposed to a sequence rich in Pro and Thr/Ser (PTS). The PTS region has potential sites for four O-linked glycans in addition to five other predicted O-glycosylation sites distributed throughout the entire ACN-1 sequence and four potential N-glycosylation sites. The GPI Modification Site Prediction Server indicates that ACN-1 is probably attached to a GPI anchor at Ala-898 (18Eisenhaber B. Bork P. Eisenhaber F. J. Mol. Biol. 1999; 292: 741-758Crossref PubMed Scopus (358) Google Scholar). acn-1 Is Expressed in Embryonic and Larval Hypodermis, in the Vulva during Organogenesis, and in the Ray Papillae of the Male Tail—The spatial and temporal expression pattern of acn-1 was studied by generating independent lines of transgenic C. elegans expressing a C-terminal reporter gene fusion (acn-1::gfp) under the control of the 4.9-kb promoter region immediately upstream of acn-1. Strong reporter gene expression was first observed in the hypodermal seam cells during embryogenesis and subsequently in the seam cells of all larval stages (Fig. 2, A-D). The main hypodermal syncytium, hyp7, of larvae and young adult nematodes also displayed reporter gene activity (Fig. 2B). The expression in individual seam cells was often highly punctate (Fig. 2C). Strong GFP expression was observed in the toroid cells that form the developing vulva in the L4 larval stage (Fig. 2, D and E), and expression persisted into early adulthood but was not present in the vulva of mature hermaphrodites. In addition to the hypodermal expression described above for hermaphrodites, intense reporter gene activity was also observed in the developing ray papillae of the L4 male tail (Fig. 2F). Young adult males exhibited weak expression, restricted to the hypodermis just anterior to the tail (not shown). No transgene expression was detected in the dauer larvae, but expression re-appeared ∼12 h after dauers had been transferred to a fresh lawn of E. coli. acn-1(RNAi) Causes Morphological Defects in Larvae and Adults—To investigate the physiological role of ACN-1, we used RNA interference (RNAi) to selectively silence expression of acn-1 (26Fire A. Xu S. Montgomery M.K. Kostas S.A. Driver S.E. Mello C.C. Nature. 1998; 391: 806-811Crossref PubMed Scopus (11430) Google Scholar). The specificity of acn-1(RNAi) was confirmed by abrogation of reporter gene activity in larval hypodermal cells of the transgenic acn-1::gfp line. In initial experiments, dsRNA was injected into the gonads of young adult hermaphrodites, and the phenotype of F1 progeny was analyzed 16-40 h post-injection. Larvae arrested at the L2 stage (penetrance of around 85%) and were either trapped within the L1 cuticle or were carrying fragments of unshed cuticle at variable positions along the body of the nematode. This early lethality prevented the detection of any RNAi-induced phenotype in later larval stages and in adults. This was circumvented by feeding E. coli-expressing acn-1 dsRNA to L1/L2 larvae of an RNAi-sensitive C. elegans mutant (rrf-3) (23Simmer F. Tijsterman M. Parrish S. Koushika S.P. Nonet M.L. Fire A. Ahringer J. Plasterk R.H. Curr. Biol. 2002; 12: 1317-1319Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar). The cuticle defective phenotype was observed in L3/L4 larvae and adult nematodes with high penetrance (>95%) (Figs. 3 and 4). Nematodes fed E. coli lacking the acn-1 dsRNA plasmid showed no cuticle defects and developed normally. The failure to molt correctly resulted in larvae with two layers of cuticle, most visibly around the "neck" or tail regions (Fig. 3, A and B, and Fig. 4, A and C). Consistent with this observation, nematodes exhibited movement defects and apparent slower growth. Adults were generally smaller in length than wild-type nematodes, and several internal structures, particularly the pharynx, were displaced because of the constriction presumably caused by the attached L4 cuticle. The overlying unshed cuticle often sealed the anal pore, leading to severe constipation (Fig. 4B). Severe vulva defects were also observed, compromising egg laying and resulting in the "bagof-worms" phenotype. The protruding vulva, together with an ellipsoid