Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Fission Yeast TOR Homolog,tor1 +, Is Required for the Response to Starvation and Other Stresses via a Conserved Serine

2001; Elsevier BV; Volume: 276; Issue: 10 Linguagem: Inglês

10.1074/jbc.m010446200

ISSN

1083-351X

Autores

Ronit Weisman, Mordechai Choder,

Tópico(s)

Signaling Pathways in Disease

Resumo

Targets of rapamycin (TORs) are conserved phosphatidylinositol kinase-related kinases that are involved in the coordination between nutritional or mitogenic signals and cell growth. Here we report the initial characterization of twoSchizosaccharomyces pombe TOR homologs,tor1 + and tor2 +.tor2 + is an essential gene, whereastor1 + is required only under starvation and other stress conditions. Specifically, Δtor1 cells fail to enter stationary phase or undergo sexual development and are sensitive to cold, osmotic stress, and oxidative stress. In complex with the prolyl isomerase FKBP12, the drug rapamycin binds a conserved domain in TORs, FRB, thus inhibiting some of the functions of TORs. Mutations at a conserved serine within the FRB domain ofSaccharomyces cerevisiae TOR proteins led to rapamycin resistance but did not otherwise affect the functions of the proteins. The S. pombe tor1 + exhibits different features; substitution of the conserved serine residue, Ser1834, with arginine compromises its functions and has no effect on the inhibition that rapamycin exerts on sexual development in S. pombe. Targets of rapamycin (TORs) are conserved phosphatidylinositol kinase-related kinases that are involved in the coordination between nutritional or mitogenic signals and cell growth. Here we report the initial characterization of twoSchizosaccharomyces pombe TOR homologs,tor1 + and tor2 +.tor2 + is an essential gene, whereastor1 + is required only under starvation and other stress conditions. Specifically, Δtor1 cells fail to enter stationary phase or undergo sexual development and are sensitive to cold, osmotic stress, and oxidative stress. In complex with the prolyl isomerase FKBP12, the drug rapamycin binds a conserved domain in TORs, FRB, thus inhibiting some of the functions of TORs. Mutations at a conserved serine within the FRB domain ofSaccharomyces cerevisiae TOR proteins led to rapamycin resistance but did not otherwise affect the functions of the proteins. The S. pombe tor1 + exhibits different features; substitution of the conserved serine residue, Ser1834, with arginine compromises its functions and has no effect on the inhibition that rapamycin exerts on sexual development in S. pombe. target of rapamycin FKBP12-rapamycin binding kilobase pair(s) base pairs polymerase chain reaction hemagglutinin The target of rapamycin (TOR)1-mediated signaling pathway in the yeast Saccharomyces cerevisiae activates a cell growth program in response to nutrient availability (reviewed in Refs. 1Hall M.N. Biochem. Soc. Trans. 1996; 24: 234-239Crossref PubMed Scopus (44) Google Scholar and 2Cardenas M.E. Cruz M.C. Del Poeta M. Chung N. Perfect J.R. Heitman J. Clin. Microbiol. Rev. 1999; 12: 583-611Crossref PubMed Google Scholar). S. cerevisiae contains two TOR homologs,TOR1 and TOR2. TOR1 is a nonessential gene that shares a common function with TOR2 in controlling G1 progression (3Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (256) Google Scholar, 4Kunz J. Henriquez R. Schneider U. Deuter-Reinhard M. Movva N.R. Hall M.N. Cell. 1993; 73: 585-596Abstract Full Text PDF PubMed Scopus (728) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar, 6Barbet N.C. Schneider U. Helliwell S.B. Stansfield I. Tuite M.F. Hall M.N. Mol. Biol. Cell. 1996; 7: 25-42Crossref PubMed Scopus (602) Google Scholar). This common function is sensitive to the drug rapamycin. Thus, either the loss of function of bothTOR1 and TOR2 or the inhibition of their products by rapamycin results in a G1 arrest (6Barbet N.C. Schneider U. Helliwell S.B. Stansfield I. Tuite M.F. Hall M.N. Mol. Biol. Cell. 1996; 7: 25-42Crossref PubMed Scopus (602) Google Scholar). The rapamycin G1 arrested cells exhibit various characteristics of starved cells (6Barbet N.C. Schneider U. Helliwell S.B. Stansfield I. Tuite M.F. Hall M.N. Mol. Biol. Cell. 1996; 7: 25-42Crossref PubMed Scopus (602) Google Scholar, 7Di Como C.J. Arndt K.T. Genes Dev. 1996; 10: 1904-1916Crossref PubMed Scopus (440) Google Scholar, 8Zaragoza D. Ghavidel A. Heitman J. Schultz M.C. Mol. Cell. Biol. 1998; 18: 4463-4470Crossref PubMed Scopus (184) Google Scholar, 9Beck T. Hall M.N. Nature. 