Identification of Residues Important Both for Primary Receptor Binding and Specificity in Fibroblast Growth Factor-7
2000; Elsevier BV; Volume: 275; Issue: 45 Linguagem: Inglês
10.1074/jbc.m003293200
ISSN1083-351X
AutoresIfat Sher, Tamar Lang, Sharon Lubinsky-Mink, Jonathan Kuhn, Noam Adir, S Chatterjee, Dietmar Schomburg, Dina Ron,
Tópico(s)Metabolism, Diabetes, and Cancer
ResumoFibroblast growth factors (FGFs) mediate a multitude of physiological and pathological processes by activating a family of tyrosine kinase receptors (FGFRs). Each FGFR binds to a unique subset of FGFs and ligand binding specificity is essential in regulating FGF activity. FGF-7 recognizes one FGFR isoform known as the FGFR2 IIIb isoform or keratinocyte growth factor receptor (KGFR), whereas FGF-2 binds well to FGFR1, FGFR2, and FGFR4 but interacts poorly with KGFR. Previously, mutations in FGF-2 identified a set of residues that are important for high affinity receptor binding, known as the primary receptor-binding site. FGF-7 contains this primary site as well as a region that restricts interaction with FGFR1. The sequences that confer on FGF-7 its specific binding to KGFR have not been identified. By utilizing domain swapping and site-directed mutagenesis we have found that the loop connecting the β4-β5 strands of FGF-7 contributes to high affinity receptor binding and is critical for KGFR recognition. Replacement of this loop with the homologous loop from FGF-2 dramatically reduced both the affinity of FGF-7 for KGFR and its biological potency but did not result in the ability to bind FGFR1. Point mutations in residues comprising this loop of FGF-7 reduced both binding affinity and biological potency. The reciprocal loop replacement mutant (FGF2-L4/7) retained FGF-2 like affinity for FGFR1 and for KGFR. Our results show that topologically similar regions in these two FGFs have different roles in regulating receptor binding specificity and suggest that specificity may require the concerted action of distinct regions of an FGF. Fibroblast growth factors (FGFs) mediate a multitude of physiological and pathological processes by activating a family of tyrosine kinase receptors (FGFRs). Each FGFR binds to a unique subset of FGFs and ligand binding specificity is essential in regulating FGF activity. FGF-7 recognizes one FGFR isoform known as the FGFR2 IIIb isoform or keratinocyte growth factor receptor (KGFR), whereas FGF-2 binds well to FGFR1, FGFR2, and FGFR4 but interacts poorly with KGFR. Previously, mutations in FGF-2 identified a set of residues that are important for high affinity receptor binding, known as the primary receptor-binding site. FGF-7 contains this primary site as well as a region that restricts interaction with FGFR1. The sequences that confer on FGF-7 its specific binding to KGFR have not been identified. By utilizing domain swapping and site-directed mutagenesis we have found that the loop connecting the β4-β5 strands of FGF-7 contributes to high affinity receptor binding and is critical for KGFR recognition. Replacement of this loop with the homologous loop from FGF-2 dramatically reduced both the affinity of FGF-7 for KGFR and its biological potency but did not result in the ability to bind FGFR1. Point mutations in residues comprising this loop of FGF-7 reduced both binding affinity and biological potency. The reciprocal loop replacement mutant (FGF2-L4/7) retained FGF-2 like affinity for FGFR1 and for KGFR. Our results show that topologically similar regions in these two FGFs have different roles in regulating receptor binding specificity and suggest