The human ABCG1 gene: identification of LXR response elements that modulate expression in macrophages and liver
2005; Elsevier BV; Volume: 46; Issue: 10 Linguagem: Inglês
10.1194/jlr.m500080-jlr200
ISSN1539-7262
AutoresSteven L. Sabol, H. Bryan Brewer, Silvia Santamarina-Fojo,
Tópico(s)Peroxisome Proliferator-Activated Receptors
ResumoThe ABC transporter ABCG1 (ATP binding cassette transporter G1), expressed in macrophages, liver, and other tissues, has been implicated in the efflux of cholesterol to high density lipoprotein. The ABCG1 gene is transcriptionally activated by cholesterol loading and activators of liver X receptors (LXRs) and retinoid X receptors (RXRs) through genomic sequences that have not been fully characterized. Here we show that ABCG1 mRNA is induced by LXR agonists in RAW264.7 macrophage cells, HepG2 hepatoma cells, and primary mouse hepatocytes. We identify two evolutionarily highly conserved LXR response elements (LXREs), LXRE-A and LXRE-B, located in the first and second introns of the human ABCG1 gene. Each element conferred robust LXR-agonist responsiveness to ABCG1 promoter-directed luciferase gene constructs in RAW264.7 and HepG2 cells. Overexpression of LXR/RXR activated the ABCG1 promoter in the presence of LXRE-A or LXRE-B sequences. In gel-shift assays, LXR/RXR heterodimers bound to wild-type but not to mutated LXRE-A and LXRE-B sequences. In chromatin immunoprecipitation assays, LXR and RXR were detected at LXRE-A and -B regions of DNA of human THP-1 macrophages.These studies clarify the mechanism of transcriptional upregulation of the ABCG1 gene by oxysterols in macrophages and liver, two key tissues where ABCG1 expression may affect cholesterol balance and atherogenesis. The ABC transporter ABCG1 (ATP binding cassette transporter G1), expressed in macrophages, liver, and other tissues, has been implicated in the efflux of cholesterol to high density lipoprotein. The ABCG1 gene is transcriptionally activated by cholesterol loading and activators of liver X receptors (LXRs) and retinoid X receptors (RXRs) through genomic sequences that have not been fully characterized. Here we show that ABCG1 mRNA is induced by LXR agonists in RAW264.7 macrophage cells, HepG2 hepatoma cells, and primary mouse hepatocytes. We identify two evolutionarily highly conserved LXR response elements (LXREs), LXRE-A and LXRE-B, located in the first and second introns of the human ABCG1 gene. Each element conferred robust LXR-agonist responsiveness to ABCG1 promoter-directed luciferase gene constructs in RAW264.7 and HepG2 cells. Overexpression of LXR/RXR activated the ABCG1 promoter in the presence of LXRE-A or LXRE-B sequences. In gel-shift assays, LXR/RXR heterodimers bound to wild-type but not to mutated LXRE-A and LXRE-B sequences. In chromatin immunoprecipitation assays, LXR and RXR were detected at LXRE-A and -B regions of DNA of human THP-1 macrophages. These studies clarify the mechanism of transcriptional upregulation of the ABCG1 gene by oxysterols in macrophages and liver, two key tissues where ABCG1 expression may affect cholesterol balance and atherogenesis. The ATP binding cassette transporter G1 (ABCG1) is a member of a large superfamily of evolutionarily conserved transmembrane proteins that transport a variety of molecules across membranes. Many of the approximately 48 known human ABC transporters, which are divided into seven families (A–G), have been implicated in disease (1Dean M. Rzhetsky A. Allikmets R. The human ATP-binding cassette (ABC) transporter superfamily.Genome Res. 2001; 11: 1156-1166Google Scholar, 2Dean M. Hamon Y. Chimini G. The human ATP-binding cassette (ABC) transporter superfamily.J. Lipid Res. 2001; 42: 1007-1017Google Scholar). ABCG1, originally termed "White" and "ABC8" (3Savary S. Denizot F. Luciani M. Mattei M. Chimini G. Molecular cloning of a mammalian ABC transporter homologous to Drosophila white gene.Mamm. Genome. 