Portal de Periódicos da CAPES

Membrane Topology of the Xenobiotic-exporting Subunit, MexB, of the MexA,B-OprM Extrusion Pump in Pseudomonas aeruginosa

1999; Elsevier BV; Volume: 274; Issue: 15 Linguagem: Inglês

10.1074/jbc.274.15.10517

1083-351X

Lan Guan, Michael Ehrmann, Hiroshi Yoneyama, Taiji Nakae,

Antibiotic Resistance in Bacteria

The MexA,B-OprM efflux pump assembly ofPseudomonas aeruginosa consists of two inner membrane proteins and one outer membrane protein. The cytoplasmic membrane protein, MexB, appears to function as the xenobiotic-exporting subunit, whereas the MexA and OprM proteins are supposed to function as the membrane fusion protein and the outer membrane channel protein, respectively. Computer-aided hydropathy analyses of MexB predicted the presence of up to 17 potential transmembrane segments. To verify the prediction, we analyzed the membrane topology of MexB using the alkaline phosphatase gene fusion method. We obtained the following unique characteristics. MexB bears 12 membrane spanning segments leaving both the amino and carboxyl termini in the cytoplasmic side of the inner membrane. Both the first and fourth periplasmic loops had very long hydrophilic domains containing 311 and 314 amino acid residues, respectively. This fact suggests that these loops may interact with other pump subunits, such as the membrane fusion protein MexA and the outer membrane protein OprM. Alignment of the amino- and the carboxyl-terminal halves of MexB showed a 30% homology and transmembrane segments 1, 2, 3, 4, 5, and 6 could be overlaid with the segments 7, 8, 9, 10, 11, and 12, respectively. This result suggested that the MexB has a 2-fold repeat that strengthen the experimentally determined topology model. This paper reports the structure of the pump subunit, MexB, of the MexA,B-OprM efflux pump assembly. This is the first time to verify the topology of the resistant-nodulation-division efflux pump protein. The MexA,B-OprM efflux pump assembly ofPseudomonas aeruginosa consists of two inner membrane proteins and one outer membrane protein. The cytoplasmic membrane protein, MexB, appears to function as the xenobiotic-exporting subunit, whereas the MexA and OprM proteins are supposed to function as the membrane fusion protein and the outer membrane channel protein, respectively. Computer-aided hydropathy analyses of MexB predicted the presence of up to 17 potential transmembrane segments. To verify the prediction, we analyzed the membrane topology of MexB using the alkaline phosphatase gene fusion method. We obtained the following unique characteristics. MexB bears 12 membrane spanning segments leaving both the amino and carboxyl termini in the cytoplasmic side of the inner membrane. Both the first and fourth periplasmic loops had very long hydrophilic domains containing 311 and 314 amino acid residues, respectively. This fact suggests that these loops may interact with other pump subunits, such as the membrane fusion protein MexA and the outer membrane protein OprM. Alignment of the amino- and the carboxyl-terminal halves of MexB showed a 30% homology and transmembrane segments 1, 2, 3, 4, 5, and 6 could be overlaid with the segments 7, 8, 9, 10, 11, and 12, respectively. This result suggested that the MexB has a 2-fold repeat that strengthen the experimentally determined topology model. This paper reports the structure of the pump subunit, MexB, of the MexA,B-OprM efflux pump assembly. This is the first time to verify the topology of the resistant-nodulation-division efflux pump protein. resistance nodulation division alkaline phosphatase transmembrane segment(s) polymerase chain reaction Nosocomial patients with cancer, transplantation, burn, cystic