β-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is Essential for Bacterial Fatty Acid Synthesis
2003; Elsevier BV; Volume: 278; Issue: 51 Linguagem: Inglês
10.1074/jbc.m308638200
ISSN1083-351X
AutoresChiou-Yan Lai, John E. Cronan,
Tópico(s)RNA and protein synthesis mechanisms
Resumoβ-Ketoacyl-acyl carrier protein (ACP) synthase III (KAS III, also called acetoacetyl-ACP synthase) encoded by the fabH gene is thought to catalyze the first elongation reaction (Claisen condensation) of type II fatty acid synthesis in bacteria and plant plastids. However, direct in vivo evidence that KAS III catalyzes an essential reaction is lacking, because no mutant organism deficient in this activity has been isolated. We report the first bacterial strain lacking KAS III, a fabH mutant constructed in the Gram-positive bacterium Lactococcus lactis subspecies lactis IL1403. The mutant strain carries an in-frame deletion of the KAS III active site region and was isolated by gene replacement using a medium supplemented with a source of saturated and unsaturated long-chain fatty acids. The mutant strain is devoid of KAS III activity and fails to grow in the absence of supplementation with exogenous long-chain fatty acids demonstrating that KAS III plays an essential role in cellular metabolism. However, the L. lactis fabH deletion mutant requires only long-chain unsaturated fatty acids for growth, a source of long-chain saturated fatty acids is not required. Because both saturated and unsaturated fatty acids are required for growth when fatty acid synthesis is blocked by biotin starvation (which prevents the synthesis of malonyl-CoA), another pathway for saturated fatty acid synthesis must remain in the fabH deletion strain. Indeed, incorporation of [1-14C]acetate into fatty acids in vivo showed that the fabH mutant retained about 10% of the fatty acid synthetic ability of the wild-type strain and that this residual synthetic capacity was preferentially diverted to the saturated branch of the pathway. Moreover, mass spectrometry showed that the fabH mutant retained low levels of palmitic acid upon fatty acid starvation. Derivatives of the fabH deletion mutant strain were isolated that were octanoic acid auxotrophs consistent with biochemical studies indicating that the major role of FabH is production of short-chain fatty acid primers. We also confirmed the essentiality of FabH in Escherichia coli by use of a plasmid-based gene insertion/deletion system. Together these results provide the first genetic evidence demonstrating that FabH conducts the major condensation reaction in the initiation of type II fatty acid biosynthesis in both Gram-positive and Gram-negative bacteria. β-Ketoacyl-acyl carrier protein (ACP) synthase III (KAS III, also called acetoacetyl-ACP synthase) encoded by the fabH gene is thought to catalyze the first elongation reaction (Claisen condensation) of type II fatty acid synthesis in bacteria and plant plastids. However, direct in vivo evidence that KAS III catalyzes an essential reaction is lacking, because no mutant organism deficient in this activity has been isolated. We report the first bacterial strain lacking KAS III, a fabH mutant constructed in the Gram-positive bacterium Lactococcus lactis subspecies lactis IL1403. The mutant strain carries an in-frame deletion of the KAS III active site region and was isolated by gene replacement using a medium supplemented with a source of saturated and unsaturated long-chain fatty acids. The mutant strain is devoid of KAS III activity and fails to grow