that specificity may require the concerted action of distinct regions of an FGF. fibroblast growth factor fibroblast growth factor receptor Fibroblast growth factors (FGFs)1 constitute a family of at least 19 structurally related polypeptides that play key roles during development and morphogenesis (1Martin G.R. Genes Dev. 1998; 12: 1571-1586Crossref PubMed Scopus (567) Google Scholar), as well as several physiological and pathological situations such as wound repair, neuvascularization, and tumor growth and metastasis (2Basilico C. Moscatelli D. Adv. Cancer Res. 1992; 59: 115-165Crossref PubMed Scopus (1057) Google Scholar, 3Zetter B.R. Annu. Rev. Med. 1998; 49: 407-424Crossref PubMed Scopus (869) Google Scholar). The biological activities of FGFs are mediated by cell surface high affinity receptors that belong to the tyrosine kinase receptor family and cellular responses to FGFs are modulated by heparan sulfate proteoglycans that are also known as low affinity receptors for FGFs (4McKeehan W.L. Wang F. Kan M. Prog. Nucleic Acids Res. Mol. Biol. 1998; 59: 135-176Crossref PubMed Scopus (363) Google Scholar, 5Johnson D.E. Lu J. Chen H. Werner S. Williams L.T. Mol. Cell. Biol. 1991; 11: 4627-4634Crossref PubMed Scopus (358) Google Scholar, 6Rapraeger A.C. Guimond S. Krufka A. Olwin B.B. Methods Enzymol. 1994; 245: 219-240Crossref PubMed Scopus (96) Google Scholar, 7Vlodavsky I. Miao H.Q. Medalion B. Danagher P. Ron D. Cancer Metastasis Rev. 1996; 15: 177-186Crossref PubMed Scopus (270) Google Scholar). Four high affinity receptors (FGFR1-FGFR4) that share common structural features have been identified (4McKeehan W.L. Wang F. Kan M. Prog. Nucleic Acids Res. Mol. Biol. 1998; 59: 135-176Crossref PubMed Scopus (363) Google Scholar, 5Johnson D.E. Lu J. Chen H. Werner S. Williams L.T. Mol. Cell. Biol. 1991; 11: 4627-4634Crossref PubMed Scopus (358) Google Scholar). The prototype FGFR is composed of an extracellular ligand-binding domain that contains three immunoglobulin-like domains (D1-D3), a transmembrane domain, and a cytoplasmic domain that bears the tyrosine kinase activity (4McKeehan W.L. Wang F. Kan M. Prog. Nucleic Acids Res. Mol. Biol. 1998; 59: 135-176Crossref PubMed Scopus (363) Google Scholar, 5Johnson D.E. Lu J. Chen H. Werner S. Williams L.T. Mol. Cell. Biol. 1991; 11: 4627-4634Crossref PubMed Scopus (358) Google Scholar). Receptor binding specificity is an essential element in regulating the diverse activities of FGFs. Each of the four FGFRs binds a subset of FGFs with varying affinities, and an additional level of complexity is created via an alternative splicing mechanism that generates FGFR1-FGFR3 isoforms with altered ligand binding properties (4McKeehan W.L. Wang F. Kan M. Prog. Nucleic Acids Res. Mol. Biol. 1998; 59: 135-176Crossref PubMed Scopus (363) Google Scholar, 5Johnson D.E. Lu J. Chen H. Werner S. Williams L.T. Mol. Cell. Biol. 1991; 11: 4627-4634Crossref PubMed Scopus (358) Google Scholar). This phenomenon is best exemplified for the FGFR2IIIb isoform, also known as the keratinocyte growth factor receptor (KGFR). This receptor is a spliced variant of FGFR2. While FGFR2 binds FGF-1 and FGF-2 with high affinity and does not interact with the keratinocyte growth factor (FGF-7 or KGF), the KGFR binds FGF-1 and FGF-7 with high affinity and FGF-2 with a 20-fold lower affinity (8Bottaro D.P. Rubin J.S. Ron D. Finch P.W. Florio C. Aaronson S.A. J. Biol. Chem. 1990; 265: 12767-12770Abstract Full Text PDF PubMed Google Scholar, 9Miki T. Bottaro D.P. Fleming T.P. Smith C.L. Burgess W.H. Chan A.M. Aaronson S.