fibrosis, etc. are easily infected by bacteria with low virulence. Among those opportunistic pathogens, Pseudomonas aeruginosais particularly problematic, since the bacteria show resistance to many structurally and functionally diverse antibiotics (1Brown M.R.W. Brown M.R.W. Resistance of Pseudomonas aeruginosa. John Wiley and Sons, London1975: 71-107Google Scholar). Recent studies have revealed that this type of resistance is attributable to a synergy of low outer membrane permeability and active drug extrusion (2Nakae T. Yoshihara E. Yoneyama H. J. Infect. Chemother. 1997; 3: 173-183Abstract Full Text PDF PubMed Scopus (21) Google Scholar). An increasing number of multidrug extrusion systems are being reported in both prokaryotes and eukaryotes (2Nakae T. Yoshihara E. Yoneyama H. J. Infect. Chemother. 1997; 3: 173-183Abstract Full Text PDF PubMed Scopus (21) Google Scholar, 3Rella M. Haas D. Antimicrob. Agents Chemother. 1982; 22: 242-249Crossref PubMed Scopus (114) Google Scholar, 4Lei Y. Sato K. Nakae T. Biochem. Biophys. Res. Commun. 1991; 178: 1043-1048Crossref PubMed Scopus (31) Google Scholar, 5Hirai K. Suzue S. Irikura T. Iyobe S. Mitsuhashi S. Antimicrob. Agents Chemother. 1987; 31: 582-586Crossref PubMed Scopus (142) Google Scholar, 6Fukuda H. Hosaka M. Hirai K. Iyobe S. Antimicrob. Agents Chemother. 1990; 34: 1757-1761Crossref PubMed Scopus (109) Google Scholar, 7Ramos J.L. Duque E. Godoy P. Segura A. J. Bacteriol. 1998; 180: 3323-3329Crossref PubMed Google Scholar, 8Goldstein L.J. Galski H. Fojo A. Willingham M. Lai S.L. Gazdar A. Priker R. Green A. Crist W. Brodeur G.M. J. Natl. Cancer Inst. 1989; 81: 116-124Crossref PubMed Scopus (1230) Google Scholar). It is likely, therefore, that active extrusion systems play a crucial role in the cellular defense mechanism against incoming noxious compounds in many living organisms. It is of great interest and importance, therefore, to analyze the mechanism by which such universally occurring extrusion pump function. The wild-type P. aeruginosa expresses a low level of the MexA,B-OprM drug extrusion machinery (9Poole K. Krebes K. McNally C. Neshat S. J. Bacteriol. 1993; 175: 7363-7372Crossref PubMed Scopus (546) Google Scholar, 10Moreshed S.R.M. Lei Y. Yoneyama H. Nakae T. Biochem. Biophys. Res. Commun. 1995; 210: 356-362Crossref PubMed Scopus (53) Google Scholar). Mutations innalB gene cause overexpression of the mexA,B-oprMoperon rendering the bacterium more resistant than the wild-type strain to a broad spectrum of antibiotics (3Rella M. Haas D. Antimicrob. Agents Chemother. 1982; 22: 242-249Crossref PubMed Scopus (114) Google Scholar). Deletion of the coding region of the wild-type mexA, mexB, or oprMrenders the mutant more susceptible than the wild-type strain to many antibiotics (9Poole K. Krebes K. McNally C. Neshat S. J. Bacteriol. 1993; 175: 7363-7372Crossref PubMed Scopus (546) Google Scholar, 11Yoneyama H. Ocaktan A. Tsuda M. Nakae T. Biochem. Biophys. Res. Commun. 1997; 233: 611-618Crossref PubMed Scopus (78) Google Scholar). Thus, it is apparent that the MexA,B-OprM machinery is involved in the both basal and elevated levels of intrinsic antibiotic resistance in P. aeruginosa. The MexA,B-OprM pump consists of three subunits, MexA, MexB, and OprM, located at the inner and outer membrane, respectively (9Poole K. Krebes K. McNally C. Neshat S. J. Bacteriol. 1993; 175: 7363-7372Crossref PubMed Scopus (546) Google Scholar, 10Moreshed S.R.M. Lei Y. Yoneyama H. Nakae T. Biochem. Biophys. Res. Commun. 1995; 210: 356-362Crossref PubMed Scopus (53) Google Scholar). MexB consists of 1046 amino acid residues and is assumed to extrude the xenobiotics utilizing the proton motive force as the energy source (4Lei Y. Sato K. Nakae T. Biochem. Biophys. Res. Commun. 