in the absence of supplementation with exogenous long-chain fatty acids demonstrating that KAS III plays an essential role in cellular metabolism. However, the L. lactis fabH deletion mutant requires only long-chain unsaturated fatty acids for growth, a source of long-chain saturated fatty acids is not required. Because both saturated and unsaturated fatty acids are required for growth when fatty acid synthesis is blocked by biotin starvation (which prevents the synthesis of malonyl-CoA), another pathway for saturated fatty acid synthesis must remain in the fabH deletion strain. Indeed, incorporation of [1-14C]acetate into fatty acids in vivo showed that the fabH mutant retained about 10% of the fatty acid synthetic ability of the wild-type strain and that this residual synthetic capacity was preferentially diverted to the saturated branch of the pathway. Moreover, mass spectrometry showed that the fabH mutant retained low levels of palmitic acid upon fatty acid starvation. Derivatives of the fabH deletion mutant strain were isolated that were octanoic acid auxotrophs consistent with biochemical studies indicating that the major role of FabH is production of short-chain fatty acid primers. We also confirmed the essentiality of FabH in Escherichia coli by use of a plasmid-based gene insertion/deletion system. Together these results provide the first genetic evidence demonstrating that FabH conducts the major condensation reaction in the initiation of type II fatty acid biosynthesis in both Gram-positive and Gram-negative bacteria. Fatty acid biosynthetic pathways are of two classes called types I and II (reviewed in Refs. 1Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (289) Google Scholarand 2Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar). In the associated or type I fatty acid synthase system, each fatty acid synthetic reaction is catalyzed by a distinct domain of large multifunctional proteins. The dissociated or type II fatty acid synthesis system found in most bacteria and plant plastids consists of a series of discrete proteins, each of which catalyzes an individual reaction of the fatty acid biosynthetic pathway. In some cases, two or more enzymes are able to perform the same chemical reaction, but have differing substrate specificities and physiological functions. The β-ketoacyl-ACP synthases (KAS) 1The abbreviations used are: KASβ-ketoacyl-ACP synthaseACPacyl carrier proteinX-gal5-bromo-4-chloro-3-indoyl-β-d-galactosideTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineCRIMconditional-replication, integration, and modular.1The abbreviations used are: KASβ-ketoacyl-ACP synthaseACPacyl carrier proteinX-gal5-bromo-4-chloro-3-indoyl-β-d-galactosideTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineCRIMconditional-replication, integration, and modular. provide a good example. All organisms using a type II pathway contain at least two KAS enzymes, KAS II and KAS III (1Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (289) Google Scholar, 2Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar). KAS II is the generic enzyme responsible for the elongations required for synthesis of long-chain fatty acids, whereas KAS III is thought to catalyze the first condensation reaction to produce the butryl thioester of acyl carrier protein (ACP) (1Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (289) Google Scholar, 2Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar). Butyryl-ACP is then thought to act as a substrate for the KAS II-catalyzed elongations that result in