1996; 7: 673-676Google Scholar, 4Chen H. Rossier C. Lalioti M.D. Lynn A. Chakravarti A. Perrin G. Antonarakis S.E. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.Am. J. Hum. Genet. 1996; 59: 66-75Google Scholar, 5Croop J.M. Tiller G.E. Fletcher J.A. Lux M.L. Raab E. Goldenson D. Son D. Arciniegas S. Wu R.L. Isolation and characterization of a mammalian homolog of the Drosophila white gene.Gene. 1997; 185: 77-85Google Scholar), is a half-transporter (74–76 kDa) possessing one ATP binding/hydrolysis cassette and one transmembrane domain and is presumed to form dimers or multimers with either itself or another half-transporter to assemble a functional complex (6Cserepes J. Szentpetery Z. Seres L. Ozvegy-Laczka C. Langmann T. Schmitz G. Glavinas H. Klein I. Homolya L. Varadi A. et al.Functional expression and characterization of the human ABCG1 and ABCG4 proteins: indications for heterodimerization.Biochem. Biophys. Res. Commun. 2004; 320: 860-867Google Scholar). ABCG1 mRNA is expressed at high or moderate levels in macrophages, spleen, lung, thymus, placenta, brain, and fetal tissues, and at lower levels in most other tissues, including liver (3Savary S. Denizot F. Luciani M. Mattei M. Chimini G. Molecular cloning of a mammalian ABC transporter homologous to Drosophila white gene.Mamm. Genome. 1996; 7: 673-676Google Scholar, 4Chen H. Rossier C. Lalioti M.D. Lynn A. Chakravarti A. Perrin G. Antonarakis S.E. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.Am. J. Hum. Genet. 1996; 59: 66-75Google Scholar, 5Croop J.M. Tiller G.E. Fletcher J.A. Lux M.L. Raab E. Goldenson D. Son D. Arciniegas S. Wu R.L. Isolation and characterization of a mammalian homolog of the Drosophila white gene.Gene. 1997; 185: 77-85Google Scholar, 7Su Y.R. Linton M.F. Fazio S. Rapid quantification of murine ABC mRNAs by real time reverse transcriptase-polymerase chain reaction.J. Lipid Res. 2002; 43: 2180-2187Google Scholar, 8Langmann T. Mauerer R. Zahn A. Moehle C. Probst M. Stremmel W. Schmitz G. Real-time reverse transcription-PCR expression profiling of the complete human ATP-binding cassette transporter superfamily in various tissues.Clin. Chem. 2003; 49: 230-238Google Scholar, 9Hoekstra M. Kruijt J.K. Eck M. Van Van Berkel T.J. Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells.J. Biol. Chem. 2003; 278: 25448-25453Google Scholar). Recent studies have implicated ABCG1 in the cellular transport and efflux of cholesterol and possibly phospholipids. Klucken et al. (10Klucken J. Buchler C. Orso E. Kaminski W.E. Porsch-Ozcurumez M. Liebisch G. Kapinsky M. Diederich W. Drobnik W. Dean M. et al.ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport.Proc. Natl. Acad. Sci. USA. 2000; 97: 817-822Google Scholar) first demonstrated that treatment of human macrophages with antisense oligonucleotides targeting ABCG1 mRNA resulted in decreased efflux of cholesterol and phospholipids to HDL3, a major fraction of high density lipoprotein (HDL). More recently, Wang et al. (11Wang N. Lan D. Chen W. Matsuura F. Tall A.R. ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins.Proc. Natl. Acad. Sci. USA. 2004; 101: 9774-9779Google Scholar) and Nakamura et al. (12Nakamura K. Kennedy M.A. Baldan A. Bojanic D.D. Lyons K. Edwards P.A. Expression and regulation of multiple murine ATP-binding cassette transporter G1 mRNAs/isoforms that stimulate cellular cholesterol efflux to high density lipoprotein.J. Biol. Chem. 2004; 279: 45980-45989Google Scholar) reported that increased expression of ABCG1 or the closely related transporter ABCG4 in human embryonic kidney cells increased cholesterol efflux to HDL. Other studies have shown that overexpressing ABCG1 in mouse hepatocytes via adenovirus infection reduced plasma HDL levels and increased cholesterol secretion into bile, findings consistent with a role for ABCG1 in the transport of cholesterol in liver cells (13Ito T. Sabol S.L. Amar M. Knapper C. Duarte C. Shamburek R.D. Meyn S. Santamarina-Fojo S. Brewer H.B. Adenovirus-mediated expression establishes an in vivo role for human ABCG1 (ABC8) in lipoprotein metabolism.Circulation. 