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 246-250Crossref PubMed Scopus (662) Google Scholar). FGF-7 is unique among its family members since this growth factor has a distinctive target cell specificity. Whereas the other FGFs have broader cell type specificity, FGF-7 is secreted by cells of mesenchymal origin and acts predominantly on cells of epithelial origin (10Rubin J.S. Bottaro D.P. Chedid M. Miki T. Ron D. Cunha G.R. Finch P.W. Goldberg I.D. Rosen E.M. Epithelial-Mesenchymal Interactions in Cancer. Birkhauser Verlag Press, Basal, Switzerland1995: 191-214Google Scholar). The unique target cell specificity of FGF-7 is dictated by virtue of the fact that unlike the other FGFs, which can interact with several FGFRs, FGF-7 can only bind to the KGFR isoform that is specifically expressed in epithelial cells (11Finch P.W. Cunha G.R. Rubin J.S. Wong J. Ron D. Dev. Dyn. 1995; 203: 223-240Crossref PubMed Scopus (264) Google Scholar). Because of its unique receptor binding characteristics, FGF-7 is ideal for studying how the specificity of FGF-FGFR interaction is conferred at the structural level. The three-dimensional structures of three FGFs, FGF-1, FGF-2, and FGF-7 have been resolved (12Zhu X. Komiya H. Chirino A. Faham S. Fox G.M. Arakawa T. Hsu B.T. Rees D.C. Science. 1991; 251: 90-93Crossref PubMed Scopus (332) Google Scholar, 13Osslund T.D. Syed R. Singer E. Hsu W.-J., E. Nybo R. Chen B.L. Harvey T. Arakawa T. Owers Narhi L. Chirino A. Morris C.F. Protein Sci. 1998; 7: 1681-1690Crossref PubMed Scopus (31) Google Scholar). Although there is only about 50% amino acid sequence identity between these three growth factors, their three-dimensional structures share a common structural fold, the β-trefoil scaffold, and the three structures are nearly superimposable (12Zhu X. Komiya H. Chirino A. Faham S. Fox G.M. Arakawa T. Hsu B.T. Rees D.C. Science. 1991; 251: 90-93Crossref PubMed Scopus (332) Google Scholar, 13Osslund T.D. Syed R. Singer E. Hsu W.-J., E. Nybo R. Chen B.L. Harvey T. Arakawa T. Owers Narhi L. Chirino A. Morris C.F. Protein Sci. 1998; 7: 1681-1690Crossref PubMed Scopus (31) Google Scholar). However, the three FGFs display distinct receptor binding characteristics suggesting that sequence differences between FGFs regulate receptor binding specificity. Earlier mutagenesis studies by Springer et al. (14Springer B.A. Pantoliano M.W. Barbera F.A. Gunyuzlu P.L. Thompson L.D. Herblin W.F. Rosenfeld S.A. Book G.W. J. Biol. Chem. 1994; 269: 26879-26884Abstract Full Text PDF PubMed Google Scholar) identified two receptor-binding sites in FGF-2 that map onto diametrically opposite sides of the molecule. Based on their relative affinities for FGFR1, these sites were named high and low affinity sites. The high affinity site is comprised of a set of discontinuous residues that are clustered in a hydrophobic patch on the FGF-2 surface. These residues are highly conserved among FGFs and therefore unlikely to contribute to ligand binding specificity. The low affinity site resides within a loop that connects the ninth and tenth β-strands of FGF-2 (14Springer B.A. Pantoliano M.W. Barbera F.A. Gunyuzlu P.L. Thompson L.D. Herblin W.F. Rosenfeld S.A. Book G.W. J. Biol. Chem. 1994; 269: 26879-26884Abstract Full Text PDF PubMed Google Scholar). Although the loop structure and its primary sequence vary among FGFs, β9-β10 loop exchange between FGF-2 and FGF-7 did not alter their known receptor binding specificities (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). Other investigators have proposed that a segment in the carboxyl-terminal part of FGF-7 prevents this growth factor from binding to FGFR1. Replacement of this segment with the corresponding one in FGF-1 (termed the glycine box) conferred on FGF-7 the ability to bind FGFR1 (16Luo Y. Lu W. Mohamedali K.A. Jang J.H. Jones R.B. Gabriel J.L. Kan M. McKeehan W.L. Biochemistry. 