Glucose Metabolism Attenuates p53 and Puma-dependent Cell Death upon Growth Factor Deprivation
2008; Elsevier BV; Volume: 283; Issue: 52 Linguagem: Inglês
10.1074/jbc.m803580200
ISSN1083-351X
AutoresYuxing Zhao, Jonathan L. Coloff, Emily C. Ferguson, Sarah R. Jacobs, Kai Cui, Jeffrey C. Rathmell,
Tópico(s)Adipose Tissue and Metabolism
ResumoGrowth factor stimulation and oncogenic transformation lead to increased glucose metabolism that may provide resistance to cell death. We have previously demonstrated that elevated glucose metabolism characteristic of stimulated or cancerous cells can stabilize the anti-apoptotic Bcl-2 family protein Mcl-1 through inhibition of GSK-3. Here we show that the pro-apoptotic Bcl-2 family protein, Puma, is also metabolically regulated. Growth factor deprivation led to the loss of glucose uptake and induction of Puma. Maintenance of glucose uptake after growth factor withdrawal by expression of the glucose transporter, Glut1, however, suppressed Puma up-regulation and attenuated growth factor withdrawal-induced activation of Bax, DNA fragmentation, and cell death. Conversely, glucose deprivation led to Puma induction even in the presence of growth factor. This regulation of Puma expression was a central component in cell death as a consequence of growth factor or glucose deprivation because Puma deficiency suppressed both of these cell death pathways. Puma induction in growth factor or glucose withdrawal was dependent on p53 in cell lines and in activated primary T lymphocytes because p53 deficiency suppressed Puma induction and delayed Bax and caspase activation, DNA fragmentation, and loss of clonogenic survival. Importantly, although p53 levels did not change or were slightly reduced, p53 activity was suppressed by elevated glucose metabolism to inhibit Puma induction after growth factor withdrawal. These data show that p53 is metabolically regulated and that glucose metabolism initiates a signaling mechanism to inhibit p53 activation and suppress Puma induction, thus promoting an anti-apoptotic balance to Bcl-2 family protein expression that supports cell survival. Growth factor stimulation and oncogenic transformation lead to increased glucose metabolism that may provide resistance to cell death. We have previously demonstrated that elevated glucose metabolism characteristic of stimulated or cancerous cells can stabilize the anti-apoptotic Bcl-2 family protein Mcl-1 through inhibition of GSK-3. Here we show that the pro-apoptotic Bcl-2 family protein, Puma, is also metabolically regulated. Growth factor deprivation led to the loss of glucose uptake and induction of Puma. Maintenance of glucose uptake after growth factor withdrawal by expression of the glucose transporter, Glut1, however, suppressed Puma up-regulation and attenuated growth factor withdrawal-induced activation of Bax, DNA fragmentation, and cell death. Conversely, glucose deprivation led to Puma induction even in the presence of growth factor. This regulation of Puma expression was a central component in cell death as a consequence of growth factor or glucose deprivation because Puma deficiency suppressed both of these cell death pathways. Puma induction in growth factor or glucose withdrawal was dependent on p53 in cell lines and in activated primary T lymphocytes because p53 deficiency suppressed Puma induction and delayed Bax and caspase activation, DNA fragmentation, and loss of clonogenic survival. Importantly, although p53 levels did not change or were slightly reduced, p53 activity was suppressed by elevated glucose metabolism to inhibit Puma induction after growth factor withdrawal. These data show that p53 is metabolically regulated and that glucose metabolism initiates a signaling mechanism to inhibit p53 activation and suppress Puma induction, thus promoting an anti-apoptotic balance to Bcl-2 family protein expression that supports cell survival. Hematopoietic cells depend on extrinsic growth factors to maintain viability and prevent death by neglect (1Plas D.R. Rathmell J.C. Thompson C.B. Nat. Immunol. 