2000; 102: 1525Google Scholar, 14Ito T. Physiological function of ABCG1.Drug News Perspect. 2003; 16: 490-492Google Scholar). Furthermore, green-fluorescent protein-tagged human ABCG1 protein in HeLa cells was found to be localized in endocytic compartments and the plasma membrane, consistent with a role for ABCG1 in intracellular sterol trafficking as well as efflux (15Neufeld E.B. Sabol S. Remaley A.T. Ito T. Demosky S.J. Stonik J. Santamarina-Fojo S. Brewer H.B. Cellular localization and trafficking of human ABCG1.Circulation. 2001; 104: 708Google Scholar). These combined findings suggest a role for ABCG1, as yet undefined, in reverse cholesterol transport, the process whereby excess cholesterol is removed from cells, transported to the liver, and excreted into bile (16Brewer Jr., H.B. Santamarina-Fojo S. New insights into the role of the adenosine triphosphate-binding cassette transporters in high-density lipoprotein metabolism and reverse cholesterol transport.Am. J. Cardiol. 2003; 91: 3E-11EGoogle Scholar). As might be anticipated, ABCG1 gene expression is highly regulated by cholesterol. ABCG1 mRNA levels in cultured mouse and human macrophages were highly induced by lipid loading with acetyl low density lipoprotein (Ac-LDL) (10Klucken J. Buchler C. Orso E. Kaminski W.E. Porsch-Ozcurumez M. Liebisch G. Kapinsky M. Diederich W. Drobnik W. Dean M. et al.ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport.Proc. Natl. Acad. Sci. USA. 2000; 97: 817-822Google Scholar, 17Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols.J. Biol. Chem. 2000; 275: 14700-14707Google Scholar, 18Fu X. Menke J.G. Chen Y. Zhou G. MacNaul K.L. Wright S.D. Sparrow C.P. Lund E.G. 27-Hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells.J. Biol. Chem. 2001; 276: 38378-38387Google Scholar) and reduced by lipid depletion (10Klucken J. Buchler C. Orso E. Kaminski W.E. Porsch-Ozcurumez M. Liebisch G. Kapinsky M. Diederich W. Drobnik W. Dean M. et al.ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport.Proc. Natl. Acad. Sci. USA. 2000; 97: 817-822Google Scholar). Furthermore, the normally low level of ABCG1 mRNA in rat liver parenchymal cells was increased 4-fold by feeding a high-cholesterol diet (9Hoekstra M. Kruijt J.K. Eck M. Van Van Berkel T.J. Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells.J. Biol. Chem. 2003; 278: 25448-25453Google Scholar). These combined data suggest sterol-mediated regulation of ABCG1 gene expression in macrophages, which are important in the initiation of atherosclerosis and, in liver, the major tissue involved in cholesterol homeostasis. Lipid loading or a high-cholesterol diet stimulates reverse cholesterol transport through the activation of the liver X receptor (LXR) transcriptional pathway (19Repa J.J. Turley S.D. Lobaccaro J.A. Medina J. Li L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers.Science. 2000; 289: 1524-1529Google Scholar, 20Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha.Proc. Natl. Acad. Sci. USA. 2000; 97: 12097-12102Google Scholar, 21Tontonoz P. Mangelsdorf D.J. Liver X receptor signaling pathways in cardiovascular disease.Mol. Endocrinol. 2003; 17: 985-993Google Scholar). The LXR nuclear receptors LXRα and LXRβ form obligate heterodimers with retinoid X receptors (RXRs) and bind naturally occurring oxidized cholesterol derivatives such as 24(S),25-epoxycholesterol, 22(R)-, 24(S)-, and 27-hydroxycholesterol (18Fu X. Menke J.G. Chen Y. Zhou G. MacNaul K.L. Wright S.D. Sparrow C.P. Lund E.G. 27-Hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells.J. Biol. Chem. 2001; 276: 38378-38387Google Scholar, 21Tontonoz P. Mangelsdorf D.J. Liver X receptor signaling pathways in cardiovascular disease.Mol. Endocrinol. 