long-chain fatty acids (1Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (289) Google Scholar, 2Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar). That is, KAS III is thought to provide a primer for KAS II (and other long-chain KAS isozymes, if present). The in vivo function of KAS II is clearly established because mutants (called fabF) lacking this enzyme have been well studied in Escherichia coli (1Rock C.O. Cronan J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (289) Google Scholar, 2Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar) and other bacteria (3Allen E.E. Bartlett D.H. J. Bacteriol. 2000; 182: 1264-1271Crossref PubMed Scopus (48) Google Scholar, 4Kutchma A.J. Hoang T.T. Schweizer H.P. J. Bacteriol. 1999; 181: 5498-5504Crossref PubMed Google Scholar). However, the postulated role of KAS III is based only on biochemical analyses, despite considerable efforts no mutant organism lacking this enzyme has been described. Moreover in E. coli, which contains KAS III and two long-chain KAS enzymes (KAS I and KAS II), only KAS I appears essential. This premise is based on the observation that overproduction of KAS I, but not KAS III, conferred resistance to thiolactomycin, an antibiotic that inhibits all three KAS isozymes in vitro (5Tsay J.T. Rock C.O. Jackowski S. J. Bacteriol. 1992; 174: 508-513Crossref PubMed Google Scholar) and fabB mutations that confer thiolactomycin resistance to E. coli have been isolated (6Jackowski S. Zhang Y.M. Price A.C. White S.W. Rock C.O. Antimicrob. Agents Chemother. 2002; 46: 1246-1252Crossref PubMed Scopus (31) Google Scholar). However, it has not been shown that the inhibitor is equally effective in vivo. The presence of a significant intracellular pool of acetyl-ACP in E. coli (7Heath R.J. Rock C.O. J. Biol. Chem. 1995; 270: 15531-15538Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) is also difficult to reconcile with the postulated role of KAS III because KAS III condenses acetyl-CoA and malonyl-ACP and is inactive with acetyl-ACP (8Jackowski S. Rock C.O. J. Biol. Chem. 1987; 262: 7927-7931Abstract Full Text PDF PubMed Google Scholar, 9Tsay J.T. Oh W. Larson T.J. Jackowski S. Rock C.O. J. Biol. Chem. 1992; 267: 6807-6814Abstract Full Text PDF PubMed Google Scholar).The goal of the present study was to elucidate the pathways involved in the initiation of fatty acid synthesis and to clarify the physiological role of FabH. Despite numerous attempts we have failed to obtain fabH mutants of E. coli and Salmonella enterica Serovar Typhimurium. A difficulty in these Gram-negative bacteria is that a low level of de novo fatty acid biosynthesis is required to produce the acyl-ACP precursors of lipid A (10Silbert D.F. Annu. Rev. Biochem. 1975; 44: 315-339Crossref PubMed Scopus (64) Google Scholar, 11Anderson M.S. Bulawa C.E. Raetz C.R. J. Biol. Chem. 1985; 260: 15536-15541Abstract Full Text PDF PubMed Google Scholar, 12Anderson M.S. Raetz C.R. J. Biol. Chem. 1987; 262: 5159-5169Abstract Full Text PDF PubMed Google Scholar) and thus null mutant strains lacking essential fatty acid synthetic genes cannot be isolated. We therefore turned to a Gram-positive bacterium, Lactococcus lactis (Gram-positive bacteria lack lipid A). L. lactis is one of the best characterized lactic acid bacteria and the genome of L. lactis subsp. lactis IL1403 has been sequenced (13Bolotin A. Mauger S. Malarme K. Ehrlich S.D. Sorokin A. Antonie Leeuwenhoek. 