2002; 3: 515-521Crossref PubMed Scopus (129) Google Scholar, 2Raff M.C. Nature. 1992; 356: 397-400Crossref PubMed Scopus (2488) Google Scholar). This tight regulation of cell fate by the availability of growth factors is critical for hematopoietic homeostasis. Disturbance of the balance between cell death and cell survival can lead to diseases such as autoimmunity or cancer if growth factors are in excess and immunodeficiency if growth factors or their signaling mechanisms are limiting. In addition to survival, it has become clear that growth factors play prominent roles to regulate glucose uptake and metabolism (3Gottlob K. Majewski N. Kennedy S. Kandel E. Robey R.B. Hay N. Genes Dev. 2001; 15: 1406-1418Crossref PubMed Scopus (756) Google Scholar, 4Plas D.R. Talapatra S. Edinger A.L. Rathmell J.C. Thompson C.B. J. Biol. Chem. 2001; 276: 12041-12048Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar, 5Rathmell J.C. Fox C.J. Plas D.R. Hammerman P. Cinalli R.M. Thompson C.B. Mol. Cell. Biol. 2003; 23: 7315-7328Crossref PubMed Scopus (457) Google Scholar, 6Rathmell J.C. Vander Heiden M.G. Harris M.H. Frauwirth K.A. Thompson C.B. Mol. Cell. 2000; 6: 683-692Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar, 7Vander Heiden M.G. Plas D.R. Rathmell J.C. Fox C.J. Harris M.H. B. T.C. Mol. Cell. Biol. 2001; 21: 5899-5912Crossref PubMed Scopus (426) Google Scholar). In the absence of necessary growth factors, a program of cellular atrophy is initiated that is characterized by decreased cell size, glucose uptake and metabolism, and mitochondrial potential (6Rathmell J.C. Vander Heiden M.G. Harris M.H. Frauwirth K.A. Thompson C.B. Mol. Cell. 2000; 6: 683-692Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar). These changes in glucose metabolism occur prior to commitment to cell death and may play an important role in the initiation of apoptosis. Detailed mechanisms by which glucose metabolism affects cell death pathways, however, have not been completely resolved.One key mechanism by which growth factors regulate glucose metabolism is through control of glucose uptake. In particular, glucose transporters (Gluts) 2The abbreviations used are: Glutglucose transporterHKhexokinaseILinterleukinMe-Pyrmethyl-pyruvateshRNAismall hairpin RNA interferencePIpropidium iodideERendoplasmic reticulum 2The abbreviations used are: Glutglucose transporterHKhexokinaseILinterleukinMe-Pyrmethyl-pyruvateshRNAismall hairpin RNA interferencePIpropidium iodideERendoplasmic reticulum and hexokinases (HKs) determine the first rate-limiting step of glucose metabolism. In hematopoietic cells, glucose is transported into cells through Glut1 and phosphorylated by mitochondrially bound hexokinase to become glucose-6-phosphate, which can then enter downstream pathways of glucose metabolism to generate energy as well as substrates for biosynthesis. Normally, when cells are withdrawn from growth factors, Glut1 is internalized and degraded in lysosomes, leading to decreased glucose uptake and metabolism prior to cell death (8Edinger A.L. Cinalli R.M. Thompson C.B. Dev. Cell. 2003; 5: 571-582Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 9Wieman H.L. Wofford J.A. Rathmell J.C. Mol. Biol. Cell. 2007; 18: 1437-1446Crossref PubMed Scopus (400) Google Scholar). Activated lymphocytes dramatically induce glucose uptake (10Frauwirth K.A. Riley J.L. Harris M.H. Parry R.V. Rathmell J.C. Plas D.R. Elstrom R.L. June C.H. Thompson C.B. Immunity. 2002; 16: 769-777Abstract Full Text Full Text PDF PubMed Scopus (970) Google Scholar, 11Jacobs S.R. Herman C.E. Maciver N.J. Wofford J.A. Wieman H.L. Hammen J.J. Rathmell J.C. J. Immunol. 2008; 180: 4476-4486Crossref PubMed Scopus (536) Google Scholar), and cancer cells often overexpress Glut1 and maintain glucose metabolism in the absence of growth factors (12Gatenby R.A. Gillies R.J. Nat. Rev. Cancer. 