2003; 17: 985-993Google Scholar, 22Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. LXR, a nuclear receptor that defines a distinct retinoid response pathway.Genes Dev. 1995; 9: 1033-1045Google Scholar, 23Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha.Nature. 1996; 383: 728-731Google Scholar, 24Edwards P.A. Kast H.R. Anisfeld A.M. BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis.J. Lipid Res. 2002; 43: 2-12Google Scholar) and synthetic nonsteroidal compounds such as T-0901317 (25Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. et al.Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar). RXR receptors bind the agonist 9-cis-retinoic acid (9cRA) (26Mangelsdorf D.J. Evans R.M. The RXR heterodimers and orphan receptors.Cell. 1995; 83: 841-850Google Scholar). LXR/RXR heterodimers recognize an LXR response element (LXRE) sequence containing a variant direct-repeat-4 (DR4) motif in the promoters and introns of several genes affecting lipid metabolism (22Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. LXR, a nuclear receptor that defines a distinct retinoid response pathway.Genes Dev. 1995; 9: 1033-1045Google Scholar, 27Willy P.J. Mangelsdorf D.J. Unique requirements for retinoid-dependent transcriptional activation by the orphan receptor LXR.Genes Dev. 1997; 11: 289-298Google Scholar, 28Steffensen K.R. Gustafsson J.A. Putative metabolic effects of the liver X receptor (LXR).Diabetes. 2004; 53: 36-42Google Scholar). The binding of a ligand for either LXR or RXR can activate the heterodimer submaximally to stimulate transcription, whereas ligands for both receptors are required for maximal activation (29Peet D.J. Janowski B.A. Mangelsdorf D.J. The LXRs: a new class of oxysterol receptors.Curr. Opin. Genet. Dev. 1998; 8: 571-575Google Scholar). The LXR/RXR heterodimer is normally bound to a corepressor or coactivator protein in the absence or presence of agonists, respectively (30Hu X. Li S. Wu J. Xia C. Lala D.S. Liver X receptors interact with corepressors to regulate gene expression.Mol. Endocrinol. 2003; 17: 1019-1026Google Scholar, 31Wagner B.L. Valledor A.F. Shao G. Daige C.L. Bischoff E.D. Petrowski M. Jepsen K. Baek S.H. Heyman R.A. Rosenfeld M.G. et al.Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression.Mol. Cell. Biol. 2003; 23: 5780-5789Google Scholar, 32Huuskonen J. Fielding P.E. Fielding C.J. Role of p160 coactivator complex in the activation of liver X receptor.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 703-708Google Scholar). LXR activation dramatically increases ABCG1 mRNA levels in macrophages (17Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols.J. Biol. Chem. 2000; 275: 14700-14707Google Scholar, 33Tangirala R.K. Bischoff E.D. Joseph S.B. Wagner B.L. Walczak R. Laffitte B.A. Daige C.L. Thomas D. Heyman R.A. Mangelsdorf D.J. et al.Identification of macrophage liver X receptors as inhibitors of atherosclerosis.Proc. Natl. Acad. Sci. USA. 2002; 99: 11896-11901Google Scholar). Venkateswaran et al. (17Venkateswaran A. Repa J.J. Lobaccaro J.M. Bronson A. Mangelsdorf D.J. Edwards P.A. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols.J. Biol. Chem. 2000; 275: 14700-14707Google Scholar) demonstrated that the inducibility of ABCG1 mRNA levels by oxysterols was retained in macrophages from mice lacking either of the two LXR receptor genes but was lost in mice lacking both genes, indicating that either LXRα or LXRβ can activate the ABCG1 gene. More recently, treatment of mice with T-0901317 has been shown to elevate markedly ABCG1 mRNA levels in several tissues, including liver, macrophages, and adipose tissue (12Nakamura K. Kennedy M.A. Baldan A. Bojanic D.D. Lyons K. Edwards P.A. Expression and regulation of multiple murine ATP-binding cassette transporter G1 mRNAs/isoforms that stimulate cellular cholesterol efflux to high density lipoprotein.J. Biol. Chem. 2004; 279: 45980-45989Google Scholar, 34Ulven S.M. Dalen K.T. Gustafsson J.A. Nebb H.I. Tissue-specific autoregulation of the LXRalpha gene facilitates induction of apoE in mouse adipose tissue.J. Lipid Res. 2004; 45: 2052-2062Google Scholar, 35Quinet E.M. Savio D.A. Halpern A.R. Chen L. Miller C.P. Nambi P. Gene-selective modulation by a synthetic oxysterol ligand of the liver X receptor.J. Lipid Res. 2004; 45: 1929-1942Google Scholar). LXR activation also strongly activates transcription of the gene for the important cholesterol/phospholipid transporter ABCA1, which stimulates efflux to circulating apolipoprotein A-I (19Repa J.J. Turley S.D. Lobaccaro J.A. Medina J. Li L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers.Science. 