1999; 76: 27-76Crossref PubMed Scopus (158) Google Scholar). Lactic acid bacteria require biotin for growth and it has been reported that oleate or a derivative of oleate such as Tween 80 can functionally replace biotin (14Potter R.L. Elvehjem C.A. J. Biol. Chem. 1948; 172: 531-537Abstract Full Text PDF PubMed Google Scholar, 15Williams W.L. Broquist H.P. Snell E.E. J. Biol. Chem. 1947; 170: 619-630Abstract Full Text PDF Google Scholar, 16Williams V.R. Fieger E.A. Ind. Eng. Chem. Anal. Ed. 1945; 17: 127-130Crossref Scopus (3) Google Scholar, 17Axelrod A.E. Hofmann K. Daubert B.F. J. Biol. Chem. 1947; 169: 761-762Abstract Full Text PDF PubMed Google Scholar). Biotin is the required cofactor of acetyl-CoA carboxylase, the essential enzyme carrying out the first committed step of fatty acid biosynthesis (18Cronan Jr., J.E. Waldrop G.L. Prog. Lipid Res. 2002; 41: 407-435Crossref PubMed Scopus (325) Google Scholar). The observation that biotin-free media (containing aspartate to bypass the loss of pyruvate carboxylase, a second biotin-requiring enzyme) cannot support the growth of lactic acid bacteria and that exogenous fatty acids (or Tween 80) that functionally replace biotin can be explained by a lack of acetyl-CoA carboxylase activity that results from blockage of fatty acid synthesis. Because exogenous fatty acids have biotin-replacing capability in other lactic acid bacteria (14Potter R.L. Elvehjem C.A. J. Biol. Chem. 1948; 172: 531-537Abstract Full Text PDF PubMed Google Scholar, 15Williams W.L. Broquist H.P. Snell E.E. J. Biol. Chem. 1947; 170: 619-630Abstract Full Text PDF Google Scholar, 16Williams V.R. Fieger E.A. Ind. Eng. Chem. Anal. Ed. 1945; 17: 127-130Crossref Scopus (3) Google Scholar, 17Axelrod A.E. Hofmann K. Daubert B.F. J. Biol. Chem. 1947; 169: 761-762Abstract Full Text PDF PubMed Google Scholar), we hypothesized that null mutants lacking essential fatty acid synthetic genes should grow with exogenous fatty acid supplementation unlike the case in Gram-negative bacteria (10Silbert D.F. Annu. Rev. Biochem. 1975; 44: 315-339Crossref PubMed Scopus (64) Google Scholar, 11Anderson M.S. Bulawa C.E. Raetz C.R. J. Biol. Chem. 1985; 260: 15536-15541Abstract Full Text PDF PubMed Google Scholar, 12Anderson M.S. Raetz C.R. J. Biol. Chem. 1987; 262: 5159-5169Abstract Full Text PDF PubMed Google Scholar). In this paper, we report the isolation of the first fabH null mutant obtained in any organism by gene replacement in L. lactis subsp. lactis.We also demonstrated the essentiality of KAS III in E. coli and conducted biochemical characterizations of the L. lactis fabH mutant to elucidate the physiological roles of KAS III.EXPERIMENTAL PROCEDURESBacterial Strains and Plasmids—The bacterial strains and plasmids used in this work are listed in Table I. All bacterial strains are derivatives of E. coli K-12 or Salmonella enterica Serovar Typhimurium LT2 except L. lactis subsp. lactis strain IL1403. Strain CL66 containing a fabH point mutation R271K (presumably resulting from a prior PCR amplification) was used as a template for PCR amplification of the S. enterica fabH. Plasmid pCL49 was obtained by insertion of the 2-kb plsX (truncated) plus fabH PCR product of S. enterica chromosomal DNA (amplified with primers SalS-N and SalH-C, Table II) into pCR2.1 (Invitrogen). Plasmid pORI280 that contains an erythromycin resistance gene, the origin of lactococcal replication of plasmid pWV01, and the E. coli β-galactosidase gene expressed under lactococcal promoter P32 was used as the vector for gene replacement (19Leenhouts K.J. Venema G. Kok J. Methods Cell Sci. 1998; 20: 35-50Crossref Scopus (19) Google Scholar). Plasmid pCL58 was constructed by insertion of the 1.2-kb fabH PCR product of L. lactis chromosome DNA (amplified with primers LacH-P and LacH-C, Table II) into pCR2.1. Plasmid pCL61 containing the complete L. lactis fabH gene was derived by insertion of the 1.2-kb BamHI-XbaI fabH fragment of pCL58 into pK18 (20Pridmore R.D. Gene (Amst.). 