1991; 178: 1043-1048Crossref PubMed Scopus (31) Google Scholar,12Ocaktan A. Yoneyama H. Nakae T. J. Biol. Chem. 1997; 272: 21964-21969Crossref PubMed Scopus (83) Google Scholar). This protein belongs to the resistant/nodulation/division (RND)1 family (13Paulsen I.T. Brown M.H. Skurray R.A. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar, 14Dong Q. Mergeay M. Mol. Microbiol. 1994; 14: 185-187Crossref PubMed Scopus (29) Google Scholar). MexA is an inner membrane-associated lipoprotein belonging to the membrane fusion protein family. OprM is an outer membrane protein probably forming the xenobiotics exit channel. A complex formation by these three subunit proteins has been suggested for many efflux pump assemblies in Gram-negative bacteria (13Paulsen I.T. Brown M.H. Skurray R.A. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar, 15Dinh T. Paulsen I.T. Saier Jr., M.H. J. Bacteriol. 1994; 176: 3825-3831Crossref PubMed Google Scholar, 16Nikaido H. Science. 1994; 264: 382-388Crossref PubMed Scopus (1231) Google Scholar, 17Ma D. Cook D.N. Hearst J.E. Nikaido H. Trends Microbiol. 1994; 2: 489-493Abstract Full Text PDF PubMed Scopus (243) Google Scholar). In fact, the functional coupling of the RND protein and the membrane fusion protein was recently demonstrated by the subunit exchange experiments using three efflux pump systems in P. aeruginosa (18Srikumar R. Li X. Poole K. J. Bacteriol. 1997; 179: 7875-7881Crossref PubMed Scopus (103) Google Scholar, 19Gotoh N. Tsujimoto H. Nomura A. Okamoto K. Tsuda M. Nishino T. FEMS Microbiol. Lett. 1998; 165: 21-27Crossref PubMed Google Scholar, 20Yoneyama H. Ocaktan A. Gotoh N. Nishino T. Nakae T. Biochem. Biophys. Res. Commun. 1998; 244: 898-902Crossref PubMed Scopus (57) Google Scholar, 21Köhler T. Michéa-Hamzehpour M. Henze U. Gotoh N. Curty L.K. Pechère J.-C. Mol. Microbiol. 1997; 23: 345-354Crossref PubMed Scopus (419) Google Scholar), while the outer membrane components could be substituted with other proteins having a similar function. However, the precise molecular mechanism of substrate recognition and efflux through these pumps remained to be clarified. For a better understanding of how this pump extrudes the xenobiotics, it is essential to elucidate the structure and membrane topology of the individual pump subunit. The membrane topology of several RND family proteins was suggested to have 12 transmembrane domains and two large hydrophilic domains (13Paulsen I.T. Brown M.H. Skurray R.A. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar,22Saier Jr., M.H. Tam R. Reizer A. Reizer J. Mol. Microbiol. 1994; 11: 841-847Crossref PubMed Scopus (266) Google Scholar). Hydropathy analysis of MexB by the TOP-PRED II 1.1 software packages (23von Heijne G. J. Mol. Biol. 1992; 225: 487-494Crossref PubMed Scopus (1395) Google Scholar) suggested that it might have 12 certain and 5 putative transmembrane segments (TMS). Some other software predicted the presence of 11 TMS. The topology of cytoplasmic membrane proteins in Gram-negative bacteria was often studied by the phoA gene fusion method. Alkaline phosphatase (AP) is enzymatically active after translocation to the periplasm, but is inactive when localized cytoplasmically (24Manoil C. Beckwith J. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8129-8133Crossref PubMed Scopus (655) Google Scholar, 25Manoil C. Mekalanos J.J. Beckwith J. J. Bacteriol. 1990; 172: 515-518Crossref PubMed Google Scholar). Several tools, including TnphoA, TnTAP, pPHO7, and pBADphoA (24Manoil C. Beckwith J. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8129-8133Crossref PubMed Scopus (655) Google Scholar, 26Ehrmann M. Bolek P. Mondigler M. Boyd D. Lange R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13111-13115Crossref PubMed Scopus (42) Google Scholar, 27Gutierrez C. Devedjian J. Nucleic Acids Res. 1989; 17: 3999Crossref PubMed Scopus (75) Google Scholar), have been developed to construct thephoA fusion to the target protein. Although transposon-mediated generation of gene fusion is simple, insertion of the reporter gene at a specific target site can be tedious. This difficulty is even more pronounced if a target protein has short extramembranous loops. An alternative method is cloning of PCR products to the 5′-end of the signal sequenceless phoA gene (28Boyd D. Traxler B. Beckwich J. J. Bacteriol. 1993; 175: 553-556Crossref PubMed Google Scholar). Using these two methods, we analyzed the topology of MexB. This paper reports the two-dimensional transmembrane structure of MexB. The Escherichia colistrains used were LMG194 [F− Δara714 leu::Tn10 ΔlacX74 ΔphoA(PvuII) galE galK thi rpsL] (29Guzman L.-M. Belin D. Carson M.J. Bechwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3886) Google Scholar) and CC118 (araD139 Δ(ara, leu)7697 ΔlacX74 ΔphoA20 galE galK thi rpsE rpoB argE am recA1) (24Manoil C. Beckwith J. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8129-8133Crossref PubMed Scopus (655) Google Scholar). The plasmid pBADphoA is a cloning vector containing a signal sequenceless phoA with a KpnI cloning site just in front of phoA. The construction of pBADphoAfrom pSWFII (30Ehrmann M. Boyd D. Beckwich J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7574-7578Crossref PubMed Scopus (114) Google Scholar) and pBAD22 (29Guzman L.-M. Belin D. Carson M.J. Bechwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3886) Google Scholar) will be described elsewhere. The transposon delivery plasmid pMM1 carries a mini-transposon TnTAP and Tn5 transposase (26Ehrmann M. Bolek P. Mondigler M. Boyd D. Lange R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13111-13115Crossref PubMed Scopus (42) Google Scholar). TnTAP contains a stretch of sequence coding for 24 amino acid residues, LTLIHKF ENLYFQSAAAMDPRVPC, including a tobacco etch virus protease cleavage site (underlined), signal sequencelessphoA, and neo. The Tn5 transposase is expressedin trans. The plasmid pMEXB1 was constructed by cloning a 3.9-kilobase SalI fragment containing the wild-type mexB to the shuttle vector pMMB67EH (20Yoneyama H. Ocaktan A. Gotoh N. Nishino T. Nakae T. Biochem. Biophys. Res. Commun. 1998; 244: 898-902Crossref PubMed Scopus (57) Google Scholar). Fusions of the truncated mexB to phoA, encoding for signal sequenceless AP, were carried out by inserting the PCR fragments ofmexB into the 5′-end of the signal sequencelessphoA in pBADphoA. Eleven out of 15 fusions were constructed by cloning the PCR fragments containing flankingKpnI restriction sites into pBADphoA cleaved withKpnI. The PCR primer used for the 5′-end of themexB gene was cccggtaccgTCGAAGTTTTTCATTGATAGG. The 3′-end primers designed for the immediately downstream of the codons Gln34, Glu346, Leu366, Thr392, Gly440, Thr473, Arg538, Gln871, Pro897, Ser921, and Cys972 were aggatggtacCTGGTTGACCGGCAGACTGAG (Gln34), cgcgcggtacCTCGCCGAGGGTCTTCACTAC (Glu346), gccgcggtacCAGCGTGGCGCGGAAG (Leu366), cgcggtacCGTGTTGATCGAGAAGCC (Thr392), ggcgcggtacCCCCTGGATCTGGCCCATGGA (Gly440), cgcgcggtacCGTGATGGAGAACTGCCGGTAGAT (Thr473), cgcggtacCCGATGCTTGAGGATCGAC (Arg538), ccggcggtacCTGCGAGCCGGACAAGC (Gln871), cgcggtacCGGAATCGACCAGCTTTCGTACAG (Pro897), cccccggtacCGACAGGCCGCGCATGGACGTCG (Ser921), and ccatcggtacCGGCCGCAGACGCAT (Pro972), respectively. For the fusion of phoA to codons Gly1007 and Gln1046, we designed the primers allowing in-frame blunt-end ligation, because there are two KpnI sites