1998; 37: 16506-16515Crossref PubMed Scopus (51) Google Scholar). However, acquisition of FGFR1 binding did not result in a concomitant loss of high affinity binding of FGF-7 to the KGFR which suggests that binding specificity is determined by more than one region of an FGF. The present work was aimed at identifying such determinants. Based on both loop exchange between FGF-2 and FGF-7 and site-directed mutagenesis in FGF-7, we found that the loop connecting the β4-β5 strands of FGF-7 participates in primary receptor binding and is critical for FGF-7/KGFR recognition. The results are discussed in light of the recently resolved crystal structure of FGF bound to FGFR (17Plotnikov A.N. Schlessinger J. Hubbard S.R. Mohammadi M. Cell. 1999; 98: 641-650Abstract Full Text Full Text PDF PubMed Scopus (513) Google Scholar, 18Stauber D.J. DiGabriele A.D. Hendrickson W.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 49-54Crossref PubMed Scopus (214) Google Scholar). Recombinant FGF-2 and FGF-7 were produced in bacteria and purified as described previously (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar, 19Reich-Slotky R. Shaoul E. Berman B. Graziani G. Ron D. J. Biol. Chem. 1995; 270: 29813-29818Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 20Ron D. Bottaro D.P. Finch P.W. Morris D. Rubin J.S. Aaronson S.A. J. Biol. Chem. 1993; 268: 2984-2988Abstract Full Text PDF PubMed Google Scholar). Na125I (5000 Ci/mm) was a PerkinElmer Life Sciences product. Heparin-Sepharose CL-6B was from Amersham Pharmacia Biotech. Ni-NTA-agarose was purchased from Qiagen. Bovine serum albumin was from Roche Molecular Biochemicals. Escherichia coliBL21(DE3) cells harboring the thioredoxin (Trx) expression vector were kindly provided by S. Ishii (Tsukuba Life Science Center, The Institute of Physical and Chemical Research (RIKEN), Japan). Fetal and newborn calf serum and media were purchased from Biological Industries (Beth-hemeek, Israel) or Life Technologies, Inc. Rabbit anti-FGF-2 antibodies were from R&D. Fibronectin and α-phosphotyrosine antibodies were from Upstate Biotechnology Inc. Heparin from bovine lung, monoclonal antibodies against human secreted placental alkaline phosphatase, and all other chemicals were purchased from Sigma. The generation of L6E9 cell lines expressing high levels of KGFR (designated L6/KR cells) and FGFR1 (L6/R1 cells) have been described elsewhere (21Ron D. Reich R. Chedid M. Lengel C. Cohen O.E. Chan A.M. Neufeld G. Miki T. Tronick S.R. J. Biol. Chem. 1993; 268: 5388-5394Abstract Full Text PDF PubMed Google Scholar). These cell lines were grown in Dulbecco's modified Eagle's medium containing 10% FCS. NIH/3T3 or NIH/3T3 cells overexpressing KGFR (NIH/KR cells) were grown in Dulbecco's modified Eagle's medium containing 10% newborn calf serum (22Miki T. Fleming T.P. Bottaro D.P. Rubin J.S. Ron D. Aaronson S.A. Science. 1991; 251: 72-75Crossref PubMed Scopus (361) Google Scholar). Balb/MK cells were grown in low calcium media containing 5 ng/ml epidermal growth factor and 10% dialyzed FCS as described previously (23Weissman B.E. Aaronson S.A. Cell. 1983; 32: 599-606Abstract Full Text PDF PubMed Scopus (160) Google Scholar). The mutant FGF2-L4/7, in which the β4-β5 loop of FGF-2 was replaced with that of FGF-7, was created in two steps. First, two chimeric fragments were generated utilizing the polymerase chain reaction technique (24Saiki R.K. Scharf S. Faloona F. Mullis K.B. Horn G.T. Erlich H.A. Arnheim N. Science. 