Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Sp1 and AP-1 Regulate Expression of the Human Gene VIL2 in Esophageal Carcinoma Cells

2009; Elsevier BV; Volume: 284; Issue: 12 Linguagem: Inglês

10.1074/jbc.m809734200

ISSN

1083-351X

Autores

Shuying Gao, En‐Min Li, Lei Cui, Xiaofeng Lu, Ling-Ying Meng, Huamin Yuan, Jian‐Jun Xie, Zepeng Du, Jianxin Pang, Li–Yan Xu,

Tópico(s)

Ubiquitin and proteasome pathways

Resumo

Ezrin, encoded by VIL2, is a membrane-cytoskeletal linker protein that has been suggested to be involved in tumorigenesis. Ezrin expression in esophageal squamous cell carcinoma (ESCC) was described recently, but its clinical significance and the molecular mechanism underlying its regulated expression remain unclear. Thus, we retrospectively evaluated ezrin expression by immunohistochemistry in a tissue microarray representing 193 ESCCs. Ezrin overexpression in 90 of 193 tumors (46.6%) was associated with poor survival (p = 0.048). We then explored the mechanism by which ezrin expression is controlled in ESCC by assessing the transcriptional regulatory regions of human VIL2 by fusing deletions or site-directed mutants of the 5′-flanking region of the gene to a luciferase reporter. We found that the region -87/-32 containing consensus Sp1 (-75/-69) and AP-1 (-64/-58) binding sites is crucial for VIL2 promoter activity in esophageal carcinoma cells (EC109) derived from ESCC. AP-1 is comprised of c-Jun and c-Fos. Electrophoretic mobility shift and chromatin immunoprecipitation experiments demonstrated that Sp1 and c-Jun bound specifically to their respective binding sites within the VIL2 promoter. In addition, transient expression of Sp1, c-Jun, or c-Fos increased ezrin expression and VIL2 promoter activity. Use of selective inhibitors revealed that VIL2 transactivation required the MEK1/2 signal transduction pathway but not JNK or p38 MAPK. Taken together, we propose a possible signal transduction pathway whereby MEK1/2 phosphorylates ERK1/2, which phosphorylates Sp1 and AP-1 that in turn bind to their respective binding sites to regulate the expression of human VIL2 in ESCC cells. Ezrin, encoded by VIL2, is a membrane-cytoskeletal linker protein that has been suggested to be involved in tumorigenesis. Ezrin expression in esophageal squamous cell carcinoma (ESCC) was described recently, but its clinical significance and the molecular mechanism underlying its regulated expression remain unclear. Thus, we retrospectively evaluated ezrin expression by immunohistochemistry in a tissue microarray representing 193 ESCCs. Ezrin overexpression in 90 of 193 tumors (46.6%) was associated with poor survival (p = 0.048). We then explored the mechanism by which ezrin expression is controlled in ESCC by assessing the transcriptional regulatory regions of human VIL2 by fusing deletions or site-directed mutants of the 5′-flanking region of the gene to a luciferase reporter. We found that the region -87/-32 containing consensus Sp1 (-75/-69) and AP-1 (-64/-58) binding sites is crucial for VIL2 promoter activity in esophageal carcinoma cells (EC109) derived from ESCC. AP-1 is comprised of c-Jun and c-Fos. Electrophoretic mobility shift and chromatin immunoprecipitation experiments demonstrated that Sp1 and c-Jun bound specifically to their respective binding sites within the VIL2 promoter. In addition, transient expression of Sp1, c-Jun, or c-Fos increased ezrin expression and VIL2 promoter activity. Use of selective inhibitors revealed that VIL2 transactivation required the MEK1/2 signal transduction pathway but not JNK or p38 MAPK. Taken together, we propose a possible signal transduction pathway whereby MEK1/2 phosphorylates ERK1/2, which phosphorylates Sp1 and AP-1 