in this part of mexB. The PCR fragments purified from agarose gel and blunted with the T4 DNA polymerase were ligated to the pBADphoA cleaved by KpnI and blunted with T4 DNA polymerase. The primer used for the 5′-end of the mexB gene was TCGAAGTTTTTCATTGATAGGCCC. Two 3′-end primers used to generatephoA fusions downstream of the codons Gly1007and Gln1046 were cGCCGATCACGCCGGTACCGAT (Gly1007) and aTTGCCCCTTTTCGACGGACGCCTGC (Gln1046), respectively. For fusion pBAD-P9, two oligonucleotides containing the KpnI sites at the both ends were annealed and ligated directly to the pBADphoA cleaved with KpnI. The oligonucleotides for coding and noncoding strands were CGTCGAAGTTTTTCATTGATAGGCCGGTAC and CGGCCTATCAATGAAAAACTTCGACGGTAC, respectively. The host cells used for analysis of AP activity was E. coli LMG194. For most fusion plasmids, codons for valine and proline residues were introduced at the 5′- and 3′-ends of the mexB fragments to introduce theKpnI sites. To obtain in-frame fusions of TnTAP to mexB, the pMM1 containing TnTAP was transformed into the strain E. coli CC118 carrying pMEXB1, which encodes the wild-type mexB. After transposition during overnight growth, a pool of plasmid DNA was isolated and digested with NheI to destroy pMM1, but not pMEXB1 and TnTAP. The restriction digests were transformed again into strain CC118. Blue colonies on agar plates containing 40 μg/ml 5-bromo-4-chloro-3-indolyl phosphate, 200 μg/ml ampicillin (for pMEXB1), and 100 μg/ml kanamycin were purified. Insertions intomexB were identified by PCR. The nucleotide sequence was determined using the ABI PRISMTM Dye Terminator Cycle Sequencing Core Kit with ampliTaq® DNA polymerase, FS. The sequencing primer used was GCAGTAATATCGCCCTGAGCAGC, reading out of the phoA gene toward the mexB gene. In addition, a primer GCGTCACACTTTGCTATGCC reading out of the pBADphoA vector toward themexB gene was also used. AP activity was assayed by measuring the rate of hydrolysis of p-nitrophenyl phosphate in permeabilized cells as described elsewhere (31Michaelis S. Inouye H. Oliver D. Beckwith J. J. Bacteriol. 1983; 154: 366-374Crossref PubMed Google Scholar). One unit of AP activity corresponds to the rate of p-nitrophenyl phosphate hydrolysis, 1 μmol of p-nitrophenyl phosphate/min/mg of protein at 23 °C. For the Western blot analysis of the hybrid proteins, the crude envelope fraction and whole cell lysate were prepared as described elsewhere (10Moreshed S.R.M. Lei Y. Yoneyama H. Nakae T. Biochem. Biophys. Res. Commun. 1995; 210: 356-362Crossref PubMed Scopus (53) Google Scholar). SDS-polyacrylamide gel electrophoresis (10%) and Western blotting were carried out as described previously (32Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205531) Google Scholar). The monoclonal antibody raised against AP was used to probe the hybrid proteins. Boiling the MexB protein in SDS caused disappearance of the protein band from the gel. To analyze the membrane topology of the MexB protein, we took the 12-TMS model for our working hypothesis and designed the experiments accordingly (Fig.1). We constructed 25 clones expressing COOH-terminal-truncated MexB-AP hybrids and one clone (pBAD-Q1046) expressing phoA at the COOH-terminal end of full-length MexB using pBADphoA and TnTAP (TableI). Cells harboring the pBAD-P9, pBAD-L366, pBAD-V411, pBAD-G440, pBAD-R538, pBAD-P897, pBAD-P972, and pBAD-Q1046 plasmids yielded pale blue colonies, suggesting that the AP domain is located in the cytoplasmic side of the inner membrane. The fusion pBAD-V411 was obtained accidentally in the course of pBAD-Q1046 construction. The remaining mexB-phoA fusions exhibited blue colonies on the 5-bromo-4-chloro-3-indolyl phosphate plates suggesting