area of adult cuticle, was exposed by the parting of the L4 cuticle around the vulva (Fig. 3C). In addition to entrapment within larval cuticle, adult males showed tail defects associated with malformation of the fan and sensory rays (Fig. 4, C and D). The adult cuticle of acn-1(RNAi) nematodes was characterized by severe deformation of the alae in sections along the lateral body wall (Fig. 3, D-F). The alae and circumferential annuli had a distinctive amorphous appearance.Fig. 4Light micrographs of adult C. elegans following acn-1(RNAi).A, old cuticle (arrow) that has not been shed remains attached to the nematode and appears as cuticular "horns." The old and new cuticle appear to jointly form folds (arrowheads). B, a severely constipated nematode with a swollen intestine (*), resulting from blockage to the anal pore by unshed cuticle. Pb, terminal bulb of the pharynx; In, distended intestine wall. C, an adult male has failed to form a fan and rays and still has the old cuticle (arrowheads) from previous molts attached to the posterior body wall. D, an adult male that has formed a fan but has failed to make a complete set of sensory rays (arrows).View Large Image Figure ViewerDownload Hi-res image Download (PPT) The two lateral alae of adult C. elegans are formed late in the L4 stage of development from cuticle secreted from the two sets of seam cells after they have undergone cell fusion to form a continuous lateral cord running along both sides of the nematode (27White J.G. Wood W.B. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1988: 81-122Google Scholar, 28Podbilewicz B. White J.G. Dev. Biol. 1994; 161: 408-424Crossref PubMed Scopus (156) Google Scholar). The integrity and fate of the L4 seam cells was studied by feeding acn-1 dsRNA to the transgenic C. elegans strain SU93. These nematodes express a GFP-tagged adherens junction protein (AJM-1), highlighting adherens junctions and thus marking the boundaries of the hypodermal cells (24Mohler W.A. Simske J.S. Williams-Masson E.M. Hardin J.D. White J.G. Curr. Biol. 1998; 8: 1087-1090Abstract Full Text Full Text PDF PubMed Google Scholar). Adult SU93 nematodes displayed the same cuticle and alae defects as described above for the rrf-3 mutant strain but with reduced penetrance (around 50%). Nematodes unaffected by acn-1(RNAi) shed the L4 cuticle during the larval/adult molt to reveal alae of normal appearance. The seam cells of the unaffected adults had clearly fused to form the seam syncytium (Fig. 5). In contrast, those nematodes with defective alae had extensive regions of underlying unfused seam cells. This failure to form a complete seam syncytium in adults was more pronounced in animals showing more severe alae defects. nhr-23(RNAi) and nhr-25(RNAi) Silences Seam Cell Expression of acn-1::gfp—Both nhr-23 and nhr-25 are expressed in larval seam cells and are required for the completion of larval molts (29Kostrouchova M. Krause M. Kostrouch Z. Rall J.E. Development. 1998; 125: 1617-1626Crossref PubMed Google Scholar, 30Asahina M. Ishihara T. Jindra M. Kohara Y. Katsura I. Hirose S. Genes Cells. 2000; 5: 711-723Crossref PubMed Scopus (83) Google Scholar, 31Gissendanner C.R. Sluder A.E. Dev. Biol. 2000; 221: 259-272Crossref PubMed Scopus (108) Google Scholar, 32Kostrouchova M. Krause M. Kostrouch Z. Rall J.E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 7360-7365Crossref PubMed Scopus (95) Google Scholar). The similarity of the molting defect induced by acn-1 dsRNA to that recorded previously for nhr-23(RNAi) and nhr-25(RNAi) larvae led us to consider whether these nuclear hormone receptors are involved in regulating acn-1 expression. When nematodes carrying the acn-1::gfp transgene were fed on bacteria expressing either nhr-23 dsRNA or nhr-25 dsRNA, the frequency of larvae expressing GFP in the seam cells decreased by 56 and 44%, respectively (Table I). In these experiments, nhr-23(RNAi) and nhr-25(RNAi) larvae displayed cuticle defects with a penetrance of 40 and 29%, respectively. Control experiments were performed using ltd-1::gfp nematodes, which also express GFP in larval seam cells (25Vargas J.D. Culetto E. Ponting C.P. Mi