that in turn bind to their respective binding sites to regulate the expression of human VIL2 in ESCC cells. Ezrin (villin 2), encoded by VIL2, is a membrane-cytoskeleton linker protein belonging to the ezrin-radixin-moesin family (1Algrain M. Turunen O. Vaheri A. Louvard D. Arpin M. J. Cell Biol. 1993; 120: 129-139Crossref PubMed Scopus (372) Google Scholar). By linking the cytoplasmic face of the plasma membrane to the actin cytoskeleton, ezrin acts as both a structural scaffold and a platform for the transmission of signals in response to extracellular cues (2Srivastava J. Elliott B.E. Louvard D. Arpin M. Mol. Biol. Cell. 2005; 16: 1481-1490Crossref PubMed Scopus (81) Google Scholar). Ezrin is involved in a wide variety of cellular processes such as adhesion (3Hiscox S. Jiang W.G. J. Cell Sci. 1999; 112: 3081-3090Crossref PubMed Google Scholar), survival (4Gautreau A. Poullet P. Louvard D. Arpin M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7300-7305Crossref PubMed Scopus (267) Google Scholar), motility (5Crepaldi T. Gautreau A. Comoglio P.M. Louvard D. Arpin M. J. Cell Biol. 1997; 138: 423-434Crossref PubMed Scopus (283) Google Scholar), and signal transduction (6Louvet-Vallee S. Biol. Cell. 2000; 92: 305-316Crossref PubMed Scopus (274) Google Scholar, 7Pujuguet P. Del Maestro L. Gautreau A. Louvard D. Arpin M. Mol. Biol. Cell. 2003; 14: 2181-2191Crossref PubMed Scopus (148) Google Scholar, 8Hatzoglou A. Ader I. Splingard A. Flanders J. Saade E. Leroy I. Traver S. Aresta S. Gunzburg J. Mol. Biol. Cell. 2007; 18: 1242-1252Crossref PubMed Google Scholar). Furthermore, recent biochemical and functional data have identified a novel role for ezrin in the control of cyclin A gene transcription and endothelial cell proliferation (9Kishore R. Qin G. Luedemann C. Bord E. Hanley A. Silver M. Gavin M. Goukassain D. Losordo D.W. J. Clin. Investig. 2005; 115: 1785-1796Crossref PubMed Scopus (66) Google Scholar).Ezrin is often aberrantly expressed in human cancers. There is a relationship between high expression of ezrin and metastatic potential of some carcinomas, including hepatocellular carcinoma (10Zhang Y. Hu M.Y. Wu W.Z. Wang Z.J. Zhou K. Zha X.L. Liu K.D. J. Cancer Res. Clin. Oncol. 2006; 132: 685-697Crossref PubMed Scopus (42) Google Scholar), lung cancer (11Deng X. Tannehill-Gregg S.H. Nadella M.V. He G. Levine A. Cao Y. Rosol T.J. Clin. Exp. Metastasis. 2007; 24: 107-119Crossref PubMed Scopus (43) Google Scholar), breast carcinoma (12Elliott B.E. Meens J.A. SenGupta S.K. Louvard D. Arpin M. Breast Cancer Res. 2005; 7: R365-373Crossref PubMed Scopus (177) Google Scholar), pancreatic adenocarcinoma (13Akisawa N. Nishimori I. Iwamura T. Onishi S. Hollingsworth M.A. Biochem. Biophys. Res. Commun. 1999; 258: 395-400Crossref PubMed Scopus (135) Google Scholar), and endometrial cancer (14Ohtani K. Sakamoto H. Rutherford T. Chen Z. Kikuchi A. Yamamoto T. Satoh K. Naftolin F. Cancer Lett. 2002; 179: 79-86Crossref PubMed Scopus (81) Google Scholar). We also have demonstrated that ezrin is overexpressed in a malignantly transformed esophageal epithelial cell line compared with an immortalized cell line (15Shen Z.Y. Xu L.Y. Chen M.H. Li E.M. Li J.T. Wu X.Y. Zeng Y. World J. Gastroenterol. 2003; 9: 1182-1186Crossref PubMed Scopus (25) Google Scholar). Our more recent study on esophageal squamous cell carcinoma (ESCC) 3The abbreviations used are: ESCC, esophageal squamous cell carcinoma; AP-1, activating protein-1; Sp1, specific protein-1; EMSA, electrophoretic mobility shift assay; MAPK, mitogen-activated kinase; ERK, extracellular signal-regulated kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; JNK, c-Jun N-terminal kinase; IL, interleukin; DMSO, dimethyl sulfoxide; RT, reverse transcription; ChIP, chromatin immunoprecipitation; CMV, cytomegalovirus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; rh, recombinant human. 