1999; 402: 689-692Crossref PubMed Scopus (799) Google Scholar, 10Schmidt A. Beck T. Koller A. Kunz J. Hall M.N. EMBO J. 1998; 17: 6924-6931Crossref PubMed Scopus (263) Google Scholar, 11Noda T. Ohsumi Y. J. Biol. Chem. 1998; 273: 3963-3966Abstract Full Text Full Text PDF PubMed Scopus (1047) Google Scholar), suggesting that the rapamycin-sensitive activity of the two Tor proteins inhibits the program that leads to stationary phase. Tor2p also controls the polarization of the actin cytoskeleton (12Schmidt A. Kunz J. Hall M.N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13780-13785Crossref PubMed Scopus (214) Google Scholar, 13Schmidt A. Bickle M. Beck T. Hall M.N. Cell. 1997; 88: 531-542Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar), an essential function that is not shared by Tor1p and is not inhibited by rapamycin (4Kunz J. Henriquez R. Schneider U. Deuter-Reinhard M. Movva N.R. Hall M.N. Cell. 1993; 73: 585-596Abstract Full Text PDF PubMed Scopus (728) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar). Similar to the S. cerevisiaeTORs, the mammalian TOR homolog FRAP/RAFT1/mTOR is also involved in signaling pathways that regulate transcription, translation, and G1 progression (reviewed in Ref. 20Cruz M.C. Cavallo L.M. Gorlach J.M. Cox G. Perfect J.R. Cardenas M.E. Heitman J. Mol. Cell. Biol. 1999; 19: 4101-4112Crossref PubMed Scopus (133) Google Scholar). All known TORs contain a conserved domain, the FKBP12-rapamycin binding (FRB) domain, that lies adjacent to the phosphatidylinositol kinase domain in the C-terminal region of the protein (14Chiu M.I. Katz H. Berlin V. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12574-12578Crossref PubMed Scopus (411) Google Scholar, 15Chen J. Zheng X.F. Brown E.J. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4947-4951Crossref PubMed Scopus (448) Google Scholar). A conserved serine residue within this domain is crucial for the binding of the rapamycin-FKBP12 complex. Studies in mammals (14Chiu M.I. Katz H. Berlin V. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12574-12578Crossref PubMed Scopus (411) Google Scholar, 15Chen J. Zheng X.F. Brown E.J. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4947-4951Crossref PubMed Scopus (448) Google Scholar, 16Brown E.J. Albers M.W. Shin T.B. Ichikawa K. Keith C.T. Lane W.S. Schreiber S.L. Nature. 1994; 369: 756-758Crossref PubMed Scopus (1665) Google Scholar), S. cerevisiae (3Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (256) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar, 17Stan R. McLaughlin M.M. Cafferkey R. Johnson R.K. Rosenberg M. Livi G.P. J. Biol. Chem. 1994; 269: 32027-32030Abstract Full Text PDF PubMed Google Scholar, 18Helliwell S.B. Wagner P. Kunz J. Deuter-Reinhard M. Henriquez R. Hall M.N. Mol. Biol. Cell. 1994; 5: 105-118Crossref PubMed Scopus (317) Google Scholar, 19Lorenz M.C. Heitman J. J. Biol. Chem. 1995; 270: 27531-27537Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar), andCryptococcus neoformans (20Cruz M.C. Cavallo L.M. Gorlach J.M. Cox G. Perfect J.R. Cardenas M.E. Heitman J. Mol. Cell. Biol. 1999; 19: 4101-4112Crossref PubMed Scopus (133) Google Scholar) have shown that a mutation at the conserved serine residue confers dominant rapamycin resistance by abolishing the binding to the FKBP12-rapamycin complex. The importance of the conserved serine for this binding is reinforced by the atomic structure of the ternary complex FRB-rapamycin-FKBP12 (21Choi J. Chen J. Schreiber S.L. Clardy J. Science. 1996; 273: 239-242Crossref PubMed Scopus (723) Google Scholar). Despite the high conservation of this serine, TOR proteins that are expressed at normal levels and carry a mutated serine appear to retain wild type activities other than FKBP12-rapamycin binding (5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar, 22Brown E.J. Beal P.A. Keith C.T. Chen J. Shin T.B. Schreiber S.L. Nature. 1995; 377: 441-446Crossref PubMed Scopus (618) Google Scholar, 23Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.T. Science. 1997; 277: 99-101Crossref PubMed Scopus (809) Google Scholar, 24Hara K. Yonezawa K. Kozlowski M.T. Sugimoto T. Andrabi K. Weng Q.P. Kasuga M. Nishimoto I. Avruch J. J. Biol. Chem. 1997; 272: 26457-26463Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar). Schizosaccharomyces pombe is genetically tractable yeast that is highly divergent from S. cerevisiae. These two yeasts often have distinct differences in carrying out the same cellular functions, which makes their comparative study especially revealing (25Forsburg S.L. Trends Genet. 1999; 15: 340-344Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Upon starvation, S. pombe cells enter either the stationary phase or the sexual development pathway (reviewed in Ref. 26Davey J. Yeast. 