2004; 4: 891-899Crossref PubMed Scopus (3611) Google Scholar). Recently, the maintenance of glucose metabolism has been implicated in the regulation of cell survival because the loss of glucose uptake can promote activation of the pro-apoptotic protein Bax to cause cell death (5Rathmell J.C. Fox C.J. Plas D.R. Hammerman P. Cinalli R.M. Thompson C.B. Mol. Cell. Biol. 2003; 23: 7315-7328Crossref PubMed Scopus (457) Google Scholar, 7Vander Heiden M.G. Plas D.R. Rathmell J.C. Fox C.J. Harris M.H. B. T.C. Mol. Cell. Biol. 2001; 21: 5899-5912Crossref PubMed Scopus (426) Google Scholar, 13Bensaad K. Tsuruta A. Selak M.A. Vidal M.N. Nakano K. Bartrons R. Gottlieb E. Vousden K.H. Cell. 2006; 126: 107-120Abstract Full Text Full Text PDF PubMed Scopus (1471) Google Scholar, 14Chi M.M. Pingsterhaus J. Carayannopoulos M. Moley K.H. J. Biol. Chem. 2000; 275: 40252-40257Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 15Nutt L.K. Margolis S.S. Jensen M. Herman C.E. Dunphy W.G. Rathmell J.C. Kornbluth S. Cell. 2005; 123: 89-103Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Conversely, increased glucose metabolism or maintenance of glucose metabolism after growth factor withdrawal by expression of Glut1 alone or with HK1 was found to initiate a nutrient-dependent signaling pathway that phosphorylated and inactivated GSK-3 to protect cells from apoptosis (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar). The full mechanisms by which glucose metabolism may regulate cell death, however, are not certain.Bcl-2 family members are key regulators of apoptosis upon growth factor withdrawal, and anti-apoptotic glucose signaling may act through these proteins to affect cell death. In particular, growth factors can regulate the anti-apoptotic Bcl-2 family protein Mcl-1, a short-lived protein that is essential for hematopoietic cell survival (17Opferman J.T. Iwasaki H. Ong C.C. Suh H. Mizuno S. Akashi K. Korsmeyer S.J. Science. 2005; 307: 1101-1104Crossref PubMed Scopus (468) Google Scholar, 18Opferman J.T. Letai A. Beard C. Sorcinelli M.D. Ong C.C. Korsmeyer S.J. Nature. 2003; 426: 671-676Crossref PubMed Scopus (669) Google Scholar). When cells are deprived of necessary growth factors, GSK-3 becomes activated and phosphorylates Mcl-1 to target it for proteasomal degradation (19Ding Q. He X. Hsu J.M. Xia W. Chen C.T. Li L.Y. Lee D.F. Liu J.C. Zhong Q. Wang X. Hung M.C. Mol. Cell. Biol. 2007; 27: 4006-4017Crossref PubMed Scopus (309) Google Scholar, 20Maurer U. Charvet C. Wagman A.S. Dejardin E. Green D.R. Mol. Cell. 2006; 21: 749-760Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar). Decreased glucose (21Alves N.L. Derks I.A. Berk E. Spijker R. van Lier R.A. Eldering E. Immunity. 2006; 24: 703-716Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar) or inhibition of mitochondrial respiration (22Brunelle J.K. Shroff E.H. Perlman H. Strasser A. Moraes C.T. Flavell R.A. Danial N.N. Keith B. Thompson C.B. Chandel N.S. Mol. Cell. Biol. 2007; 27: 1222-1235Crossref PubMed Scopus (40) Google Scholar) also leads to the loss of Mcl-1 protein. Glucose metabolism inhibits GSK-3 in highly glycolytic cells, however, preventing Mcl-1 phosphorylation and ubiquitination (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar). In addition to regulation of Mcl-1, growth factor withdrawal leads to induction or activation of pro-apoptotic BH3-only proteins of the Bcl-2 family. In hematopoietic cells, the BH3-only protein Bim plays a critical role in the initiation of apoptosis in response to multiple death stimuli, including growth factor deprivation (23Bouillet P. Metcalf D. Huang D.C. Tarlinton D.M. Kay T.W. Kontgen F. Adams J.M. Strasser A. Science. 1999; 286: 1735-1738Crossref PubMed Scopus (1288) Google Scholar). The BH3-only protein, Puma, is also induced in growth factor-deprived hematopoietic cells, and cells deficient in Puma expression are resistant to death (24Ekoff M. Kaufmann T. Engstrom M. Motoyama N. Villunger A. Jonsson J.I. Strasser A. Nilsson G. Blood. 