3The abbreviations used are: ESCC, esophageal squamous cell carcinoma; AP-1, activating protein-1; Sp1, specific protein-1; EMSA, electrophoretic mobility shift assay; MAPK, mitogen-activated kinase; ERK, extracellular signal-regulated kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; JNK, c-Jun N-terminal kinase; IL, interleukin; DMSO, dimethyl sulfoxide; RT, reverse transcription; ChIP, chromatin immunoprecipitation; CMV, cytomegalovirus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; rh, recombinant human. samples showed that ezrin tends to translocate from the plasma membrane to the cytoplasm in the progression from normal epithelium to invasive carcinoma of the esophagus (16Zeng H. Xu L. Xiao D. Zhang H. Wu X. Zheng R. Li Q. Niu Y. Shen Z. Li E. J. Histochem. Cytochem. 2006; 54: 889-896Crossref PubMed Scopus (42) Google Scholar). Moreover, both in vivo and in vitro experiments suggest that ezrin may affect tumor formation and tumor invasiveness directly (17Xie J.J. Xu L.Y. Xie Y.M. Zhang H.H. Cai W.J. Zhou F. Shen Z.Y. Li E.M. Int. J. Cancer. 2009; (in press)Google Scholar). These findings of ezrin up-regulation associated with epithelial tumor metastasis and invasion make ezrin a potentially new prognostic marker and/or therapeutic target for some carcinomas (12Elliott B.E. Meens J.A. SenGupta S.K. Louvard D. Arpin M. Breast Cancer Res. 2005; 7: R365-373Crossref PubMed Scopus (177) Google Scholar, 18Yeh T.S. Tseng J.H. Liu N.J. Chen T.C. Jan Y.Y. Chen M.F. Arch. Surg. 2005; 140: 1184-1190Crossref PubMed Scopus (36) Google Scholar, 19Kobel M. Langhammer T. Huttelmaier S. Schmitt W.D. Kriese K. Dittmer J. Strauss H.G. Thomssen C. Hauptmann S. Mod. Pathol. 2006; 19: 581-587Crossref PubMed Scopus (56) Google Scholar).Although much is known about how ezrin functions, there have been few reports about how ezrin expression is regulated. It has been reported that human ezrin expression can be regulated by cytokines, interleukin 2 (IL-2), IL-8, IL-10, and insulin-like growth factor 1 inhibit ezrin expression in human colon cancer cells, whereas epidermal growth factor and IL-11 increase cellular ezrin levels (20Jiang W.G. Hiscox S. Anticancer Res. 1996; 16: 861-865PubMed Google Scholar). Moreover, tumor necrosis factor-α treatment of human endothelial cells elevates ezrin expression (9Kishore R. Qin G. Luedemann C. Bord E. Hanley A. Silver M. Gavin M. Goukassain D. Losordo D.W. J. Clin. Investig. 2005; 115: 1785-1796Crossref PubMed Scopus (66) Google Scholar). In disseminated osteosarcoma, ezrin is strongly stained by immunohistochemistry and has been proposed as a crucial factor for osteosarcoma metastasis (21Khanna C. Wan X. Bose S. Cassaday R. Olomu O. Mendoza A. Yeung C. Gorlick R. Hewitt S.M. Helman L.J. Nat. Med. 2004; 10: 182-186Crossref PubMed Scopus (603) Google Scholar). Ogino et al. (22Ogino W. Takeshima Y. Mori T. Yanai T. Hayakawa A. Akisue T. Kurosaka M. Matsuo M. J. Pediatr. Hematol. Oncol. 2007; 29: 435-439Crossref PubMed Scopus (25) Google Scholar) demonstrated a high level of ezrin mRNA expression in an osteosarcoma biopsy sample with lung metastasis, which was compatible with previous reports analyzing ezrin protein levels (21Khanna C. Wan X. Bose S. Cassaday R. Olomu O. Mendoza A. Yeung C. Gorlick R. Hewitt S.M. Helman L.J. Nat. Med. 2004; 10: 182-186Crossref PubMed Scopus (603) Google Scholar). These data suggest that ezrin levels are controlled at the transcriptional level. Stable transformation of Rat-1 fibroblasts by Fos results in increased expression of ezrin (23Jooss K.U. Muller R. Oncogene. 