2000; 289: 1524-1529Google Scholar, 20Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha.Proc. Natl. Acad. Sci. USA. 2000; 97: 12097-12102Google Scholar, 36Schwartz K. Lawn R.M. Wade D.P. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR.Biochem. Biophys. Res. Commun. 2000; 274: 794-802Google Scholar, 37Costet P. Luo Y. Wang N. Tall A.R. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor.J. Biol. Chem. 2000; 275: 28240-28245Google Scholar). By the activation of the ABCA1, ABCG1, and other genes, the LXR pathway is critical to the regulation of cholesterol homeostasis, as well as the prevention of cholesterol accumulation in macrophages leading to atherosclerosis (19Repa J.J. Turley S.D. Lobaccaro J.A. Medina J. Li L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers.Science. 2000; 289: 1524-1529Google Scholar, 21Tontonoz P. Mangelsdorf D.J. Liver X receptor signaling pathways in cardiovascular disease.Mol. Endocrinol. 2003; 17: 985-993Google Scholar, 33Tangirala R.K. Bischoff E.D. Joseph S.B. Wagner B.L. Walczak R. Laffitte B.A. Daige C.L. Thomas D. Heyman R.A. Mangelsdorf D.J. et al.Identification of macrophage liver X receptors as inhibitors of atherosclerosis.Proc. Natl. Acad. Sci. USA. 2002; 99: 11896-11901Google Scholar). The human ABCG1 gene on chromosome 21q22.3 is relatively expansive and subject to alternative RNA splicing (38Langmann T. Porsch-Ozcurumez M. Unkelbach U. Klucken J. Schmitz G. Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene.Biochim. Biophys. Acta. 2000; 1494: 175-180Google Scholar, 39Lorkowski S. Rust S. Engel T. Jung E. Tegelkamp K. Galinski E.A. Assmann G. Cullen P. Genomic sequence and structure of the human ABCG1 (ABC8) gene.Biochem. Biophys. Res. Commun. 2001; 280: 121-131Google Scholar, 40Kennedy M.A. Venkateswaran A. Tarr P.T. Xenarios I. Kudoh J. Shimizu N. Edwards P.A. Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein.J. Biol. Chem. 2001; 276: 39438-39447Google Scholar). The major transcript is derived from 15 exons spanning a region of 78.1 kb (38Langmann T. Porsch-Ozcurumez M. Unkelbach U. Klucken J. Schmitz G. Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene.Biochim. Biophys. Acta. 2000; 1494: 175-180Google Scholar). Its promoter region is highly GC-rich and lacks a TATA box; furthermore, the transcription start site(s) have not been adequately determined previously. Efforts to find a functional LXRE in the promoter and upstream region of the human ABCG1 gene have been unsuccessful (41Schmitz G. Langmann T. Heimerl S. Role of ABCG1 and other ABCG family members in lipid metabolism.J. Lipid Res. 2001; 42: 1513-1520Google Scholar). Kennedy et al. (40Kennedy M.A. Venkateswaran A. Tarr P.T. Xenarios I. Kudoh J. Shimizu N. Edwards P.A. Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein.J. Biol. Chem. 2001; 276: 39438-39447Google Scholar) reported two putative LXREs in the second intron 2To prevent confusion and to facilitate cross-species comparison, in this study, we number human ABCG1 exons and introns according to the table of Langmann et al. (38Langmann T. Porsch-Ozcurumez M. Unkelbach U. Klucken J. Schmitz G. Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene.Biochim. Biophys. Acta. 2000; 1494: 175-180Google Scholar), which lists exons of the originally described and apparently major ABCG1 mRNA transcript (GenBank accessions BC029158, NM_004915, and NM_016818) initiated at the promoter shown in Fig. 2. Transcripts initiating at this promoter actually consist of two alternatively spliced isoforms differing by the presence or absence of 36 coding bases, because of the presence of two alternate splice donor sites at the end of exon 9 (4Chen H. Rossier C. Lalioti M.D. Lynn A. Chakravarti A. Perrin G. Antonarakis S.E. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.Am. J. Hum. Genet. 1996; 59: 66-75Google Scholar). of the human gene; however, these sequences are not conserved in the mouse and rat ABCG1 genes. Very recently, Nakamura et al. (12Nakamura K. Kennedy M.A. Baldan A. Bojanic D.D. Lyons K. Edwards P.A. Expression and regulation of multiple murine ATP-binding cassette transporter G1 mRNAs/isoforms that stimulate cellular cholesterol efflux to high density lipoprotein.J. Biol. Chem. 2004; 279: 45980-45989Google Scholar) published preliminary evidence for a different set of LXREs in the second intron of the mouse ABCG1 gene. Vertebrate genomes are now known to contain regions of evolutionarily conserved sequence far from exons and promoters that regulate gene transcription over large distances (42Margulies E.H. Blanchette M. Haussler D. Green E.D. Identification and characterization of multi-species conserved sequences.Genome Res. 2003; 13: 2507-2518Google Scholar, 43Dermitzakis E.T. Reymond A. Lyle R. Scamuffa N. Ucla C. Deutsch S. Stevenson B.J. Flegel V. Bucher P. Jongeneel C.V. et al.Numerous potentially functional but non-genic conserved sequences on human chromosome 21.Nature. 2002; 420: 578-582Google Scholar, 44Nobrega M.A. Ovcharenko I. Afzal V. Rubin E.M. Scanning human gene deserts for long-range enhancers.Science. 2003; 302: 413Google Scholar). Adopting this perspective in the present study, we have employed evolutionary conservation as a criterion for identifying potentially functional and important LXREs in and near the human ABCG1 gene. We report the characterization of two novel, robustly active, and evolutionarily conserved LXREs (LXRE-A and LXRE-B) in the first and second introns 2To prevent confusion and to facilitate cross-species comparison, in this study, we number human ABCG1 exons and introns according to the table of Langmann et al. (38Langmann T. Porsch-Ozcurumez M. Unkelbach U. Klucken J. Schmitz G. Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene.Biochim. Biophys. Acta. 2000; 1494: 175-180Google Scholar), which lists exons of the originally described and apparently major ABCG1 mRNA transcript (GenBank accessions BC029158, NM_004915, and NM_016818) initiated at the promoter shown in Fig. 2. Transcripts initiating at this promoter actually consist of two alternatively spliced isoforms differing by the presence or absence of 36 coding bases, because of the presence of two alternate splice donor sites at the end of exon 9 (4Chen H. Rossier C. Lalioti M.D. Lynn A. Chakravarti A. Perrin G. Antonarakis S.E. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.Am. J. Hum. Genet. 1996; 59: 66-75Google Scholar). of the human ABCG1 gene and demonstrate their functionality in cultured macrophage and hepatic cell lines. These studies enhance our understanding of the mechanisms by which oxysterols upregulate human ABCG1 transcription in two key tissues, liver and macrophages, where changes in ABCG1 expression and cellular cholesterol efflux may markedly alter cholesterol balance and atherogenesis. T-0901317 (25Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. et al.Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar) was purchased from Cayman Chemical Co. (Ann Arbor, MI). 