2007; 110: 3209-3217Crossref PubMed Scopus (94) Google Scholar, 25Erlacher M. Labi V. Manzl C. Bock G. Tzankov A. Hacker G. Michalak E. Strasser A. Villunger A. J. Exp. Med. 2006; 203: 2939-2951Crossref PubMed Scopus (189) Google Scholar, 26You H. Pellegrini M. Tsuchihara K. Yamamoto K. Hacker G. Erlacher M. Villunger A. Mak T.W. J. Exp. Med. 2006; 203: 1657-1663Crossref PubMed Scopus (335) Google Scholar). Importantly, the combined loss of Bim and Puma leads to greater cell survival than loss of the individual proteins, indicating that they play an additive and only partially redundant role in growth factor withdrawal-induced cell death (25Erlacher M. Labi V. Manzl C. Bock G. Tzankov A. Hacker G. Michalak E. Strasser A. Villunger A. J. Exp. Med. 2006; 203: 2939-2951Crossref PubMed Scopus (189) Google Scholar). The effect of glucose metabolism on these pro-apoptotic proteins, however, remains unknown.The elevated glucose metabolism of activated lymphocytes and cancer cells may inhibit cell death through regulation of multiple Bcl-2 family members. Here we show that in addition to metabolic regulation of Mcl-1 by inhibition of GSK-3 (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar), the pro-apoptotic BH3-only protein Puma is also responsive to changes in glucose metabolism. Increased glucose uptake attenuated Puma up-regulation and cell death in growth factor withdrawn cells. In contrast, glucose deprivation led to Puma induction even in the presence of growth factor. Although p53 protein levels did not increase when cells were deprived of growth factor, p53 was required for Puma induction and growth factor withdrawal-induced activation of Bax, DNA fragmentation, and cell death of IL-3-dependent cell lines as well as activated primary T lymphocytes. Elevated glucose uptake, however, suppressed growth factor-regulated p53 activity, indicating that p53 is responsive to the cellular metabolic state. Together these data show that elevated glucose metabolism characteristic of aerobic glycolysis in cancer cells or activated lymphocytes is sufficient to initiate anti-apoptotic signaling pathways that both maintain Mcl-1 and suppress p53-dependent induction of Puma.EXPERIMENTAL PROCEDURESCells—Control, Glut1/HK1, and Bcl-xL expressing FL5.12 and 32D cells were generated and cultured in RPMI medium supplemented with 0.5 ng/ml recombinant mouse IL-3 (PeproTech Inc.; Rocky Hill, NJ) as previously described (5Rathmell J.C. Fox C.J. Plas D.R. Hammerman P. Cinalli R.M. Thompson C.B. Mol. Cell. Biol. 2003; 23: 7315-7328Crossref PubMed Scopus (457) Google Scholar). Transient transfections were performed by nucleofection (Kit V; Amaxa Biosystems, Gaithersburg, MD). For growth factor withdrawal, the cells were washed three times in phosphate-buffered saline prior to resuspension in RPMI medium lacking IL-3. For glucose deprivations, the cells were washed three times and resuspended in glucose-free RPMI with addition of IL-3 and 10% dialyzed serum. Methyl-pyruvate (10 mm; Sigma) or etoposide (4 μm; Sigma) was added to some cultures.Primary T Cell Purification and Culture—T cells from wild type and p53 nullizygous mice (p53tm1Tyj; The Jackson Laboratory; Bar Harbor, ME) were purified via negative selection from spleen (StemSep, Vancouver, Canada) and cultured in RPMI 1640 (Mediatech, Inc., Herndon, VA) supplemented with 10% fetal bovine serum (Gemini Bio-Products, Woodland, CA). T cell stimulation was achieved by culture of T cells on plates coated with 5 μg/ml anit-CD3ϵ (clone 145-2C11) and anti-CD28 (clone 37.51) (both from BD Pharmingen, San Diego, CA) with the addition of 5 ng/ml recombinate murine IL-2 (PeproTech Inc.) for 2 days. The cells were then washed off the plate and cultured on uncoated plates with IL-2 for two additional days. For IL-2 deprivation, the cells were washed three times in phosphate-buffered saline and cultured in medium in the absence of IL-2. Glucose deprivations were performed as described above except with IL-2 rather than IL-3.Plasmid Constructs—shRNAi plasmids were constructed using previously described approaches (27Fox C.J. Hammerman P.S. Cinalli R.M. Master S.R. Chodosh L.A. Thompson C.B. Genes Dev. 2003; 17: 1841-1854Crossref PubMed Scopus (277) Google Scholar). shRNAi sequences were: Puma, GAGGGTCATGTACAATCTCTTCCTCGAGCAAGAGATTGTACATGACCCTC; p53 shRNAi-a, GAGTATCTGGAAGACAGGCAGACTTCCTCGAGCAAGTCTGCCTGTCTTCCAGATACTC. p53 shRNAi-b, GAGACACAATCCTCCCGGTCCCTTCCTCGAGCAAGGGACCGGGAGGATTGTGTCTC. The sequences of Bim and green