1985; 230: 1350-1354Crossref PubMed Scopus (6818) Google Scholar). Primers p1 and p2 were used to amplify the segment encoding FGF-2 residues 1–74, in which the codons encoding residues Gln65-Arg69 were replaced with the sequence encoding for the β4-β5 loop of FGF-7 (RTVAV). Primer p1 (GCGGATCCATGGCCGCCGGGAGCATCACC) is complementary to the NH2-terminal part of the FGF-2 gene product, and contains an artificial NcoI site 5′ to the initiation codon, which was employed in cloning. Primer p2 (CACAACCCCAACTGCCACTGTCCTAAGT) contains the sequence encoding the β4-β5 loop of FGF-7 (underlined) and flanking sequences from the FGF-2 gene. A second chimeric fragment encoding FGF-2 residues 61–155 was created using primers p3 and p4. Primer p3 (ATCAAGCTTCAACTTAGGACAGTGGCAGTTGGGGTTGTGTCTATCAAAGGA) contains the sequence for the loop of FGF-7 (underlined) and flanking sequences from the FGF-2 gene. Primer p4 (ATATAAGATCTATCAGCTCTTAGCAGACATT) is complementary to the COOH-terminal part of the FGF-2 gene product and contains an artificialBglII site 3′ to the stop codon for subsequent cloning. In a second step, the amplified products of the first step were annealed and amplified with primers p1 and p4. The fragment obtained was digested with NcoI and BglII and cloned into pKM260 (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). A synthetic gene of human FGF-7, encoding the mature FGF-7 polypeptide (residues Ala31 to Thr194) was utilized for mutational analysis of FGF-7. Silent mutations were introduced during the synthesis of this gene. These led to the elimination of an internalKpnI site and the insertion of 4 unique restriction sites (KpnI, SspI, SnaBI, andMscI) in positions that flank the regions encoding the β3-β4 and β4-β5 loops. The synthetic gene was cloned into the expression vector pKM260. For the replacement of the β3-β4 loop of FGF-7 with that of FGF-2, the FGF-7 plasmid was subjected toKpnI and SspI digestion, to remove the sequence encoding the loop. The digested plasmid was ligated to a double stranded DNA obtained by annealing two synthetic oligonucleotides: TCGCGAGAAGAGCGACCCACACAAT and ATTGTGTGGGTCGCTCTTCTCGCGAGTAC (the sequence encoding the β3-β4 loop of FGF-2 is underlined). Similarly, the β4-β5 loop of FGF-7 was replaced with the corresponding loop of FGF-2 following aMscI/SnaBI digestion of the FGF-7 plasmid and utilizing the following annealed synthetic oligonucleotides:AAGCAGAAGAGAGAGGAATTGTGG and CCACAATTCCTCTCTCTTCTGCTT (the sequence encoding the loop of FGF-2 is underlined). The same methodology was utilized to create the point mutations (except for R101A) utilizing the following oligonucleotide sets: T102A, GTGCAGTGGCAGTTGGAATTGTGG and CCACAATTCCAACTGCCACTGCAC; V103E, GCACAGAGGCAGTTGGAATTGTGG and CCACAATTCCAACTGCCTCTGTGC; V103A, GTACAGCGGCAGTTGGAATTGTTG and CAACAATTCCAACTGCCGCTGTAC; A104E, GCACAGTGGAAGTTGGAATTGTTG and CAACAATTCCAACTTCCACTGTGC; V105R, GTACAGTGGCACGTGGAATTGTTG and CAACAATTCCAC GTGCCACTGTAC; V105A, GCACAGTGGCAGCTGGAATTGTGG and CCACAATTCCAGCTGCCACTGTGC (the point mutations are underlined). The R101A mutant was generated in three steps. First, a mutated segment encoding for FGF-7 residues 31–108 was created using primer p1 (ATGGATCCATGGCTTGCAATGACATGACTCCA) that is complementary to the NH2-terminal part of the FGF-7 gene product, and contains artificial NcoI site 5′ to the start codon, and primer p2 (CCACAATTCCAACTGCCACTGTAGCTATCTCCATAAT) that contains the point