1995; 10: 603-608PubMed Google Scholar, 24Lamb R.F. Ozanne B.W. Roy C. McGarry L. Stipp C. Mangeat P. Jay D.G. Curr. Biol. 1997; 7: 682-688Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). Mouse ezrin expression correlates with Six1 expression in rhabdomyosarcoma (25Yu Y. Khan J. Khanna C. Helman L. Meltzer P.S. Merlino G. Nat. Med. 2004; 10: 175-181Crossref PubMed Scopus (412) Google Scholar). Six1, a homeodomain-containing transcription factor required for skeletal muscle development, can bind to the mouse Vil2 promoter between -1106 and -870, a region containing the MEF3-like motif TTCAGGA, and regulate ezrin expression (26Yu Y. Davicioni E. Triche T.J. Merlino G. Cancer Res. 2006; 66: 1982-1989Crossref PubMed Scopus (115) Google Scholar). Sequence alignment showed that the 5′-flanking regions of human VIL2 and mouse Vil2 are highly diverged (supplemental Fig. S1). Also the MEF3-like motif TTCAGGA present in the mouse sequence does not exist in the human VIL2 promoter. These sequence differences imply that the transcriptional regulation mechanism probably differs between human VIL2 and mouse Vil2. However, no study has addressed the transcriptional regulation of human VIL2, the key transcriptional regulatory regions of the gene, or the regulatory mechanisms governing its expression.In the present study, we evaluated the clinical significance of ezrin overexpression in ESCCs and explored the importance of DNA sequence elements, transcription factors, and the mitogen-activated protein kinase (MAPK) signal transduction pathway in regulating ezrin expression in human esophageal carcinoma cells (EC109 cells), which are derived from ESCC (27Pan Q.G. Xue X.H. Zhonghua Zhong Liu Za Zhi. 1980; 2: 187-192PubMed Google Scholar). We found that ezrin overexpression in ESCCs was associated with decreased survival and that consensus transcription factor Sp1 (-75/-69) and AP-1 (-64/-58) binding sites are essential for human VIL2 promoter activity. We further demonstrated that the cooperativity of Sp1 and AP-1 (c-Jun/c-Fos heterodimer) regulate VIL2 promoter activity and ezrin expression and that mitogen-activated protein kinase kinase (MEK1/2) and extracellular signal-regulated kinase (ERK1/2) are upstream kinases that control human VIL2 transcriptional activation in ESCC cells.EXPERIMENTAL PROCEDURESMaterials-Expression plasmid CMV-Sp1 was kindly provided by Dr. Guntram Suske (Philips University, Marburg, Germany). Plasmid pcDNA3 was purchased from Invitrogen. Plasmids pGL3-Basic and pRL-TK, recombinant human (rh) proteins rhSp1 and rhAP-1 (c-Jun), and kinase inhibitors U0126, PD98059, and SB203580 were purchased from Promega (Madison, WI). c-Jun N-terminal kinase (JNK) inhibitor II SP600125 was purchased from Calbiochem (La Jolla, CA). Antibodies against Sp1, c-Jun, c-Fos, phospho-ERK1/2, ERK1/2, and ezrin, were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). β-Actin was purchased from Sigma. All other reagents were of analytical grade.Tissue Specimens and Immunohistochemical Staining-Surgically removed tumors embedded in paraffin wax blocks from 193 ESCC cases were retrieved from the archives of the Department of Pathology of the Central Hospital of Shantou City, China. The cases were received between 1987 and 1997. The cases were selected to build tissue microarrays as described (28Zhang F.R. Tao L.H. Shen Z.Y. Lv Z. Xu L.Y. Li. E.M. J. Histochem. Cytochem. 