1987; 56: 309-312Crossref PubMed Scopus (353) Google Scholar) cut with the same enzymes. Plasmid pCL62 containing the in-frame fabH deletion was constructed by digestion of pCL61 with BcgI followed by formation of blunt ends by treatment with T4 DNA polymerase plus the 4 dNTPs followed by ligation with T4 DNA ligase. To ensure that the expected fabH in-frame deletion had been made, the deletion region was checked by sequencing. Plasmid pCL66 was obtained by insertion of the 1.2-kb BamHI-XbaI fragment (containing the in-frame fabH deletion) of pCL62 into pORI280 cut with the same enzymes. All primers (Table II) used for PCR in this work were synthesized by the Genetic Engineering Facility, University of Illinois, Urbana-Champaign.Table IBacterial strains and plasmids used in this workStrains or plasmidRelevent characteristicsSources or referencesE. coli MG1655Wild-typeLab collection UB1005F-metB1 relA1 spoT1 gyrA216 λrλ-Lab collection DY330W3110 ΔlacU169 gal490 λc1857 Δ(cro-bioA)23Yu D. Ellis H.M. Lee E.C. Jenkins N.A. Copeland N.G. Court D.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5978-5983Crossref PubMed Scopus (1353) Google Scholar CAG12094MG1655, zcb-3059::Tn1034Singer M. Baker T.A. Schnitzler G. Deischel S.M. Goel M. Dove W. Jaacks K.J. Grossman A.D. Erickson J.W. Gross C.A. Microbiol. Rev. 1989; 53: 1-24Crossref PubMed Google Scholar, 35Nichols B.P. Shafiq O. Meiners V. J. Bacteriol. 1998; 180: 6408-6411Crossref PubMed Google Scholar CAG18466MG1655, zcc-282::Tn1034Singer M. Baker T.A. Schnitzler G. Deischel S.M. Goel M. Dove W. Jaacks K.J. Grossman A.D. Erickson J.W. Gross C.A. Microbiol. Rev. 1989; 53: 1-24Crossref PubMed Google Scholar, 35Nichols B.P. Shafiq O. Meiners V. J. Bacteriol. 1998; 180: 6408-6411Crossref PubMed Google Scholar CL81UB1005, attHK022::(plsX′fabH; aadA)This work CL106DY330, attHK022::(plsX'fabH; aadA)This work CL110DY330, attHK022::(plsX'fabH; aadA) fabH::kanThis work CL111CL81, fabH::kanThis work BMH71-81F-lacIq Δ(lacZ)M15 proA+B+/Δ(lac-proAB) thi glnVLab collection AT1371DH5α/pEC, PlacpanC on pEC24von Delft F. Lewendon A. Dhanaraj V. Blundell T.L. Abell C. Smith A.G. Structure (Lond.). 2001; 9: 439-450Abstract Full Text Full Text PDF PubMed Scopus (69) Google ScholarS. enterica Serovar typhimurium CL66LT2, fabF::kan, fabH (R271K)This workL. lactis ssp. lactis IL1403Wild type13Bolotin A. Mauger S. Malarme K. Ehrlich S.D. Sorokin A. Antonie Leeuwenhoek. 1999; 76: 27-76Crossref PubMed Scopus (158) Google Scholar CL112IL1403, in-frame fabH deletionThis studyPlasmids pAH144Plasmid dependent upon pir+ in host, R6K γori, attPHK022, Spcr Strr33Haldimann A. Wanner B.L. J. Bacteriol. 2001; 183: 6384-6393Crossref PubMed Scopus (440) Google Scholar pAH69CRIM helper plasmid, amp, oriR101, IntHK02233Haldimann A. Wanner B.L. J. Bacteriol. 2001; 183: 6384-6393Crossref PubMed Scopus (440) Google Scholar pAH83CRIM helper plasmid, amp, oriR101, Xis and IntHK02233Haldimann A. Wanner B.L. J. Bacteriol. 2001; 183: 6384-6393Crossref PubMed Scopus (440) Google Scholar pKD13Template plasmid, amp, FRT-flanked kan45Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (10974) Google Scholar pCL49Insertion of the 2-kb plsX′ fabH PCR product of S. enterica strain CL66 (amplified with primers SalS-N and SalH-C) into pCR2.1This work pOR1280Plasmid dependent upon RepA+ in host, ori of pWV01, P32lacZ, Emr,19Leenhouts K.J. Venema G. Kok J. Methods Cell Sci. 1998; 20: 35-50Crossref Scopus (19) Google Scholar pK18Cloning vector20Pridmore R.D. Gene (Amst.). 