mutation (underlined). A second mutated fragment, encoding for FGF-7 residues 97–194 was created using primers p3 (ATTATGGAGATAGCTACAGTGGCAGTTGGAATTGTGG) that contains the point mutation (underlined) and primer p4 (TTGGATCCATTAAGTTATTGCCATAGGAAG) that is complementary to the COOH-terminal part of the FGF-7 gene product. Then the amplified products of the first step were annealed and amplified with primers p1 and p4. The fragment obtained was cut with NcoI andEcoRI and cloned into the FGF-7 plasmid that was digested with the same enzymes. All the mutated genes were sequenced to confirm that the desired mutation had been introduced and that additional mutations had not been created during the amplification process. All the FGFs used in this study were expressed as His-tagged products in E. coli as previously reported (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). FGF-7 and all the FGF-7 mutants were expressed in BL21(DE3) plys S cells (25Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6006) Google Scholar). FGF-2 and the FGF2-L4/7 mutant were co-expressed with E. coli thioredoxin (Trx) in BL21(DE3) cells (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar, 26Yasukawa T. Kanei-Ishii C. Maekawa T. Fujimoto J. Yamamoto T. Ishii S. J. Biol. Chem. 1995; 270: 25328-25331Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar). This enzyme increases the solubility of eukaryotic proteins in E. coli, thus increasing the protein yield. Purification of the recombinant proteins was carried out by Ni2+-nitrilotriacetic acid affinity chromatography followed by heparin-Sepharose affinity chromatography as described previously (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). All mutant proteins eluted from the column at the same salt concentration as the parental molecules (0.5 m NaCl for the FGF-7 mutants, 1.5 m NaCl for the FGF-2 mutants). Circular dichroism (CD) spectra was employed for analyzing differences in secondary structure and in thermal stability of mutant proteins that displayed lower receptor binding affinity or biological potency compared with wild type proteins (27Johnson, W. C., Jr. (1990) Proteins Struct. Funct. Genet. 205–214.Google Scholar) (see Tables I and II). Thermal stability was also determined by incubating wild type and the mutant proteins at 37 °C for 16 h and testing the effect of incubation on receptor binding affinities compared with fresh proteins as described previously (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar).Table ISecondary structure of FGF-7 mutant proteinsProteinTwo-dimensional analysis from 185 to 250 nmα-Helixβ-Sheetβ-TurnRandom coil%%%%FGF-7162289FGF7-L4/2359327R101A362278T102A057349V103A161299V105R066313V105A264287The CD spectra were analyzed using the CONTIN program to estimate the proteins secondary structures from circular dichroism (41Provencher S.W. Glockner J. Biochemistry. 1981; 20: 33-37Crossref PubMed Scopus (1890) Google Scholar). Open table in a new tab Table IIReceptor binding and mitogenic activity for FGF-7 mutantsFGF-7 mutantKGFR binding 2-aIC50 value was calculated from the competitive binding of 125I-labeled FGF-7versus unlabeled wild type FGF-7 or FGF-7 mutants to soluble KR/AP fusion protein (an average of at least three experiments for each mutant). The IC50 value for FGF-7 determined from a large number of independent experiments was 15 ng/ml. (IC50mutant/IC50FGF-7)Mitogenic activity 2-bED50 values were calculated from at least three separate mitogenic assays on Balb/MK cells, as described in the legends to Fig. 1. ED50 value for FGF-7 was 1.2 ng/ml. (ED50mutant/ED50FGF-7)Thermal transition point 2-cApparent T m. The midpoint temperature in the thermal transition curve obtained by following changes in CD signal at 205 nm. T m for FGF-7 was 58 °C.