Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Interacting JNK-docking Sites in MKK7 Promote Binding and Activation of JNK Mitogen-activated Protein Kinases

2006; Elsevier BV; Volume: 281; Issue: 19 Linguagem: Inglês

10.1074/jbc.m601010200

ISSN

1083-351X

Autores

David Ho, A. Jane Bardwell, Seema Grewal, Corey Iverson, Lee Bardwell,

Tópico(s)

Microbial Metabolism and Applications

Resumo

D-sites are a class of MAPK-docking sites that have been found in many MAPK regulators and substrates. A single functional, high affinity D-site has been identified near the N terminus of each of the MAPK kinases (MKKs or MEKs) MEK1, MEK2, MKK3, MKK4, and MKK6. Here we demonstrated that MKK7 recognizes its target JNK by a novel mechanism involving a partially cooperative interaction of three low affinity D-sites in the N-terminal domain of MKK7. Mutations of the conserved residues within any one of the three docking sites (D1, D2, and D3) disrupted the ability of the N-terminal domain of MKK7β to bind JNK1 by about 50–70%. Moreover, mutation of any two of the three D-sites reduced binding by about 80–90%, and mutation of all three reduced binding by 95%. Full-length MKK7 containing combined D1/D2 mutations was compromised for binding to JNK1 and exhibited reduced JNK1 kinase activity when compared with wild-type MKK7. Peptide versions of the D-sites from MKK4 or the JIP-1 scaffold protein inhibited MKK7-JNK binding, suggesting that all three JNK regulators bind to the same region of JNK. Moreover, peptide versions of any of the three D-sites of MKK7 inhibited the ability of JNK1 and JNK2 to phosphorylate their transcription factor substrates c-Jun and ATF2, suggesting that D-site-containing substrates also compete with MKK7 for docking to JNK. Finally, MKK7-derived D-site peptides exhibited selective inhibition of JNK1 versus ERK2. We conclude that MKK7 contains three JNK-docking sites that interact to selectively bind JNK and contribute to JNK signal transmission and specificity. D-sites are a class of MAPK-docking sites that have been found in many MAPK regulators and substrates. A single functional, high affinity D-site has been identified near the N terminus of each of the MAPK kinases (MKKs or MEKs) MEK1, MEK2, MKK3, MKK4, and MKK6. Here we demonstrated that MKK7 recognizes its target JNK by a novel mechanism involving a partially cooperative interaction of three low affinity D-sites in the N-terminal domain of MKK7. Mutations of the conserved residues within any one of the three docking sites (D1, D2, and D3) disrupted the ability of the N-terminal domain of MKK7β to bind JNK1 by about 50–70%. Moreover, mutation of any two of the three D-sites reduced binding by about 80–90%, and mutation of all three reduced binding by 95%. Full-length MKK7 containing combined D1/D2 mutations was compromised for binding to JNK1 and exhibited reduced JNK1 kinase activity when compared with wild-type MKK7. Peptide versions of the D-sites from MKK4 or the JIP-1 scaffold protein inhibited MKK7-JNK binding, suggesting that all three JNK regulators bind to the same region of JNK. Moreover, peptide versions of any of the three D-sites of MKK7 inhibited the ability of JNK1 and JNK2 to phosphorylate their transcription factor substrates c-Jun and ATF2, suggesting that D-site-containing substrates also compete with MKK7 for docking to JNK. Finally, MKK7-derived D-site peptides exhibited selective inhibition of JNK1 versus ERK2. We conclude that MKK7 contains three JNK-docking sites that interact to selectively bind JNK and contribute to JNK signal transmission and specificity. Mitogen-activated protein kinases (MAPKs) 4The abbreviations used are: MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; MEK, MAPK/ERK kinase; JNK, c-Jun N-terminal kinase; GST, glutathione S-transferase; MKK, MAPK kinase. are essential components of eukaryotic signal transduction networks that enable cells to respond appropriately to extracellular signals and stresses. In mammalian organisms, the following four major MAPK cascades have been characterized: ERK1/2, ERK5, p38, and JNK pathways (1Chang L. Karin M. Nature. 