that the AP domain is translocated to the periplasm. The fusion joints were confirmed by nucleotide sequencing and all reading frames were correct (Tables II andIII). The distribution of a total of 26 fusion sites covered the entire MexB protein, and each hydrophobic segment was flanked by phoA fusions (Fig. 1).Table IStrain, plasmid, and the method for construction of the fusionStrainFusion plasmidaAP was fused to the numbered amino acid residues.Method of constructionTNE040pBADphoATNE041pBAD-P9OligbOligonucleotide annealing method.TNE042pBAD-Q34PCRTNE043pBAD-E346PCRTNE044pBAD-L366PCRTNE045pBAD-T392PCRTNE046pBAD-V411PCRTNE047pBAD-G440PCRTNE048pBAD-T473PCRTNE049pBAD-R538PCRTNE050pBAD-Q871PCRTNE051pBAD-P897PCRTNE052pBAD-S921PCRTNE053pBAD-P972PCRTNE054pBAD-G1007PCRTNE055pBAD-Q1046PCRTNE056pMEXB1TNE057pMEXB-D59TAPTnTAPTNE058pMEXB-T89TAPTnTAPTNE059pMEXB-V105TAPTnTAPTNE060pMEXB-R124TAPTnTAPTNE061pMEXB-I214TAPTnTAPTNE062pMEXB-G271TAPTnTAPTNE063pMEXB-T309TAPTnTAPTNE064pMEXB-L349TAPTnTAPTNE065pMEXB-F459TAPTnTAPTNE066pMEXB-N616TAPTnTAPTNE067pMEXB-L696TAPTnTAPa AP was fused to the numbered amino acid residues.b Oligonucleotide annealing method. Open table in a new tab Table IINucleotide sequence of the mexB-phoA fusion junction derived from pBADphoAView Large Image Figure ViewerDownload (PPT)The table shows the nucleotide sequence and the deduced amino acid sequence at the fusion junctions. Hyphens mark the fusion points. The DNA sequences of the mexB fragment amplified by PCR are indicated in bold. The lowercase letters represent the linker for theKpnI restriction sites. Underlined sections represent the original bases of mexB and these alterations did not change the amino acid sequence. Small fonts show the inserted amino acid residues. Open table in a new tab Table IIINucleotide sequence of the mexB-phoA fusion junction derived from TnTAPView Large Image Figure ViewerDownload (PPT)The table shows the nucleotide sequence and the deduced amino acid sequence at the fusion junctions. Hyphens mark the fusion points. The DNA sequence from TnTAP is shown in bold. Open table in a new tab The table shows the nucleotide sequence and the deduced amino acid sequence at the fusion junctions. Hyphens mark the fusion points. The DNA sequences of the mexB fragment amplified by PCR are indicated in bold. The lowercase letters represent the linker for theKpnI restriction sites. Underlined sections represent the original bases of mexB and these alterations did not change the amino acid sequence. Small fonts show the inserted amino acid residues. The table shows the nucleotide sequence and the deduced amino acid sequence at the fusion junctions. Hyphens mark the fusion points. The DNA sequence from TnTAP is shown in bold. We quantified the AP activities of the cells harboring the mexB-phoA fusions (Fig. 1). The AP activities in these cells harboring the fusions derived from pBADphoA were divided into two major classes. One class of cells showed about 0.2–0.4 unit of AP activity, which is close to the activity in the control cell (pBADphoA, 0.32 unit) and another showed 1.7–11 units. Fusions at Pro9, Leu366, Val411, Gly440, Arg538, Pro897, Pro972, and Gln1046belonged to the former class. Therefore, these fusion sites are most likely to be located at the cytoplasmic side (Fig. 1). The remaining fusions, including the Gln34, Glu346, Thr392, Thr473, Gln871, Ser921, and Gly1007 sites, showed high AP activities, suggesting that these sites are located at the periplasmic side (Fig. 1). All the cells harboring the mexB-phoA fusions derived from TnTAP showed an AP activity of about 1–3 units (Fig. 1), whereas the AP activity of cells containing mexB without phoA(pMEXB1) was only 0.33 unit. Based on these