1987; 56: 309-312Crossref PubMed Scopus (353) Google Scholar pCL58Insertion of the 1.2-kb fabH PCR product of L. lactis chromosome DNA (amplified with primers LacH-P and LacH-C) into pCR2.1This study pCL61Insertion of the 1.2-kp BamHI-XbaI fabH fragment of pCL58 into pK18 cut with the same enzymesThis study pCL62pCL61 was digested with BcgI followed by blunt ending with T4 DNA polymerase + 4 dNTPs and then ligatedThis study pCL66Insertion of the 1.2-kb BamHI-XbaI fragment (containing an in-frame fabH deletion) of pCL62 into pORI280 cut with BamHI and XbaIThis study Open table in a new tab Table IIPCR primers used in this studyPrimerSequence (5′-3′)Primer 1GCCACATTGCCGCGCCAAACGAAACCGTTTCAACCATGGTTCCGGGGATCCGTCGACCTGCAGTPrimer 2CGCCCCAGATTTCACGTATTGATCGGCTACGCTTAATGCATGTGTAGGCTGGAGCTGCTTCSalS-NACGCTAATTCGCAGCTCACTSalH-CACAAATGCAAATTGCGTCATLacH-PTCAATCGATTAGAAGATAAGGGALacH-CGAAAAACTTGCTAAACTTTGAAGCP1aPrimers P1, P2, P3, and P4 are from Ref. 34.GGAATCAATGCCTGAGTGP2aPrimers P1, P2, P3, and P4 are from Ref. 34.ACTTAACGGCTGACATGGP3aPrimers P1, P2, P3, and P4 are from Ref. 34.ACGAGTATCGAGATGGCAP4aPrimers P1, P2, P3, and P4 are from Ref. 34.GGCATCAACAGCACATTCa Primers P1, P2, P3, and P4 are from Ref. 34Singer M. Baker T.A. Schnitzler G. Deischel S.M. Goel M. Dove W. Jaacks K.J. Grossman A.D. Erickson J.W. Gross C.A. Microbiol. Rev. 1989; 53: 1-24Crossref PubMed Google Scholar. Open table in a new tab Media and Culture Conditions—E. coli and S. enterica cultures were grown in rich broth (21Zhang Y. Cronan Jr., J.E. J. Bacteriol. 1998; 180: 3295-3303Crossref PubMed Google Scholar), Luria-Bertani (LB) (22Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1972Google Scholar) liquid medium, or on agar plates made of rich broth or LB. L. lactis cultures were grown in GM17 medium (Difco) or on GM17 agar plates (19Leenhouts K.J. Venema G. Kok J. Methods Cell Sci. 1998; 20: 35-50Crossref Scopus (19) Google Scholar). Antibiotics were added at the following concentrations (in μg/ml): kanamycin, 50; ampicillin, 100; spectinomycin, 100; tetracycline, 12; and erythromycin, 150. Single copy integrants of E. coli were selected using a mixture of spectinomycin and streptomycin at 17.5 μg/ml each. Single copy integrants of L. lactis were selected using erythromycin at 5 μg/ml. Final concentrations of 1 mm isopropyl-β-d-thiogalactopyranoside, 0.2% arabinose, 0.4% glucose, 0.005% fucose, 0.3 mg/ml avidin, 0.1% Tween 40, 0.1% Tween 80, 0.02% oleate, 0.02% octanoic acid, 0.02% cis-vaccinate, and 0.2% Tergitol Nonidet P-40 (a metabolically inert detergent used to solubilize fatty acids) were obtained by appropriate supplementation of the media.The minimal medium contained medium E and 4% vitamin-free casamino acids plus the following (final concentrations in mm) major components: glucose, 100; sodium acetate, 30; asparagines, 1.6; glutamine, 10; tryptophan, 1; sodium chloride, 50; ammonium chloride, 9.5, potassium sulfate, 0.28; potassium phosphate, 1.3 mm; and Tricine, 4. The minor components (final concentrations in μm) were: calcium chloride, 0.5; magnesium chloride, 520; ferrous sulfate, 10; ammonium molybdate, 0.006; boric acid, 0.8; 0.006; cobalt chloride, 0.06; cupric sulfate, 0.02; manganous chloride, 0.16; zinc sulfate, 0.02; biotin, 0.8; pyridoxal, 20; folic