fluorescent protein shRNAi have been previously described (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar). The sequences were cloned into pCR2.1 vector driven by the human U6 promoter as previously described (27Fox C.J. Hammerman P.S. Cinalli R.M. Master S.R. Chodosh L.A. Thompson C.B. Genes Dev. 2003; 17: 1841-1854Crossref PubMed Scopus (277) Google Scholar). The p53 luciferase reporter construct was kindly provided by Dr. Ratna Ray (St. Louis University, St. Louis, MO). The pHRGTK Renilla construct was kindly provided by Dr. Michael Datto (Duke University, Durham, NC).Glucose Uptake Assay—Glucose uptake was measured as previously described, with minor modifications (9Wieman H.L. Wofford J.A. Rathmell J.C. Mol. Biol. Cell. 2007; 18: 1437-1446Crossref PubMed Scopus (400) Google Scholar). In brief, the cells were washed and resuspended in Krebs-Ringer-HEPES (at pH 7.4, 136 mm NaCl, 4.7 ml KCl, 1.25 mm CaCl2, 1.25 mm MgSO4, and 10 mm HEPES). 2-Deoxy-d-H3 glucose (2 μCi/reaction) was added, and the cells were incubated for 5 min at 37 °C. The reactions were quenched by the addition of ice-cold 200 μm phloretin (Calbiochem, Gibbstown, NJ) followed by centrifugation through an oil layer (1:1 Dow Corning 550 Silicon fluid from Motion Industries, Birmingham, AL; and dinonyl phthalate from Sigma-Aldrich). The cell pellets were washed and solubilized in 1 m NaOH, and radioactivity was measured using a scintillation counter.Western Blots—The cells were lysed in radioimmune precipitation assay buffer with protease inhibitors (BD Pharmingen) on ice for 10 min and precleared by centrifugation. The protein concentrations were determined by bicinchoninic acid protein assay (Bio-Rad), and 35 μg of protein was run on a 10–20% SDS-PAGE gel (Bio-Rad). Antibodies used were rabbit anti-Bim (BD Pharmingen), rabbit anti-Puma (Cell Signaling Technology; Danvers, MA), mouse anti-actin (Sigma), mouse anti-p53 (Cell Signaling Technology), rabbit anti-Bid (Cell Signaling), mouse anti-Bad (BD Pharmingen), rabbit anti-Mcl-1 (BioLegend, San Diego, CA), rabbit anti-BiP (Cell Signaling Technology), mouse anti-p21 (BD Pharmingen), and rabbit anti-Bax (Cell Signaling). Secondary antibodies were anti-rabbit horseradish peroxidase-labeled antibody (Cell Signaling) and anti-rabbit and anti-mouse infrared-labeled antibody and were detected with ECL Plus (Pierce) or the Odyssey infrared imaging system (Licor). All of the images were uniformly contrasted, and some were digitally rearranged for ease of viewing (rearranged lanes indicated by spaces). For all immunoblots, the levels of proteins under analysis were quantified by normalization to actin and to the control sample. The numbers indicating these normalized quantifications of protein levels are presented under each lane throughout.Cell Death Assays—A FACScan (BD Biosciences) and FLowJo (TreeStar, Ashland, OR) were used to analyze uptake of propidium iodide (1 μg/ml; Invitrogen). Bax activation was determined as previously described (5Rathmell J.C. Fox C.J. Plas D.R. Hammerman P. Cinalli R.M. Thompson C.B. Mol. Cell. Biol. 2003; 23: 7315-7328Crossref PubMed Scopus (457) Google Scholar). Briefly, the cells were fixed in 0.25% paraformaldehyde for 5 min and stained with anti-active conformation Bax antibody (clone 6A7; BD Pharmingen) in 100 μg/ml digitonin (Sigma) in phosphate-buffered saline followed by staining with anti-mouse IgG1-PE (BD Pharmingen). DNA fragmentation analysis by quantification of subdiploid cells was performed simultaneously with Bax activation by the addition of propidium iodide (10 μg/ml) and RNase (Sigma) to fixed and permeabilized cells prior to flow cytometry. Caspase activation was determined by analysis of cell lysates for DEVDase activity as described (15Nutt L.K. Margolis S.S. Jensen M. Herman C.E. Dunphy W.G. Rathmell J.C. Kornbluth S. Cell. 2005; 123: 89-103Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). The samples were analyzed in triplicate for absorbance at 405 nm. The values given are Vmax values of absorbance over 30 min after start of reaction. Clonogenic survival was determined by culturing cells in the presence or absence of IL-3 for 12 h and then performing limiting dilution analysis of cell growth following readdition of IL-3 to determine the percentage of cells capable of responding to IL-3 readdition with clonogenic growth (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar).Real Time PCR—Total RNA was isolated from cells using the TRIzol (Invitrogen) method. 