2008; 56: 193-199Crossref PubMed Scopus (81) Google Scholar) and were included in this study only if a follow-up was obtained and clinical data were available. Mean age at surgery was 53 years (range 35-70), and 127 patients were male and 66 were female. The SuperPicTure Polymer Detection kit and Liquid Substrate kit (Invitrogen) were used to conduct immunohistochemistry according to the manufacturer's instructions. Staining was scored using the following scale: 0, no staining; 1+, minimal staining; 2+, moderate staining in at least 20% of cells; 3+, strong staining in at least 50% of cells. Cases scored as 0, 1+, or 2+ were classified as "non-overexpression," and cases with 3+ staining were classified as "overexpression." The study was approved by the ethical committee of the Central Hospital of Shantou City and the Medical College of Shantou University, and written informed consent was obtained from all surgical patients to use resected samples for research.Expression Vectors and Reporter Gene Constructs-The human VIL2 5′-flanking region plus 134 bp of transcribed human VIL2 sequence was generated by PCR using the following primers: Fezr, 5′-CGGGGTACCA-1759GTGAATGCTGTTGCTGCTCGTCTGGAAG-3′ (KpnI site underlined; position -1759 is indicated); Rezr, 5′-CCCAAGCT+134TTCGGTTTCTGGTGAGTATCCTCGATCCC-3′ (HindIII site underlined; translation initiation site for the ezrin protein occurs at +135). The amplified fragment from the genomic DNA of EC109 cells was digested with KpnI/HindIII and inserted into the KpnI/HindIII sites of pGL3-basic, and the resulting plasmid was named pGLB-hE(-1759/+134). The luciferase reporter plasmids, pGLB-hE(-324/+134), pGLB-hE(-890/+134), pGLB-hE(-696/+134), pGLB-hE(-213/+134), pGLB-hE(-146/+134), pGLB-hE(-97/+134), pGLB-hE(-87/+134), and pGLB-hE(-32/+134) were generated from pGLB-hE(-1759/+134) using the Erase-a-Base® System (Promega). Site-directed mutagenesis to obtain sequences (-87/+134)Sm, (-87/+134)Am, and (-87/+134)SAm was performed by PCR using primer "Rezr" along with the following primers: Fezr-Sm, 5′--83GCAGTGCTAATATTTGCGCTGACTCACCCGGGCCCG-3′; Fezr-Am, 5′--83GCAGTGCTGGGCGGGGCGCGTCGGATCCCGGGCCCGGGCTGGCCGGTTC-3′; or Fezr-SAm, 5′--83GCAGTGCTAATATTTGCGCGTCGGATCCCGGGCCCGGGCTGGCCGG-3′ (position -83 is indicated; mutated bases are underlined). The amplified fragments obtained using Pfu DNA polymerase (Promega) were digested with HindIII and inserted into the SmaI/HindIII sites of pGL3-basic and were named pGLB-hE(-87/+134)Sm, pGLB-hE(-87/+134)Am, and pGLB-hE(-87/+134)SAm; in the constructs the sequence upstream of the sense primer was GCCC, which is the same sequence as -87/-84 of the human VIL2 5′-flanking region. The c-Fos and c-Jun expression vectors were constructed by cloning full-length c-Fos or c-Jun cDNA in the pcDNA3 plasmid. Primers for c-Fos were 5′-CCAAGCTTACCGCCACGATGATGTTCTC-3′ (HindIII site underlined) and 5′-CGGGATCCTTCCCTGCCCCCTCACA-3′ (BamHI site underlined). Primers for c-Jun were 5′-CCAAGCTTTGACGGACTGTTCTATGACTGC-3′ (HindIII site underlined) and 5′-CGGGATCCCGACGGTCTCTCTTCAAAATGT-3′ (BamHI site underlined).Cell Culture and Transfection-EC109 cells were maintained in 199 medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) at 37 °C in a 5% CO2 environment. For transfection, cells were seeded in 96-well plates at 1.5 × 105 cells/ml, grown to 50-80% confluency and transfected with the plasmids described above using Superfect Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Following transfection, cells were incubated for another 48 h before being harvested for the luciferase assay or gene expression assay. Alternatively, after transfection for 24 h, cells were treated with a kinase inhibitor for another 24 h before being harvested.Luciferase Assay-Transfected cells were harvested in Passive Lysis Buffer (Promega) and the cell lysates analyzed for luciferase activity with the Dual Luciferase Reporter Assay System (Promega) according to the manufacturer's recommendations.Electrophoretic Mobility Shift Assay (EMSA)-Nuclear extracts