1998; 14: 1529-1566Crossref PubMed Scopus (84) Google Scholar). We previously reported that rapamycin has a different effect on S. pombe compared with its effect on S. cerevisiae. Rapamycin does not inhibit the growth of S. pombe but specifically inhibits sexual development in response to starvation (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar). As a first step toward understanding the response to rapamycin in S. pombe, we cloned and initiated a functional analysis of the S. pombe TOR homologs, namedtor1 + and tor2 +. We show here that at least some of the functions of each of these TORs are distinct. Thus, tor2 + is essential for growth, whereas tor1 + is required only under starvation and other stress conditions. We also demonstrate that the conserved serine residue within the FRB domain of Tor1 is important for the protein function and does not play a detectable role in the response of starved S. pombe to rapamycin. Yeast strains used in this paper are described in TableI. All media used in this study are based on those described previously (28Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3143) Google Scholar). EMM-N contains no nitrogen; EMM lowG contains 0.1% glucose. Rapamycin was used as described previously (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar). Transformation of S. pombe cells was performed by electroporation (29Prentice H.L. Nucleic Acids Res. 1992; 20: 621Crossref PubMed Scopus (214) Google Scholar). Assays for mating or sporulation efficiency were carried out as described in (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar).Table IStrains used in this studyStrainaStrains TA99, TA100, and TA120 are haploid segregants of the diploid TA82. Strains TA99 and TA120 are the parents of TA132. TA157 is a haploid segregant from a cross between TA99 and TA16. TA163 is derived from TA99 and is the result of transformation of TA99 with the marker swap construct,ura4Δ∷his1 +, a kind gift of P. Fantes (Edinburgh University, UK).GenotypeSource or referenceTA01972h −P. FantesTA02975h +P. FantesTA03ura4-D18 leu1-32 ade6-M210 h+P. FantesTA04ura4-D18 leu1-32 ade6-M216 h−P. FantesTA07ura4-D18/ura4-D18 leu1-32/leu1-32ade6-M216/ade6-M210 h+/h−TA16leu1-32 ura4-D18 ade6-M216 h90A. CohenTA82tor1∷ura4+/ tor1+ura4-D18/ura4-D18This studyleu1-32/leu1-32 ade6-M216/ade6-M210 h+/h−TA99tor1∷ura4+ leu1-32 ura4-D18 ade6-M216 h−This studyTA100leu1-32 ura4-D18 ade6-M216 h−This studyTA120tor1∷ura4+ leu1-32 ura4-D18 ade6-M210 h+This studyTA132tor1∷ura4+/ tor1∷ura4 ura4-D18/ura4-D18This studyleu1-32/leu1-32 ade6-M216/ade6-M210 h+/h−TA137tor2∷ura4+/ tor2+ura4-D18/ura4-D18This studyleu1-32/leu1-32 ade6-M216/ade6-M210 h+/h−TA157tor1∷ura4+ leu1-32 ura4-D18 ade6-216 h90This studyTA163tor1∷his1+ his1-102 ade6-M216 leu1-32 ura4-D18 h+This studya Strains TA99, TA100, and TA120 are haploid segregants of the diploid TA82. Strains TA99 and TA120 are the parents of TA132. TA157 is a haploid segregant from a cross between TA99 and TA16. TA163 is derived from TA99 and is the result of transformation of TA99 with the marker swap construct,ura4Δ∷his1 +, a kind gift of P. Fantes (Edinburgh University, UK). Open table in a new tab Cells were stained with the DNA fluorochrome propidium iodide and analyzed by a Becton Dickinson FACSort as described by (30Snaith H.A. Forsburg S.L. Genetics. 1999; 152: 839-851PubMed Google Scholar). Data were analyzed by Cell Quest software for Macintosh. A fragment containing 5.84 kbp of the C-terminal region oftor1 + gene was amplified by PCR using the Expand Long Template PCR System (Roche Molecular Biochemicals) with a genomicS. pombe DNA preparation as a template and the primers 104 (5′-TTGAAGAATCTGCAGCAATAAATATTC) and 105 (5′-AAGATTTGATCGGCATTTGGCAC). The resulting PCR fragment was subcloned into a pGEM-T vector (Promega) to give pGEMtor1. A 3.63-kbp HindIII fragment of pGEMtor1 containing the kinase and FRB-like domains was replaced with anHindIII fragment containing the entireura4 +, resulting in the plasmid ptor1::ura4. NotI and SacI were used to release the 4-kbp tor1::ura4 disruption fragment, and this was gel purified and transformed into the diploid TA07. Stable Ura4+ diploids were selected, and their DNA was extracted and subjected to PCR analysis with primers 105 and 137 (5′-TTGTAAATAGGATAGCCAGCACC), which lies 100 bp upstream of the 5′ end of the disruption construct. 0.4- and 0.5-kbp fragments containing the very 5′ and 3′ ends of thetor2 + open reading frame, respectively, were amplified by PCR, using genomic DNA as the template. The primers were: 152 (5′-ATAAGAGTCGACTCACAAGTGTTGTGAACTTGGTGG); 154 (5′-GGGGTACCGAGCTCATTCCTGCTTTTCAACCCAGG); 153 (5′-ATAAGAGTCGACAGATACGTGAAGAGGGGTGGTGAC); and 155 (5′-CGGGATCCGTTTCTGGTAGGTGACAGTCCC). The resulting 0.4- and 0.5-kbp PCR fragments were digested with KpnI andBamHI, respectively (sites are underlined in the sequence of the primers) and ligated with the 1.8-kbpkpnI-BamHI fragment containing the entireura4 + gene. The fragment containing theura4 + gene flanked bytor2 + sequences was amplified by PCR using 152 and 153 and used to transform the