2 μg of RNA was reverse transcribed with SuperScript II (Invitrogen). Quantitative reverse transcription-PCR was done by using SYBR Green Supermix (Bio-Rad) and was analyzed on an iCycler. β2-Microglobulin was used as the internal control. Primers are: Puma, forward primer, AGACAAGAAGAGCAGCATCGACAC, and reverse primer, TAGGCACCTAGTTGGGCTCCATTT; β2-microglobulin, forward primer, ACCGGCCTGTATGCTATCCAGAAA, and reverse primer, GGTGAATTCAGTGTGAGCCAGGAT.Luciferase Assay—2.5 × 106 cells were transfected with 15 μg of luciferase reporter plasmid and 10 ng of Renilla plasmid. 18 h after transfection, the cells were washed and cultured in the presence or absence of IL-3 for 9 h. The cells were then lysed, and activities of firefly and Renilla luciferase were analyzed by a luminometer. Firefly luciferase activity was normalized to Renilla luciferase activity to adjust for transfection efficiency.RESULTSIncreased Glucose Metabolism Attenuates Puma Up-regulation after Growth Factor Withdrawal—The early hematopoietic precursor cell line, FL5.12, is dependent on the cytokine IL-3 to maintain glucose metabolism and survival (6Rathmell J.C. Vander Heiden M.G. Harris M.H. Frauwirth K.A. Thompson C.B. Mol. Cell. 2000; 6: 683-692Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar). Control of glucose uptake, in particular, plays an important role in the regulation of glucose metabolism and cell death. Prior to commitment to cell death, IL-3 withdrawal led to decreased glucose uptake in control cells (Fig. 1A, left panel). Expression of Glut1 and HK1 both elevated and sustained glucose uptake (Fig. 1A, right panel), rendering cells growth factor-independent for control of glucose uptake (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar). The increased and growth factor-independent glucose uptake capacity of Glut1- and HK1-expressing cells provided a model of highly glycolytic cancer cells and activated lymphocytes. By expressing only these metabolic genes, the effects of elevated glucose uptake could be directly observed independent of oncogene- or growth factor-stimulated changes in cell signaling pathways that may otherwise complicate analyses of the role of cell metabolism in cell fate determination. Thus whereas Glut1/HK1-expressing cells have an apparent exaggerated glucose uptake capacity relative to control cells and do not simply model growth factor-independent regulation of glucose uptake, they represent highly glycolytic cells. Differences between control and Glut1/HK1 cells, therefore, demonstrate how high rates of glucose metabolism may affect cell signaling and survival pathways. Consistent with the hypothesis that elevated glucose uptake may affect cell signaling and survival, maintenance of elevated glucose uptake was sufficient to inhibit the death of Glut1/HK1 cells withdrawn from IL-3 as determined by propidium iodide exclusion (Fig. 1B) as well by Bax activation, cytochrome c release, and a stringent clonogenicity assay (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar).It was unclear whether in addition to regulation of the anti-apoptotic protein, Mcl-1 (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar), increased glucose metabolism affected pro-apoptotic BH3-only proteins that are critical to initiate cell death upon growth factor withdrawal. To address this, control and Glut1/HK1 cells were cultured in the presence of IL-3 or withdrawn from IL-3 for 10 h, and the expression of the pro-apoptotic BH3-only proteins Bim and Puma was analyzed by immunoblot (Fig. 1, C and D). The BH3-only protein Bad was also analyzed, but the inactive phosphorylated form of Bad was undetectable, and endogenous unphosphorylated Bad was unchanged by IL-3 withdrawal