from human esophageal cancer cells were produced according to standard methods (29Sambrook J. Russell D. Molecular Cloning: A Laboratory Manual.3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2000Google Scholar). Extracts were aliquoted and stored at -70 °C. Equimolar amounts of complementary, single-stranded oligonucleotides were annealed and labeled with digoxigenin (DIG)-ddUTP by terminal transferase using a DIG Gel Shift kit (Roche). The oligonucleotide probes used in EMSA were as follows: probe W, 5′-GCCCGCAGTGCTGGGCGGGGCGCTGACTCACCCGGGCCCGGG-3′ (wild-type sequence); probe Sm, 5′-GCCCGCAGTGCTAATATTTGCGCTGACTCACCCGGGCCCGGG-3′ (mutated Sp1 binding site underlined); probe Am, 5′-GCCCGCAGTGCTGGGCGGGGCGCGTCGGATCCCGGGCCCGGG-3′ (mutated AP-1 binding site underlined); and probe SAm, 5′-GCCCGCAGTGCTAATATTTGCGCGTCGGATCCCGGGCCCGGG-3′ (both mutated Sp1 and AP-1 binding sites underlined). These probes corresponded to the human VIL2 5′-flanking sequence from -87 to -46. Each binding mixture (20 μl) for EMSA contained 5-10 μg of nuclear extract or 0.2-0.3 μg of recombinant protein, 20 mm HEPES (pH 7.9), 1 mm EDTA (pH 8.0), 1 mm dithiothreitol, 10 mm (NH4)2SO4, 0.2% (w/v) Tween 20, 30 mm KCl, 1 μg poly[d(I-C)], 0.1 μg of poly-l-lysine, and 0.05 pmol of labeled double-stranded oligonucleotide probe. Samples were incubated at room temperature for 30 min, and complexes were analyzed by electrophoresis on 6% non-denaturing polyacrylamide gels (acrylamide/bis-acrylamide ratio of 29:1) in 0.5× TBE at 80 V for 180 min at 4 °C. The gels were then transferred to a positively charged nylon membrane. Alkaline phosphatase-conjugated anti-digoxigenin antibody and chemiluminescent substrate were used to detect digoxigenin (Dig Gel Shift kit), and immunoreactive bands were photographed and analyzed by a Flu- orChemTMIS-8900 (Alpha Innotech, San Leandro, CA). For analysis of blocking of Sp1 binding to DNA, DNA probes were preincubated for 1 h at 4 °C with increasing concentrations of mithramycin A (0.1, 1, or 10 μm) before use in binding reactions. In specific competition experiments, a 100-fold molar excess of unlabeled oligonucleotide was added to the binding reactions.Chromatin Immunoprecipitation (ChIP)-EC109 cells were grown to 70-80% confluency on three 15-cm plates (∼4.5 × 107 cells per plate). Chromatin immunoprecipitation was carried out using the ChIP-IT kit (Active Motif, Carlsbad, CA). Briefly, the enzymatically sheared chromatin was precleared with protein G beads and an aliquot saved as a positive control (input DNA). Aliquots of the precleared sheared chromatin were then immunoprecipitated using 2 μg of antibodies against IgG, Sp1, c-Jun, or c-Fos. The resulting DNA was used for PCR analysis, and the amplified DNA fragments were visualized on an agarose gel. PCR of immunoprecipitated DNA were carried out using human VIL2 promoter-specific primers and negative control primers flanking a region of genomic DNA between GAPDH and the chromosome condensation-related SMC-associated protein gene. The human VIL2 promoter-specific primers were 5′-CTCCCCATGCCCGCAGTGCT-3′ (VIL2 -95/-76 sequence) and 5′-GGTGAGTATCCTCGATCCCCGAAAA-3′ (VIL2 +123/+99 sequence). The negative control primers were 5′-ATGGTTGCCACTGGGGATCT-3′ and 5′-TGCCAAAGCCTAGGGGAAGA-3′.Real-time Reverse Transcription (RT)-Polymerase Chain Reaction-Total cellular RNA was extracted from EC109 cells with TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using the PrimeScript™ RT-PCR kit (TaKaRa, Dalian, China). The real-time RT-PCR assay was carried out with the Rotor-Gene 6000 system (Corbett Life Science, Sydney, Australia) using SYBR® Premix Ex Taq™ (TaKaRa) according to the manufacturer's instructions. All PCRs were done