acid, 4.6; riboflavin, 5.2; niacinamide, 16; thiamine, 6; and pantothenate, 4. The pantothenate was replaced with the radioactive species for labeling studies. The fatty acid supplement consisted of (final concentrations) 0.1% Tween 40 and Tween 80 plus 0.02% oleic acid.CRIM Plasmid Integration—Ligation mixtures containing EcoRI-digested pAH144 and the 2-kb S. enterica fabH EcoRI fragment of pCL49 were transformed into both strain UB1005 and strain DY330 carrying the CRIM helper plasmid pAH69, and transformants resistant to both spectinomycin and streptomycin were selected. The resulting S. enterica fabH integrants CL81 (from UB1005) and CL106 (from DY330) were verified by PCR using primers SalS-N, SalH-C (Table II), and the copy number of the integrants were checked by use of primers P1, P2, P3, and P4 (21Zhang Y. Cronan Jr., J.E. J. Bacteriol. 1998; 180: 3295-3303Crossref PubMed Google Scholar).Construction of an E. coli fabH Deletion Mutation in the Presence of S. enterica fabH—Linear DNA fragments carrying a kanamycin resistance cassette flanked by the FRT sites were amplified by PCR from pKD13 using primers 1 and 2 (Table II). These primers were homologous at the 3′ end to priming sequences in pKD13 and contained 40-base 5′ end extensions homologous to E. coli fabH. The respective 1.4-kb PCR products were purified, treated with DpnI, and then transformed into CL106, the strain harboring a λ prophage that contains recombination genes exo, bet, and gam under control of a temperature-sensitive λcI-repressor (23Yu D. Ellis H.M. Lee E.C. Jenkins N.A. Copeland N.G. Court D.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5978-5983Crossref PubMed Scopus (1353) Google Scholar). The resulting strain CL110 that contained a replacement of the E. coli fabH gene by the kanamycin cassette was then transduced by phage P1 into strain CL81 with selection for kanamycin resistance. Strain CL111 carrying the E. coli fabH deletion and a copy of the S. enterica fabH integrated into the chromosomal attHK022 site was obtained and verified by PCR using primers SalS-N and SalH-C (Table II).Construction of the L. lactis fabH Null Deletion Mutant—The replacement of the L. lactis fabH gene was conducted according to the method of Leenhouts et al. (19Leenhouts K.J. Venema G. Kok J. Methods Cell Sci. 1998; 20: 35-50Crossref Scopus (19) Google Scholar) (Fig. 1). Plasmid pCL66 containing an in-frame fabH deletion was transformed into strain IL1403 followed by selection on GSM17E5 agar plates (19Leenhouts K.J. Venema G. Kok J. Methods Cell Sci. 1998; 20: 35-50Crossref Scopus (19) Google Scholar) supplemented with 0.1% Tween 40, 0.1% Tween 80, and 0.02% oleate at 30 °C. These transformants were then plated on GM17E5 plates containing 5-bromo-4-chloro-3indoyl-β-d-galactoside (X-gal) plates supplemented with fatty acids as above and blue colonies were isolated. The integrant strain was grown in GM17 medium with fatty acid supplementation and the overnight culture was diluted 106 times and 2 μl were inoculated into 2 ml of GM17 medium containing fatty acids and grown overnight at 30 °C. Dilutions of the overnight culture were plated on GM17 plus X-gal supplemented with fatty acids and screened for white colonies. All white colonies were then PCR amplified using primers LacH-P and LacH-C (Table II) and the resulting PCR products were digested with either BcgI or HpaI. Strains having PCR fragments digested by HpaI, but not by BcgI, were candidate fabH deletion mutants. The PCR products of these strains were then cloned into plasmid pCR2.1 and checked by sequencing. One of these strains, CL112, had the expected sequence and was subjected to Southern blot analysisKAS III Assay—Acetoacetyl-ACP synthase activity was assayed according to Tsay et al. (5Tsay J.T. Rock C.O. Jackowski S. J. Bacteriol. 