diploid strain TA07. The correct disruption of tor2 + was verified by PCR analysis using the primer 165 (5′-CGGGATCCCCATTTAATAGAGAAAGGGATATTAGC) that lies 32 bp upstream of the 5′ end of the disruption construct in combination with primer 135 (5′-GTTATAAACATTGGTGTTGGAACAG) that lies in theura4 + gene. The tor1 + andtor2 + gene were obtained using the Expand Long Template PCR System (Roche Molecular Biochemicals) with a genomicS. pombe DNA preparation as the template. For amplifyingtor2 + we used primers 152 (5′-ATAAGAGTCGACTCACAAGTGTTGTGAACTTGGTGG) and 153 (5′-ATAAGAGTCGACAGATACGTGAAGAGGGGTGGTGAC) (SalI sites used for subsequent cloning are underlined). For amplifyingtor1 + we used primers 141 (5′-CGGGATCCGCGGCCGCCAATGTGAATGCATATCTTTAGTCC) and 142 (5′-ACGCGTCGACTGCTCTGAAGTCAATTCCGAAGTG) (BamHI,NotI, and SalI sites used for subsequent cloning are underlined). The resulting 8.3-kbptor1 + and 8 kbp tor2 + PCR fragments were cloned into the S. pombe pIRT2 expression plasmid (31Booher R. Beach D. Mol. Cell. Biol. 1986; 6: 3523-3530Crossref PubMed Scopus (95) Google Scholar), resulting in pIRT2-tor1 + and pIRT2-tor2 +, respectively. To express tor1 + in S. cerevisiae we used pIRT2-tor1 + as a template in a PCR reaction with primers 143 (5′-CGGGATCCGTCTATCGTTTCACTCGCTCTC) (BamHI, for subsequent cloning is underlined) and primer 141. This reaction resulted in the amplification of a 7.4-kbp fragment that contains the tor1 + ORF, 30 and 300 bp upstream and downstream of the open reading frame, respectively. This fragment was cloned into the pCM190 S. cerevisiae expression vector (32Gari E. Piedrafita L. Aldea M. Herrero E. Yeast. 1997; 13: 837-848Crossref PubMed Scopus (504) Google Scholar), resulting in pCM190-tor1 +. The mutation at the conserved serine in the Tor1 FRB domain, S1843R, was created by site-directed mutagenesis by overlap extension (33Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene ( Amst. ). 1989; 77: 51-59Crossref PubMed Scopus (6833) Google Scholar). pIRT2-tor1 + served as a template in a PCR reaction with primers 145 (5′-TGCATCCTCAGGCATTGGTGTATTC) and 146 (5′-GAAAAATAAGCCTGACGAGCTTCCTCTAATC; mutations are in bold type). The resulting PCR product (220 bp) was gel purified and used as a primer for a second-round of PCR with primer 144 (5′-AATAGATCTCTCGTTGAGTCCTTCG). The resulting 1.58-kbp PCR product was cleaved with BglII and Bsu36I, whose restriction sites reside near the fragment ends. This fragment was used to replace the corresponding fragment in pIRT2-tor1 + and pCM190-tor1 +. We verified that only the desired mutation had occurred during PCR or cloning of theBglII/Bsu36I fragment by DNA sequence analysis. In addition, to further ascertain that the only defect of thetor1 S1834R resided in Ser1834, the plasmid carrying tor1 S1834R was cut withBglII/Bsu36I, and the 1.58-kbp fragment containing the site of the mutation was recovered. This fragment was used as the template in a PCR reaction performed to replace Arg1834 back with serine. The fragment containing Ser1834 was ligated back to theBglII/Bsu36I cut plasmid to reconstruct a wild type tor1 +. This tor1 +, derived from tor1 S1834R, fully restoredtor1 + function. The wild type and mutant tor1genes were amplified from the plasmids pIRT2-tor1 + and pIRT2-tor1 S1834R using the primers 141 (containing a BamHI site, see above) and 199 (ATAAGAATGCGGCCGCATGGAGTATTTTAGTGATCTAAAAAAC) (theNotI site is underlined). PCR products were digested withBamHI/NotI and cloned into theBglII/NotI sites of the thiamine-repressible vector pSLF273 (34Forsburg S.L. Sherman D.A. Gene ( Amst. ). 1997; 191: 191-195Crossref PubMed Scopus (164) Google Scholar), downstream and in frame with the plasmid sequences encoding the triple hemagglutinin (HA) epitope domain. The resulting plasmids carrying the N-terminal HA-tagged wild type and mutated proteins were transformed into a Δtor1 strain, TA163. Total protein extracts were prepared from cells growing under conditions that allow protein expression (in the absence of thiamine) following the method described by (28Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3143) Google Scholar). Aliquots of whole cell extracts containing 60 μg of protein were fractionated by SDS-polyacrylamide gels and transferred to membrane filters. The immobilized proteins were detected using the PerkinElmer Life Sciences enhanced chemiluminescence system. The HA-tagged proteins were detected with monoclonal antibody HA.11 (Berkley Antibody Co.). Polyclonal antibodies raised againstS. cerevisiae FKBP12 (a kind gift of J. Heitman, Duke University Medical Center) were used to detect the S. pombeFKBP12 proteins as an internal loading control. The DNA sequence of most of the S. pombe genome has been determined through the coordination of the Sanger Center. Based on