in triplicate. The sequences of VIL2 primers were designed based on the human VIL2 mRNA sequence (GenBank accession number NM_003379) as follows: VIL2 forward, 5′-AGCGCATCACTGAGGCAGAG-3′, and reverse, 5′-GCCGCAGCGTCTTGTACTTG-3′. The sequences of GAPDH primers were designed based on the human GAPDH mRNA sequence (GenBank accession number NM_002046) as follows: GAPDH forward, 5′-GCACCGTCAAGGCTGAGAAC-3′ and reverse, 5′-TGGTGAAGACGCCAGTGGA-3′. The absolute levels of mRNAs of VIL2 were normalized to that of GAPDH mRNA. The relative value from the vehicle-treated control group was considered equal to one arbitrary unit.Western Blot Analysis-Whole cell protein extracts were boiled for 5 min with Laemmli buffer and subjected to 12% SDS-polyacrylamide gel electrophoresis using standard methodology. Proteins were then transferred electrophoretically onto a polyvinylidene difluoride membrane (Immobilon, pore size 0.45 μm, Millipore, Bedford, MA) using a constant voltage of 60 V for 120 min. The membranes were then blocked in 5% nonfat milk in phosphate-buffered saline containing 0.1% Tween 20 for 1 h at room temperature followed by the addition of the primary antibody for 1 h at room temperature. The membranes were then washed and incubated with a secondary antibody coupled to horseradish peroxidase for 1 h at room temperature. Antigen-antibody complexes were detected by Western blot luminol reagent (Santa Cruz Biotechnology).Statistical Analysis-Data analysis was performed using SPSS 13.0 (SPSS, Inc., Chicago, IL). A two-tailed independent-sample t test was used to determine the significance of differences between groups. Differences were considered statistically significant at p < 0.05. Data are plotted as mean ± S.D. Survival was assessed by Kaplan-Meier analysis, and the log-rank score was used to determine statistical significance.RESULTSEzrin Overexpression in ESCCs Is Associated with Poor Survival-Our recent study on ESCC samples showed that ezrin tends to translocate from the plasma membrane to the cytoplasm in the progression from normal epithelium to invasive carcinoma of the esophagus (16Zeng H. Xu L. Xiao D. Zhang H. Wu X. Zheng R. Li Q. Niu Y. Shen Z. Li E. J. Histochem. Cytochem. 2006; 54: 889-896Crossref PubMed Scopus (42) Google Scholar). Here, we confirmed this finding and further evaluated clinical significance. Ezrin immunoreactivity in normal esophageal epithelial tissue was weak to moderate in the membrane and cytoplasm (data not shown). However, ESCC tumors displayed one of four distinct immunostaining phenotypes (Fig. 1): intense diffuse membranous and/or cytoplasmic staining (Fig. 1A), moderate cytoplasmic staining (Fig. 1B), weak cytoplasmic staining (Fig. 1C), or no staining (Fig. 1D). Ezrin overexpression was defined as intense diffuse cytoplasmic and/or plasma membrane staining in >50% of tumor cells. In all, 90 of 193 tumors were designated as ezrin overexpressors. Kaplan-Meier survival analysis (Fig. 2) demonstrated that ezrin overexpression was associated with decreased survival (p = 0.048).FIGURE 2Kaplan-Meier estimates of the survival by ezrin status. The survival rate for patients overexpressing ezrin was significantly lower than that for patients not overexpressing ezrin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Consensus Sp1 (-75/-69) and AP-1 (-64/-58) Binding Sites Are Essential for Human VIL2 Promoter Activity-To better understand the transcriptional regulation of ezrin in ESCCs, 1759 bp of the 5′-flanking region of human VIL2 and 134 bp of the transcribed sequence were cloned from EC109 cells (derived from ESCC) and sequenced (GenBank accession number EF184645). NCBI BLAST analysis (www.ncbi.nlm.nih.gov/BLAST) showed that the cloned