results, we concluded that all the fusion sites, including Asp59, Thr89, Val105, Arg124, Ile214, Gly271, Thr309, Leu349, Phe459, Asn616, and Leu696, were located at the periplasmic side (Fig. 1). The expression of hybrid proteins derived from TnTAP and pBADphoA is under the control of lac and araBAD promotor, respectively, and therefore the cells harboring the fusions were induced in the presence of 100 μmisopropyl-β-d-thiogalactopyranoside and 100 μml-arabinose, respectively. The hybrid proteins with high and low AP activities are shown in Fig.2, lanes 3–20 and lanes 21–27, respectively. The size of the hybrid proteins was within the range of the expected molecular mass. The protein band of the fusion at Pro9 was undetectable, since the hybrid protein is expected to be soluble in the cytoplasm. All the bands for cytoplasmic hybrid proteins showed weaker signals than the periplasmic hybrid proteins, which probably was attributable to the proteolytic degradation of the hybrid protein as reported earlier (33Gott P. Boos W. Mol. Microbiol. 1988; 2: 655-663Crossref PubMed Scopus (63) Google Scholar, 34Allard J.D. Bertrand K.P. J. Biol. Chem. 1992; 267: 17809-17819Abstract Full Text PDF PubMed Google Scholar). In addition, protein bands with a higher molecular mass than expected were seen as reported elsewhere (35Enomoto H. Unemoto T. Nishibuchi M. Padan E. Nakamura T. Biochim. Biophys. Acta. 1998; 1370: 77-86Crossref PubMed Scopus (20) Google Scholar). This might be explained by suggesting that the chimeric proteins maintaining the native conformation bind less SDS than fully denatured proteins in the electrophoresis buffer, because the samples were subjected to electrophoresis without heating. Fusion Gly440 appeared only in a higher molecular weight range than expected and was barely seen. Most living organisms, if not all, seem to be equipped with xenobiotics extrusion pump(s). Mammalian cells, for instance, express P-glycoproteins (8Goldstein L.J. Galski H. Fojo A. Willingham M. Lai S.L. Gazdar A. Priker R. Green A. Crist W. Brodeur G.M. J. Natl. Cancer Inst. 1989; 81: 116-124Crossref PubMed Scopus (1230) Google Scholar), multidrug resistance associated protein (36Cole S.P. Bhardwaj G. Gerlach J.H. Mackie J.E. Grant C.E. Almquist K.C. Stewart A.J. Kurz E.U. Duncan A.M. Deeley R.G. Science. 1992; 258: 1650-1654Crossref PubMed Scopus (2973) Google Scholar), and cannalicular multispecific organic anion transporter (37Fujii R. Mutoh M. Niwa K. Yamada K. Aikou T. Nakagawa M. Kuwano M. Akiyama S. Jpn. J. Can. Res. 1994; 85: 426-433Crossref PubMed Scopus (86) Google Scholar), which extrude anticancer drugs, bile acids, and others. Expression of the efflux proteins in bacteria renders the organisms resistant to many antibiotics, organic solvents, hydrophobic dyes, and surfactants. Structure of the efflux pump in Gram-negative bacteria is particularly complicated, since the outer membrane covers the inner membrane. An extrusion pump in P. aeruginosa consisted of three subunits, MexA, MexB and OprM. Among them, MexB is particularly important in the pump function, since this subunit primarily recognizes and extrudes the substrates. To analyze the two-dimensional membrane topology of MexB, we constructed 26 phoA fusions, which covered the entire MexB protein. The NH2-terminal segment before the first hydrophobic segment consists of 9 amino acid residues containing 2 positively and 1 negatively charged residues. This segment is unlikely to cross the membrane according to the positive charge inside rule (38von Heijne G.C. EMBO J. 1986; 5: 3021-3027Crossref PubMed Google Scholar). The periplasmic location of the Gln34 and Gly1007sites and the cytoplasmic location of the Pro9 and Gln1046 