sequence comparisons, we identified two TOR homologs in chromosome II. We named one of these, on cosmid SPBC30D10, tor1 + and the second, contained on two overlapping cosmids, SPBC216 and SPBC646,tor2 +. The open reading frames oftor1 + and tor2 + encode for 2335- and 2337-amino acid proteins, respectively. No introns are found in either of the open reading frames. The two S. pombeTOR homologs share 52% overall identity. A slightly lower level of overall identity (42–44%) is revealed when the amino acids encoded bytor1 + or tor2 + are aligned with the human TOR, the S. cerevisiae Tor1p or Tor2p, or the C. neoformans Tor1. The C-terminal regions of the S. pombe Tor1 and Tor2 proteins contain the FRB and the phosphatidylinositol kinase-like domains and are the most conserved regions of the proteins. The C-terminal regions of Tor1 and Tor2, residues 1814–2171 and 1817–2174, respectively, show 64–65% identity with the corresponding amino acids of other TOR homologs in the data bases. Amino acid comparisons of these C-terminal regions indicate that both Tor1 and Tor2 in S. pombe contain the conserved structural features that characterize the TOR family of proteins. This includes the conserved serine at position 1834 or 1837 in Tor1 or Tor2, respectively (Fig.1). As a first step toward understanding the physiological function(s) of the TORs inS. pombe, we disrupted the chromosomal copies oftor1 + or tor2 + by one-step gene replacement (“Experimental Procedures”). Fig.2 shows a tetrad analysis of a heterozygous diploid strain (TA137) in which one of the copies oftor2 + was replaced with the selective markerura4 +. A total of 25 tetrads were dissected, and all yielded only two or one viable spores, none of which cosegregated with the ura4 + marker, indicating that thetor2 disruption was lethal. Microscopic examination revealed that in the nonviable segregants, the spores produced single cells that did not undergo cell divisions (data not shown). This lethal phenotype was rescued by reintroduction of tor2 +. Strain TA137 transformed with plasmid pIRT2-tor2 +(tor2 + expressed under the regulation of its endogenous promoter) was sporulated and dissected. Progeny disrupted in the chromosomal copy of tor2 + were obtained, but in all cases they carried the plasmid-borne wild typetor2 + gene. We also used the ura4 + selective marker to disrupt tor1 + (“Experimental Procedures”). In contrast to tor2 disruption, sporulation of diploid heterozygous for tor1 + disruption (TA82) yielded viable Ura4+ haploids. PCR analysis confirmed that the Ura4+ haploids carried a disputed allele of tor1(data not shown). Thus, whereas tor2 + is an essential gene, tor1 + is a nonessential gene. We further analyzed two independently isolated Δtor1 haploid clones. Under optimal growth conditions, the growth rate and cell morphology ofΔtor1 cells were indistinguishable from that of wild type cells (Fig. 3 A). However, Δtor1 cells exited the logarithmic phase at a lower cell density, were abnormally long, and lost viability rapidly (Fig. 3). The loss of viability of Δtor1depends on the growth medium. Whereas Δtor1cells died when they reached saturation in rich medium, they maintained viability comparable with wild type cells when grown to saturation in minimal medium (Fig. 3 B). This suggests thatΔtor1 cells are defective in the response to particular sets of conditions rather than in the actual cellular processes that allow cells to acquire the stationary phase physiology. We also noted that Δtor1 cells failed to cross with wild type strains. Microscopic examination suggested a defect at an early stage of sexual development, before conjugation had occurred. Media limiting for either nitrogen or carbon sources are conventionally used for a quantitative analysis of conjugation (mating). Under these conditions, haploid cells of the opposite mating types can conjugate to form a diploid zygote, which rapidly undergoes meiosis and sporulation and produces an ascus (reviewed in Ref. 26Davey J. Yeast. 1998; 14: 1529-1566Crossref PubMed Scopus (84) Google Scholar). Under either nitrogen or carbon starvation, ∼60% of wild type cells underwent mating compared with less than 1% of Δtor1 cells. The sterile phenotype of Δtor1 was efficiently suppressed when we reintroducedtor1 + (Fig.4 A). Nitrogen or carbon starvation is also a signal for diploid cells to enter meiosis (reviewed in Ref. 26Davey J. Yeast. 1998; 14: 1529-1566Crossref PubMed Scopus (84) Google Scholar). Under these conditions most of the wild type diploid cells, >60%, underwent sporulation, whereas <1% of homozygous Δtor1 diploids sporulated (results not shown). Thus, in addition to its role in mating,tor1 + is also required for meiosis/sporulation. Analysis of the DNA content of growing and starved Δtor1cells also indicates that these cells are defective in their response to starvation. In the absence of a mating partner, starved S. pombe cells become arrested in either G1 or G2, depending on the growth medium; nitrogen starvation arrests cells mainly at the G1 phase, and carbon starvation arrests cells mainly at the G2 phase (35Costello G.F. Rodegers L. Beach D. Curr. Genet. 