°CR101A5 ± 0.535 ± 1.454T102A4 ± 0.424.5 ± 0.7853V103E2.5 ± 0.1617 ± 0.154V103A2 ± 0.286 ± 0.74ND 2-dND, not determined.A104E0.95 ± 0.070.9 ± 0.0952V105R2 ± 0.545.5 ± 0.8058V105A6 ± 0.8722 ± 3.93542-a IC50 value was calculated from the competitive binding of 125I-labeled FGF-7versus unlabeled wild type FGF-7 or FGF-7 mutants to soluble KR/AP fusion protein (an average of at least three experiments for each mutant). The IC50 value for FGF-7 determined from a large number of independent experiments was 15 ng/ml.2-b ED50 values were calculated from at least three separate mitogenic assays on Balb/MK cells, as described in the legends to Fig. 1. ED50 value for FGF-7 was 1.2 ng/ml.2-c Apparent T m. The midpoint temperature in the thermal transition curve obtained by following changes in CD signal at 205 nm. T m for FGF-7 was 58 °C.2-d ND, not determined. Open table in a new tab The CD spectra were analyzed using the CONTIN program to estimate the proteins secondary structures from circular dichroism (41Provencher S.W. Glockner J. Biochemistry. 1981; 20: 33-37Crossref PubMed Scopus (1890) Google Scholar). Radioiodination of FGF-2 and FGF-7 and separation of the radiolabeled growth factors from free Na125I was performed as described previously (21Ron D. Reich R. Chedid M. Lengel C. Cohen O.E. Chan A.M. Neufeld G. Miki T. Tronick S.R. J. Biol. Chem. 1993; 268: 5388-5394Abstract Full Text PDF PubMed Google Scholar). The specific activities of radioiodinated growth factors were in the range of 1–2 × 105 cpm/ng. Cell surface receptor binding competition assays were performed using subconfluent cultures in 24-well microtiter plates as described (19Reich-Slotky R. Shaoul E. Berman B. Graziani G. Ron D. J. Biol. Chem. 1995; 270: 29813-29818Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 21Ron D. Reich R. Chedid M. Lengel C. Cohen O.E. Chan A.M. Neufeld G. Miki T. Tronick S.R. J. Biol. Chem. 1993; 268: 5388-5394Abstract Full Text PDF PubMed Google Scholar). Solid phase binding assays were performed using 96-well enzyme-linked immunosorbent assay plates coated with a soluble extracellular domain of the mouse KGFR fused to secreted placental alkaline phosphatase (KR/AP) essentially as described (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar, 28Berman B. Ostrovsky O. Shlissel M. Lang T. Regan D. Vlodavsky I. Ishai-Michaeli R. Ron D. J. Biol. Chem. 1999; 274: 36132-36138Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). DNA synthesis was measured by an [3H]thymidine incorporation assay using serum-starved confluent cultures of NIH/3T3 or Balb/MK cells and protein tyrosine phosphorylation experiments were performed utilizing serum starved subconfluent cultures of NIH/KR cells (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar, 19Reich-Slotky R. Shaoul E. Berman B. Graziani G. Ron D. J. Biol. Chem. 1995; 270: 29813-29818Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Previous studies in which large segments were exchanged between FGF-2 and FGF-7 suggested that a region in the middle part of FGF-7 (residues 91–110) may be important for FGF-7/KGFR recognition (19Reich-Slotky R. Shaoul E. Berman B. Graziani G. Ron D. J. Biol. Chem. 1995; 270: 29813-29818Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Theoretical, homology based model of the three-dimensional structure of FGF-7 (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar) indicated that