sites indicated that a cytoplasmic location of both the NH2- and COOH-terminal ends (Fig. 1). The hybrid protein Gln34 was detected in the crude envelope fraction (Fig. 2, lane 3) indicating that TMS1 is an uncleaved signal-anchor. The periplasmic location of the Glu346, Thr392, Thr473, Gln871, Ser921, and Gly1007 sites, and the cytoplasmic location of the Leu366, Val411, Gly440, Arg538, Pro897, and Pro972 sites verified the transmembrane nature of the TMS 2–11 (Fig. 1). Five weak hydrophobic segments suggested by the TOPRED II software (a–e, Fig. 1) did not function as transmembrane segments, because they were flanked by fusions with high AP activities (Fig. 1). These results supported our working model. Some of the computer programs for the topology prediction suggested the presence of 11 TMS in the MexB polypeptide. Our results experimentally ruled out this possibility. We carried out computer-aided alignment analysis of the amino-terminal and carboxyl-terminal halves of the polypeptide from Met1to Arg529 and Gly530 to Gln1046, respectively. Fig. 3 shows 30% homology between the first and second halves. TMS 1, 2, 3, 4, 5, and 6 of the amino-terminal half could be overlaid by TMS 7, 8, 9, 10, 11, and 12 in the carboxyl-terminal half, respectively. This 2-fold repeat suggested that mexB is evolved from an ancestral gene encoding a protein of six TMS by an intragenic duplication as predicted earlier (13Paulsen I.T. Brown M.H. Skurray R.A. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar, 22Saier Jr., M.H. Tam R. Reizer A. Reizer J. Mol. Microbiol. 1994; 11: 841-847Crossref PubMed Scopus (266) Google Scholar). This is to doubly support the transmembrane nature of the segments experimentally assigned to be the membrane-spanning domain. In addition, the distribution of positive charges in the cytoplasmic and periplasmic domains were 22 and 2, respectively, excepting the first and fourth large periplasmic domains with more than 60 amino acid residues (Fig. 1). The result was in accord with the positive inside rule (38von Heijne G.C. EMBO J. 1986; 5: 3021-3027Crossref PubMed Google Scholar). This is the first experimental verification of the transmembrane topology of the RND family extrusion pump protein. This experimentally verified model has the following features. (i) The MexB protein spans the membrane 12 times leaving amino and carboxyl termini at cytoplasmic side of the inner membrane as suggested for the RND family proteins (13Paulsen I.T. Brown M.H. Skurray R.A. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar, 22Saier Jr., M.H. Tam R. Reizer A. Reizer J. Mol. Microbiol. 1994; 11: 841-847Crossref PubMed Scopus (266) Google Scholar). (ii) MexB has two large hydrophilic segments with 311 and 314 amino acid residues from 29 to 338 (between TMS 1 and 2) and from 558 and 871 (between TMS 7 and 8), respectively. (iii) The membrane topology of MexB appeared to have a 2-fold repeat. These big loops might interact with the periplasmic subunit, MexA, and the outer membrane subunit, OprM. It is conceivable that these large loops transmit cellular energy to the OprM channel gate. In addition, we found 5 charged amino acid residues in the transmembrane domains. These charged residues were highly conserved in the RND family efflux proteins as aligned by the Clustal W multi-alignment software (data not shown). Specific localization of the highly conserved charged residues in the TMS suggested that they might play an important role in substrate binding and proton transport. Further studies are needed to elucidate the role of these amino acid residues in the mechanism of xenobiotics extrusion. We acknowledge the preliminary participation of Weil EL-Naggar in this study.