1986; 11: 119-125Crossref Scopus (146) Google Scholar). The DNA profile of Δtor1 cells under optimal growth conditions shows a major 2n DNA peak, characteristic of growing wild type cells (see Refs. 36Moreno S. Nurse P. Nature. 1994; 367: 236-242Crossref PubMed Scopus (303) Google Scholar and 37Takeda T. Toda T. Kominami K. Kohnosu A. Yanagida M. Jones N. EMBO J. 1995; 14: 6193-6208Crossref PubMed Scopus (229) Google Scholar and Fig. 4 B). However, under nitrogen starvation, Δtor1 cells show an abnormal DNA profile as cells failed to arrest in G1 (Fig. 4 B). Because G1 arrest is a prerequisite for mating, the failure of Δtor1 cells to arrest their growth in G1 may be associated with their inability to undergo sexual development. We noted that the phenotype of Δtor1 cells was particularly similar to that of cells disrupted for atf1 +, a gene that encodes a bZIP (basic leucine zipper) transcription factor (37Takeda T. Toda T. Kominami K. Kohnosu A. Yanagida M. Jones N. EMBO J. 1995; 14: 6193-6208Crossref PubMed Scopus (229) Google Scholar). Under starvation conditions, both Δtor1 and Δatf1 cannot arrest in G1, exhibit an abnormal elongated morphology, lose viability in rich but not minimal medium, and are sterile.atf1 + has also been implicated in regulating the cellular response to a variety of stress conditions, such as cold, osmotic stress, and oxidative stress (37Takeda T. Toda T. Kominami K. Kohnosu A. Yanagida M. Jones N. EMBO J. 1995; 14: 6193-6208Crossref PubMed Scopus (229) Google Scholar, 38Shiozaki K. Russell P. Genes Dev. 1996; 10: 2276-2288Crossref PubMed Scopus (365) Google Scholar, 39Wilkinson M.G. Samuels M. Takeda T. Toone W.M. Shieh J.C. Toda T. Millar J.B. Jones N. Genes Dev. 1996; 10: 2289-2301Crossref PubMed Scopus (312) Google Scholar). We found thattor1 + is also required under these stress conditions; unlike wild type cells, Δtor1 could not form colonies on medium containing 0.5 m NaCl or 1 mKCl (Fig. 4 C) or on medium containing 5 mmH2O2 (Fig. 4 D) or below 20 °C (results not shown). Taken together, our findings reveal a striking similarity between the phenotypes of Δtor1 and Δatf1 cells. It remains to be determined whethertor1 + and atf1 + are involved in the same signaling pathway. We previously reported that rapamycin specifically inhibits sexual development in S. pombe (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar). As indicated above, Δtor1 cells are unable to undergo sexual development. Because rapamycin is known to inhibit the TOR proteins in mammals, S. cerevisiae, and C. neoformans, we considered the possibility that rapamycin exerts its effect by inhibiting the function of the S. pombe Tor1 during sexual development. A conserved serine residue in TORs has been identified as the site for missense mutations (serine substituted with arginine, isoleucine, or glutamic acid) conferring dominant rapamycin resistance (see the Introduction). We mutated the equivalent serine residue inS. pombe Tor1, Ser1834, into arginine (“Experimental Procedures”). The tor1 +and tor1 S1834Rgenes, cloned into the S. pombe expression vector pIRT2 (“Experimental Procedures”) were transformed into Δtor1 strains TA99 or TA157. TA99 and TA157 are isogenic except that TA157 is a homothallic strain (cells can switch their mating types between h + andh − every other generation), whereas TA99 is a heterothallic strain composed of h− cells only. Surprisingly, we found that the mutation at Ser1834diminished the activity of Tor1; the mating efficiency was extremely low when TA157 cells carrying tor1 S1834R were induced to undergo mating (0.9%, Fig.5 A). In crosses between wild type and Δtor1 cells (TA99) carryingtor1 S1834R, we observed that the wild type cells partially suppressed the sterility of Δtor1 cells carryingtor1 S1834R (Fig. 5 A). The mutation S1834R also diminished the activity of Tor1 under osmotic stress conditions (Fig. 5 C) or in acquisition of stationary phase physiology (data not shown). Because mating is very inefficient intor1 S1834R mutants, it was no surprise that this mutated allele did not confer dominant resistance to rapamycin in wild type TA16 transformants (Fig. 5 B). Our finding that Ser1834 is critical for the function of Tor1 is surprising given that equivalent mutations did not affect TOR function in S. cerevisiae. To ascertain that the only defect of the tor1 S1834R resided in S1834, the plasmid carrying tor1 S1834R was used as the template in