or glucose uptake (data not shown). Levels of both Bim and Puma increased in control cells after IL-3 deprivation. Although control and Glut1/HK1 cells had similar induction of Bim, Puma up-regulation was attenuated in Glut1/HK1 cells. This suppression of Puma induction upon IL-3 withdrawal occurred in multiple independently derived cell clones that expressed Glut1 and HK1, either individually or together, when compared with control or Bcl-xL-expressing cells (Fig. 1E). Similar inhibition of Puma expression by elevated glucose uptake was also seen in other IL-3-dependent cell lines, such as 32D cells (Fig. 1F). These data suggest, therefore, that Puma induction after growth factor withdrawal is inhibited by elevated glucose metabolism.Increased Glucose Metabolism Depends on Inhibition of Puma to Attenuate Cell Death—Expression of Glut1 and HK1 attenuated the up-regulation of Puma, but not Bim, upon growth factor withdrawal, suggesting that Puma may play a role in glucose-mediated anti-apoptotic signaling. We have shown previously that expression of Bim was sufficient to induce cell death even in the presence of IL-3 (16Zhao Y. Altman B.J. Coloff J.L. Herman C.E. Jacobs S.R. Wieman H.L. Wofford J.A. Dimascio L.N. Ilkayeva O. Kelekar A. Reya T. Rathmell J.C. Mol. Cell. Biol. 2007; 27: 4328-4339Crossref PubMed Scopus (161) Google Scholar). Puma has also been implicated in promoting cell death upon growth factor withdrawal (24Ekoff M. Kaufmann T. Engstrom M. Motoyama N. Villunger A. Jonsson J.I. Strasser A. Nilsson G. Blood. 2007; 110: 3209-3217Crossref PubMed Scopus (94) Google Scholar, 25Erlacher M. Labi V. Manzl C. Bock G. Tzankov A. Hacker G. Michalak E. Strasser A. Villunger A. J. Exp. Med. 2006; 203: 2939-2951Crossref PubMed Scopus (189) Google Scholar, 26You H. Pellegrini M. Tsuchihara K. Yamamoto K. Hacker G. Erlacher M. Villunger A. Mak T.W. J. Exp. Med. 2006; 203: 1657-1663Crossref PubMed Scopus (335) Google Scholar). To determine whether Bim and Puma expression was required for cell death following growth factor withdrawal, the cells were transiently transfected with vector control, Bim, or Puma shRNAi. Protein levels were determined 1 day after transfection (Fig. 2A). The requirement for each protein in IL-3 withdrawal-induced cell death and glucose-mediated protection from this death pathway was next tested. A time course analysis of cell death by measurement of loss of cellular membrane integrity and uptake of the vital dye, propidium iodide (PI), showed that Bim deficiency delayed cell death in both control and Glut1/HK1 cells (Fig. 2B). Bim-deficient Glut1/HK1 cells remained more resistant to cell death, however, than Bim-deficient control cells, indicating that although Bim played a role in growth factor withdrawal-induced cell death, glucose metabolism provided additional protection from death. Inhibition of Puma expression also attenuated cell death as measured by PI uptake. Combined absence of Bim and Puma led to even greater ability to maintain membrane integrity and resist PI uptake. Consistent with these results suggesting roles for both Bim and Puma in regulation of apoptosis, analysis of control and Glut1/HK1 cells transfected with control, Bim, Puma, or Bim together with Puma shRNAi showed that both Bim and Puma are critical for Bax activation and DNA fragmentation following growth factor withdrawal (Fig. 2C). Therefore, inhibition of Puma induction appears to be a critical mechanism for glucose metabolism to protect cells against growth factor withdrawal-induced apoptosis.FIGURE 2Increased glucose metabolism depends on inhibition of Puma induction to attenuate cell death. A, control (lanes C) and Glut1/HK1 (lanes GH) cells were transfected with control (Ctrl), Bim (top panel), or Puma (bottom panel) shRNAi plasmid, and expression was determined 10 h after IL-3 withdrawal. B and C, cell viability was analyzed over time after IL-3 withdrawal by uptake of the vital dye PI (B) and after 15 h by flow cytometric analysis (C) for active conformation Bax (top row) and DNA fragmentation (bottom row). The percentage of ce
Referência(s)