residues 91–110 span the carboxyl-terminal half of the loop connecting the β3-β4 strands, the β4 strand, and the loop connecting the β4-β5 strands. In order to test the contributions of these solvent exposed loops for the specific interaction of FGF-7/KGFR, we first performed loop exchanges between FGF-7 and FGF-2 and examined the effect of each replacement on the unique receptor binding characteristics and biological activity of each growth factor. The 155-amino acid form of FGF-2 and the mature FGF-7 polypeptide (residues 31–194) fused to a hexa-histidine tag were employed in this study. As previously reported, the biological properties of the His-tagged products are identical to those of the parental molecules lacking the tag (15Sher I. Weizman A. Lubinsky-Mink S. Lang T. Adir N. Schomburg D. Ron D. J. Biol. Chem. 1999; 274: 35016-35022Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). The generation, expression, and purification of the parental and mutant proteins are described under “Experimental Procedures.” All mutants retained wild type affinity for heparin (data not shown). Binding competition and [3H]thymidine incorporation were utilized to assess the biological properties of the mutants. The binding experiments were performed in L6E9 cells that were engineered to individually express KGFR (L6/KR cells) or FGFR1 (L6/RI cells), the high affinity receptors of FGF-7 and FGF-2, respectively (21Ron D. Reich R. Chedid M. Lengel C. Cohen O.E. Chan A.M. Neufeld G. Miki T. Tronick S.R. J. Biol. Chem. 1993; 268: 5388-5394Abstract Full Text PDF PubMed Google Scholar, 29Shaoul E. Reich-Slotky R. Berman B. Ron D. Oncogene. 1995; 10: 1553-1561PubMed Google Scholar). The keratinocyte cell line Balb/MK and NIH/3T3 fibroblasts were utilized for the mitogenic assays. FGF-7 is highly mitogenic to Balb/MK cells but does not stimulate a mitogenic response in NIH/3T3 cells, whereas FGF-2 is highly mitogenic to NIH/3T3 cells but is a poor mitogen for keratinocytes (19Reich-Slotky R. Shaoul E. Berman B. Graziani G. Ron D. J. Biol. Chem. 1995; 270: 29813-29818Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 30Aaronson S.A. Bottaro D.P. Miki T. Ron D. Finch P.W. Fleming T.P. Ahn J. Taylor W.G. Rubin J.S. Ann. N. Y. Acad. Sci. 1991; 638: 62-77Crossref PubMed Scopus (137) Google Scholar). The mutant FGF7-L3/2 in which amino acids 89–95 (Gln-Glu-Met-Lys-Asn-Asn-Tyr) from the β3-β4 loop of FGF-7 have been replaced with the corresponding residues of FGF-2 (amino acids Arg53-Glu-Lys-Ser-Asp-Pro-His59) displayed receptor binding properties and mitogenic activity that were indistinguishable from those of FGF-7 (data not shown and Fig.1). These results suggest that the β3-β4 loop does not contribute to the specific interaction between FGF-7 and the KGFR and this mutant was not studied further. In contrast to the results observed with the mutant FGF7-L3/2, replacement of the loop connecting the β4-β5 strands of FGF-7 (amino acids Arg101-Thr-Val-Ala-Val105) with that of FGF-2 (amino acids Gln65-Ala-Glu-Glu-Arg69) resulted in a dramatic reduction in the binding affinity to KGFR. Half-maximal competition for125I-FGF-7 binding was observed at about 20 and 2500 ng/ml FGF-7 and the FGF7-L4/2 mutant, respectively (Fig.2 A). Similar results were obtained using a cell-free binding assay with a soluble extracellular domain of KGFR (data not shown). The reduction in receptor binding affinity of the mutant was not due to an apparent change in the protein secondary structure as the CD spectra of FGF-7 and the mutant protein were identical and, in addition, the m
Referência(s)