a PCR reaction performed to replace Arg1834 back with serine (see “Experimental Procedures”). Thistor1 +, derived fromtor1 S1834R, fully restoredtor1 +, demonstrating thattor1 S1834R carries no mutations other than S1834R. We also examined whether the mutation at S1834 affected protein stability. To this aim, the wild type and mutated Tor1 proteins were tagged with the HA epitope (see “Experimental Procedures”). Analysis of Δtor1 cells expressing these proteins demonstrated that the HA tagging did not affect the activity of the proteins in vivo (data not shown). Western blot analysis using antibody raised against the HA epitope demonstrated that the level of Tor1 and Tor1S1834R are comparable (Fig.6). Therefore, we conclude that the S1834R mutation did not affect protein stability in vivo, but rather the S1834 residue is required for the function of Tor1 under starvation or osmotic stress conditions. Because the S. pombe tor1 + shows a significant level of homology with the S. cerevisiae TOR genes (about 43% identity), we examined the functions of the S. pombe tor1 + and tor1 S1834R inS. cerevisiae. Plasmids carryingtor1 + or tor1 S1834R, expressed under the control of the S. cerevisiae ADH1promoter, were introduced into wild type S. cerevisiaecells. Fig. 7 shows thattor1 S1834R but not tor1 +conferred dominant rapamycin resistance in S. cerevisiae. This is similar to the effect of equivalent point mutations in theS. cerevisiae TOR proteins (3Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (256) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar, 19Lorenz M.C. Heitman J. J. Biol. Chem. 1995; 270: 27531-27537Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar), except thattor1 S1834R did not confer rapamycin resistance at a high concentration of rapamycin (100 ng/ml, results not shown). The dominant resistance exhibited by the S. pombe tor1 S1834R indicates that the S. pombe TOR homolog can complement the function of the S. cerevisiaeTORs. It also implies that the conserved serine intor1 + is critical for the binding of FKBP12-rapamycin when expressed in S. cerevisiae cells. In conclusion, it appears that although S1834 is required for Tor1 function in S. pombe, it is not required for the rapamycin-sensitive TOR function of S. cerevisiae. We report here the identification and initial characterization of the S. pombe homologs of the TOR genes. We found theS. pombe tor2 + gene is essential for growth, whereas tor1 + is required only under starvation, osmotic stress, and oxidative stress. The inability of Δtor1 cells to respond appropriately to starvation conditions may suggest that the S. pombe tor1 +, like its S. cerevisiae TOR homologs (2Cardenas M.E. Cruz M.C. Del Poeta M. Chung N. Perfect J.R. Heitman J. Clin. Microbiol. Rev. 1999; 12: 583-611Crossref PubMed Google Scholar, 40Cutler N.S. Heitman J. Cardenas M.E. Mol. Cell. Endocrinol. 1999; 155: 135-142Crossref PubMed Scopus (81) Google Scholar), participates in signal transduction pathways that are involved in nutrient sensing. However, there are significant differences between the functions of the S. cerevisiae and S. pombeTORs. First, the S. pombe tor1 + has a positive role in the sexual development pathway and entry into stationary phase, whereas the activity of the S. cerevisiae TORs is required to repress meiosis (41Zheng X.F. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3070-3075Crossref PubMed Scopus (54) Google Scholar) and entry into stationary phase (6Barbet N.C. Schneider U. Helliwell S.B. Stansfield I. Tuite M.F. Hall M.N. Mol. Biol. Cell. 1996; 7: 25-42Crossref PubMed Scopus (602) Google Scholar, 7Di Como C.J. Arndt K.T. Genes Dev. 1996; 10: 1904-1916Crossref PubMed Scopus (440) Google Scholar, 8Zaragoza D. Ghavidel A. Heitman J. Schultz M.C. Mol. Cell. Biol. 1998; 18: 4463-4470Crossref PubMed Scopus (184) Google Scholar, 9Beck T. Hall M.N. Nature. 1999; 402: 689-692Crossref PubMed Scopus (799) Google Scholar, 10Schmidt A. Beck T. Koller A. Kunz J. Hall M.N. EMBO J. 1998; 17: 6924-6931Crossref PubMed Scopus (263) Google Scholar, 42Hardwick J.S. Kuruvilla F.G. Tong J.K. Shamji A.F. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14866-14870Crossref PubMed Scopus (466) Google Scholar). Second, the S. pombe tor1 + is required for the appropriate response to a variety of stress conditions, whereas there is no evidence that the S. cerevisiae TOR homologs are involved in the response to stresses other than starvation. Third, each of the two S. pombe TOR homologs carries out a distinct function that is not shared by the other homolog. In contrast, theS. cerevisiae TOR1 is a nonessential gene, and its function in regulating growth in response to nutrient availability is shared with TOR2 (3Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (256) Google Scholar, 4Kunz J. Henriquez R. Schneider U. Deuter-Reinhard M. Movva N.R. Hall M.N. Cell. 1993; 73: 585-596Abstract Full Text PDF PubMed Scopus (728) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar). Mutational analysis of tor1 + revealed that the conserved serine residue within the FRB domain of Tor1 plays a critical role in the protein cellular function. Thus, although the mutation at Ser1834 did not affect the level of protein expression (Fig. 6), tor1 S1834R can only partially complement the defects observed in Δtor1 cells (Fig. 5). Although Ser1834 is required for Tor1 function, its equivalent serine residues in the S. cerevisiae TOR proteins (3Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (256) Google Scholar, 5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar, 18Helliwell S.B. Wagner P. Kunz J. Deuter-Reinhard M. Henriquez R. Hall M.N. Mol. Biol. Cell. 1994; 5: 105-118Crossref PubMed Scopus (317) Google Scholar) and possibly the human TOR protein (22Brown E.J. Beal P.A. Keith C.T. Chen J. Shin T.B. Schreiber S.L. Nature. 1995; 377: 441-446Crossref PubMed Scopus (618) Google Scholar, 23Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.T. Science. 1997; 277: 99-101Crossref PubMed Scopus (809) Google Scholar, 24Hara K. Yonezawa K. Kozlowski M.T. Sugimoto T. Andrabi K. Weng Q.P. Kasuga M. Nishimoto I. Avruch J. J. Biol. Chem. 1997; 272: 26457-26463Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar) do not appear to play an essential role in the studied functions of the proteins. However, given the conserved nature of this serine residue, its role in other TOR homologs may become evident under yet unidentified conditions. None of the functions of the S. pombe TORs described in this work appear to be inhibited by rapamycin. Rapamycin specifically inhibits sexual development in S. pombe, at an early stage, before mating (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar). Cells disrupted for tor1 +are deficient in their ability to undergo mating. However, the effects of Tor1 and rapamycin on sexual development appear to be unrelated. The inability of Δtor1 cells to enter sexual development seems to be part of a general defect in responding to nutritional deprivation. Thus, Δtor1 cells fail to enter stationary phase, arrest in G1 in response to starvation, or undergo meiosis/sporulation. In contrast, rapamycin specifically inhibits the sexual development pathway and does not interfere with other responses to starvation. Thus, cells treated with rapamycin can enter stationary phase properly, are only slightly defective in meiosis/sporulation (27Weisman R. Choder M. Koltin Y. J Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar), and can arrest their growth in G1 under starvation conditions. 2R. Weisman and M. Choder, unpublished results. Our finding thattor1 S1834R could not alleviate the inhibitory effect of rapamycin on sexual development (Fig. 5 B) is consistent with our suggestion that rapamycin does not exert its effect in S. pombe by forming a toxic FKBP12-rapamycin complex that inhibits the Tor1 function. If neither Tor1 nor Tor2 is the protein target for rapamycin, than what is the target for the action of rapamycin in S. pombe? Recent findings in our lab show that cells disrupted for the S. pombe FKBP12 homolog exhibit a phenotype highly similar to treatment with rapamycin. Thus, it is most probable that rapamycin inhibits sexual development by inhibiting the cellular function of FKBP12 in sexual development 3R. Weisman, S. Finkelshtein, and M. Choder, manuscript in preparation. and not by inhibiting TOR-related function. Why rapamycin does not inhibit neither the function of Tor1 or Tor2? Our functional analysis of tor1 + andtor1 S1834R in S. cerevisiae cells (Fig. 5 A) suggests that Tor1 can bind the FKBP12-rapamycin complex, at least in S. cerevisiae cells. It is possible that Tor1 interacts with FKBP12-rapamycin complexes in S. pombe, but this interaction does not inhibit the studied functions of Tor1 or Tor2. By analogy, the function of the S. cerevisiae Tor2p in the control of the actin cytoskeleton organization is not inhibited by rapamycin (5Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (246) Google Scholar). The features of S. pombe TOR proteins, together with other studies of TOR functions, indicate that these proteins are involved in many distinct cellular functions. Given that the C-terminal region containing the FRB and the kinase domains of the TORs is highly conserved, the differences between the TORs might reside in the less conserved N-terminal region. This is an intriguing possibility yet to be explored. We thank J. Heitman for S. cerevisiae strains and antibodies against S. cerevisiaeFKBP12. We thank M. Varon for helpful comments on the manuscript.

Referência(s)