1992; 174: 508-513Crossref PubMed Google Scholar). The assay mixtures contained 0.1 m sodium phosphate, pH 7.0, 1 mm 2-mercaptoethanol, 70 μm malonyl-CoA, 45 μm [1-14C]acetyl-CoA (specific activity, 55 mCi/mmol), 265 μm ACP, 1.1 mm cerulenin, and 25, 50, or 100 μg of extract protein from either strain IL1403 or strain CL112 (ΔfabH) in a final volume of 80 μl. The mixture of ACP, sodium phosphate, and 2-mercaptoethanol was preincubated at 37 °C for 30 min to obtain complete reduction of ACP. The remaining components excepting protein were then added. The reaction was initiated by addition of protein and incubated at 37 °C for 15 min. The assay mixture was then pipetted onto a 3MM filter disc. The discs were washed successively with 10, 5, and 1% ice-cold trichloroacetic acid at 20 ml/filter. The filters were then dried and counted in 4 ml of liquid scintillation fluor solution.Synthesis of [3-3H]Pantothenate—E. coli strain AT1371 carrying plasmid pEC (24von Delft F. Lewendon A. Dhanaraj V. Blundell T.L. Abell C. Smith A.G. Structure (Lond.). 2001; 9: 439-450Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) was grown overnight at 37 °C in 2 liters of LB medium containing isopropyl-β-d-thiogalactopyranoside (70 μg/ml) and ampicillin. Cells were centrifuged, resuspended in 10 ml of TD buffer (50 mm Tris-HCl, pH 7.5, 0.1 mm dithiothreitol), and disrupted in a French pressure cell at 18,000 p.s.i. The lysate was centrifuged in a JA-20 rotor at 16,000 rpm at 4 °C for 1 h to remove cell debris. A protein fraction obtained by adding ammonium sulfate to the supernatant to 60% of saturation was collected. The protein pellet was dissolved in 5 ml of TD buffer and dialyzed overnight at 4 °C against 2 liters of the same buffer. Synthesis of [3H]pantothenate was performed according to Cronan (25Cronan Jr., J.E. Anal. Biochem. 1980; 103: 377-380Crossref PubMed Scopus (5) Google Scholar). The pantothenate synthetase reaction contained 5 mm d-pantoic acid, 10 mm ATP (potassium salt), 10 mm MgSO4, 100 mm Tris-HCl, pH 10, 100 mm NH4Cl, 0.3 mm β-[3-3H]alanine (specific activity, 60 Ci/mmol), and 90 μl of crude extract of pantothenate synthetase in a final volume of 100 μl. The mixture was incubated at 25 °C for 28 h and then applied to a 0.6 × 2.5-cm column of AG 50W-X8 (hydrogen form) ion exchange resin. [3-3H]Pantothenate was eluted in 81% yield with 1 ml of H2O, evaporated under a stream of nitrogen, and dissolved in the minimal medium given above (with pantothenate omitted) and sterilized by filtration.In Vivo Labeling of ACP Pools—Strains IL1403 and CL112 (ΔfabH) were grown at 30 °C for 72 h in the [3H]pantothenate-containing minimal medium described above. The cells were harvested by centrifugation and the cells were washed 3 times with cold M9 medium, and lysed on ice by the method of Clewell and Helinski (26Clewell D.B. Helinski D.R. Proc. Natl. Acad. Sci. U. S. A. 1969; 62: 1159-1166Crossref PubMed Scopus (1296) Google Scholar). The lysate was centrifuged to sediment the DNA and supernatant fluid was fractionated on a 15% PAGE gel containing 2.5 m urea at 4 °C. The ACP species were desterified by treating the lysate with 1 mm dithiothreitol, pH 8.0, at 37 °C for 2 h and analyzed on the same gel. The gels were then subjected to fluorography.Ph
Referência(s)