fragment had 99% identity with the corresponding segment of human VIL2 AL589931. The CpGPlot Program (www.ebi.ac.uk/emboss/cpgplot) revealed this fragment to be highly GC rich, with CpG islands located at -1564/-581, -558/-303, and -203/+77 (supplemental Fig. S2). Potential transcription factor binding sites within human VIL2 were identified through gene-regulation (www.gene-regulation.com/pub/programs/alibaba2). The analysis revealed multiple potential transcription factor binding sites in this fragment, many of them overlapping, and one site that is a putative target of several factors (supplemental Fig. S3). Moreover, the human VIL2 promoter region lacks a typical TATA box but contains numerous potential Sp1 binding sites, as is common with many GC-rich promoters (30Hapgood J.P. Riedemann J. Scherer S.D. Cell Biol. Int. 2001; 25: 17-31Crossref PubMed Scopus (44) Google Scholar).Transient transfection of EC109 cells showed that the 5′-flanking region of human VIL2 (∼1.8 kb) could drive transcription of a luciferase reporter. To localize the regulatory region of promoter activity, a series of 5′-deletion mutants was constructed and analyzed. In EC109 cells, the -1324/+134 region of VIL2 directed maximum luciferase activity (Fig. 3A). The region -87/+134 had considerable reporter activity. Sequence deletion from -1324 to -890 caused an ∼50% reduction in luciferase activity, whereas 5′-deletion from -87 to -32 nearly abolished the activity. When compared with region -890/+134, further deletions, i.e. -696/+134, -213/+134, -146/+134, -97/+134, and -87/+134, did not markedly change the reporter activity. These data suggest that the region -1324/-890 positively regulates transcription and that the region -87/-32 regulates the promoter activity of human VIL2 in EC109 cells.FIGURE 3Transcriptional regulatory region of the human VIL2 5′-flanking region in EC109 cells. A, localization of the transcriptional regulatory region of human VIL2 by 5′-deletion analysis. Schematic representation of the VIL2 promoter 5′-deletion constructs used for transient transfections is shown on the left. 5′-Deletion constructs were cotransfected with pRL-TK into EC109 cells. Luciferase activity (right) was normalized to Renilla luciferase activity and then shown relative to that of EC109 cells transfected with pGLB-hE(-1759/+134), which was set to 100%. B, sequence of the -87/-32 region of human VIL2. The Sp1 binding site (-75/-69) and AP-1 binding site (-64/-58) are underlined. C, identification of functional sites within the human VIL2 promoter region. Schematic representation of the VIL2 promoter site-directed mutagenesis constructs used for transient transfections is shown on the left. Site-directed mutagenesis constructs were cotransfected with pRL-TK into EC109 cells. Luciferase activity (right) was normalized to Renilla luciferase activity and then shown relative to that of EC109 cells transfected with pGLB-hE(-87/+134), which was set to 100%. Each value represents the mean ± S.D. The data are representative of at least two independent experiments. Transfections were carried out in triplicate for each experiment. ***, p < 0.001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To further investigate the role of specific 5′-flanking regions in the promoter activity of human VIL2, two candidate sites were chosen: a consensus Sp1 binding site (-75/-69, GGGCGGG) and a consensus AP-1 binding site (-64/-58, TGACTCA) (Fig. 3B). Constructs containing 87 bp of VIL2 5′-flanking region with site-directed mutations in the Sp1 site and/or the AP-1 were used for transfection, and expression of the constructs was detected by luciferase assays in EC109 cells. The Sp1 and AP-1 sites were essen

Referência(s)