22(R)-hydroxycholesterol (22-OH-cholesterol) and 9cRA were from Sigma (St. Louis, MO). Stock solutions were dissolved in 95% ethanol. Human genomic DNA and total RNA from placenta and liver were from Clontech (Palo Alto, CA). RAW264.7 mouse macrophage and HepG2 human hepatoma cells [American Type Culture Collection (ATCC); Manassas, VA] were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. For mRNA studies, cells were grown in 75 cm2 flasks until 60–70% confluency was reached. The medium was changed to serum-free DMEM containing 1 mg/ml BSA, and the cells were treated with LXR/RXR agonist drug(s) or vehicle for 12 h. All experimental conditions were tested in triplicate flasks. Total RNA was isolated using Trizol reagent (Invitrogen; Carlsbad, CA) as instructed by the manufacturer. Ten micrograms RAW264.7 total RNA/lane were electrophoresed on a 1% agarose gel, blotted onto ZetaProbe GT membranes (Bio-Rad; Hercules, CA), and probed with a 32P-labeled 252 bp DNA corresponding to bases 1,052–1,303 of the mouse ABCG1 cDNA sequence in GenBank accession NM_009593, using standard methods for Northern blotting. Radioactive bands were visualized, quantitated on a phosphorimager (model 445SI; Molecular Dynamics, Sunnyvale, CA), and normalized to intensities of cyclophilin mRNAs obtained after rehybridizing the blot with a probe for mouse cyclophilin A (Ambion; Austin, TX, #7375). ABCG1 mRNA in HepG2 cells was detected by RT-PCR of first-strand cDNA prepared from total RNA using SuperScript II reverse transcriptase (Invitrogen). The forward and reverse PCR primers were GCCACTTTCGTGGGCCCAGTGA and TCTCATCACCAGCTGTGTTGCA, which amplifies a 658 bp sequence within exons 14–15 (bases 1,763–2,420 in GenBank accession BC029158). Touchdown PCR reactions containing Taq polymerase and 1 μl of cDNA synthesis reaction were carried out at annealing temperatures of 63°C, 61°C, and 59°C for 5 cycles each, followed by 57°C for 25 cycles. Aliquots (12.5 μl) were analyzed on a 1.2% agarose gel containing 0.5 μg/ml ethidium bromide and photographed in a ChemiImager 5500 (Alpha Innotech; San Leandro, CA). Livers of 3-month-old C57Bl/6 male mice were perfused through the vena cava and common bile duct with 3–4 ml of Liver Perfusion Medium (Invitrogen/Gibco, #17701) followed by 4–8 ml of a solution containing 7.5 mg/ml collagenase Type 1 (Worthington; Lakewood, NJ, #LS004196) and 10 μl/ml protease inhibitor cocktail (Sigma, #P8340) in Hanks balanced saline solution (Gibco, #14175) supplemented with 10 mM CaCl2/10 mM Hepes (Gibco #15630) at 37°C. The liver was dispersed by mincing and trituration in a large-bore pipette, and the suspension was passed through a nylon cell strainer (100 μm pore; BD-Falcon #352360, BD-Bioscience, Bedford, MA). Hepatocytes were separated from smaller liver cell types by washing with Hepatocyte Wash Medium (Gibco, #17704) followed by centrifugations at 50 g for 5 min five to six times, after which the cells were judged by light microscopy to be entirely (>99.5%) hepatocytes. The isolated, washed hepatocytes were plated in 6-well poly-lysine-coated plates (BD-BioCoat, #354413) at a density of 106 cells/well in DMEM/F12 (Gibco, #11039) supplemented with penicillin-streptomycin-glutamine and 10% fetal bovine serum. Cells were treated with 1 μM T-0901317 and/or 10 μM 9cRA, or solvent alone (ethanol, final 0.2%) for 16 h. Total RNA was isolated using the Ultraspec-RNA reagent (Biotecx; Houston, TX) according to the manufacturer's instructions. For Northern blot analysis, approximately 5 μg of total RNA per lane were electrophoresed and hybridized with the mouse ABCG1 cDNA probe, and subsequently with the mouse cyclophilin A probe, as described above for cell lines. The densities of the major ABCG1 mRNA band were quantitated with ChemiImager 5500 software and normalized to cyclophilin A mRNA band intensities, and independently to 18S and 28S rRNA band intensities. Transcription start sites were determined by 5′-rapid amplification of cDNA ends (RACE) through use of the Smart RACE cDNA Amplification Kit (Clontech). The gene-specific primer was TGGAGTGCCTTCGGGTCGCGAAGAGGAG, which is complementary to bases 176–203 of the coding sequence of human ABCG1 in exon 2, 2To prevent confusion and to facilitate cross-species comparison, in this study,
Referência(s)