2001; 410: 37-40Crossref PubMed Scopus (4398) Google Scholar). Each cascade contains three sequentially acting protein kinases collectively known as a MAPK module (2Enslen H. Davis R.J. Biol. Cell. 2001; 93: 5-14Crossref PubMed Scopus (115) Google Scholar). This module consists of a MAPK/ERK kinase kinase (MEKK or MAP3K), which activates a downstream MAPK/ERK kinase (MEK, MKK, or MAP2K) that subsequently activates a particular set of MAPKs (2Enslen H. Davis R.J. Biol. Cell. 2001; 93: 5-14Crossref PubMed Scopus (115) Google Scholar). Activated MAPKs further propagate the signal by phosphorylating downstream targets such as transcription factors and other kinases. How this ubiquitous versatile module achieves specific coupling of signal to cellular response is an important and unresolved issue that is currently the subject of intense investigation (3Morrison D.K. Davis R.J. Annu. Rev. Cell Dev. Biol. 2003; 19: 91-118Crossref PubMed Scopus (652) Google Scholar, 4Schwartz M.A. Madhani H.D. Annu. Rev. Genet. 2004; 38: 725-748Crossref PubMed Scopus (199) Google Scholar, 5Ebisuya M. Kondoh K. Nishida E. J. Cell Sci. 2005; 118: 2997-3002Crossref PubMed Scopus (271) Google Scholar, 6Komarova N.L. Zou X. Nie Q. Bardwell L. Mol. Syst. Biol. 2005; doi: 10.1038/msb4100031PubMed Google Scholar, 7Flatauer L.J. Zadeh S.F. Bardwell L. Mol. Cell. Biol. 2005; 25: 1793-1803Crossref PubMed Scopus (57) Google Scholar). The c-Jun N-terminal kinase (JNK) pathway responds primarily to extracellular stress such as UV radiation and cytokines such as interleukin-1 (8Kyriakis J.M. Avruch J. Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2885) Google Scholar, 9Davis R.J. Cell. 2000; 103: 239-252Abstract Full Text Full Text PDF PubMed Scopus (3646) Google Scholar, 10Weston C.R. Davis R.J. Curr. Opin. Genet. Dev. 2002; 12: 14-21Crossref PubMed Scopus (607) Google Scholar, 11Barr R.K. Bogoyevitch M.A. Int. J. Biochem. Cell Biol. 2001; 33: 1047-1063Crossref PubMed Scopus (220) Google Scholar). Dependent upon such factors as cell type and the nature of the stimulus, JNK has been shown to promote either cell survival or apoptosis (12Shaulian E. Karin M. Nat. Cell Biol. 2002; 4: E131-E136Crossref PubMed Scopus (2224) Google Scholar, 13Lin A. BioEssays. 2002; 25: 17-24Crossref Scopus (369) Google Scholar, 14Liu J. Lin A. Cell Res. 2005; 15: 36-42Crossref PubMed Scopus (601) Google Scholar). Deregulation of the JNK pathway has been implicated in the pathogenesis of many human diseases such as cancer (15Kennedy N.J. Sluss H.K. Jones S.N. Bar-Sagi D. Flavell R.A. Davis R.J. Genes Dev. 2003; 17: 629-637Crossref PubMed Scopus (127) Google Scholar), obesity and diabetes (16Hirosumi J. Tuncman G. Chang L. Gorgun C.Z. Uysal K.T. Maeda K. Karin M. Hotamisligil G.S. Nature. 2002; 420: 333-336Crossref PubMed Scopus (2636) Google Scholar), muscular dystrophy (17Kolodziejczyk S.M. Walsh G.S. Balazsi K. Seale P. Sandoz J. Hierlihy A.M. Rudnicki M.A. Chamberlain J.S. Miller F.D. Megeney L.A. Curr. Biol. 2001; 11: 1278-1282Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), arthritis (18Han Z. Boyle D.L. Chang L. Bennett B. Karin M. Yang L. Manning A.M. Firestein G.S. J. Clin. Investig. 2001; 108: 73-81Crossref PubMed Scopus (721) Google Scholar), Alzheimer disease (19Yoshida H. Hastie C.J. McLauchlan H. Cohen P. Goedert M. J. Neurochem. 2004; 90: 352-358Crossref PubMed Scopus (140) Google Scholar), and Parkinson disease (20Xia X.G. Harding T. Weller M. Bieneman A. Uney J.B. Schulz J.B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 10433-10438Crossref PubMed Scopus (213) Google Scholar). Inhibition of JNK activity is being considered as a possible therapy for many of these diseases (21Wang W. Shi L. Xie Y. Ma C. Li W. Su X. Huang S. Chen R. Zhu Z. Mao Z. Han Y. Li M. Neurosci. Res. 2004; 48: 195-202Crossref PubMed Scopus (132) Google Scholar, 22Kaneto H. Nakatani Y. Miyatsuka T. Kawamori D. Matsuoka T.-A. Matsuhisa M. Kajimoto Y. Ichijo H. Yamasaki Y. Hori M. Nat. Med. 2004; 10: 1128-1132Crossref PubMed Scopus (299) Google Scholar, 23Waetzig V. Herdegen T. Trends Pharmacol. Sci. 2005; 26: 455-461Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 24Manning A.M. Davis R.J. Nat. Rev. Drug Discov. 2003; 2: 554-565Crossref PubMed Scopus (537) Google Scholar). The JNK family of MAPKs is encoded by the three genes JNK1, JNK2, and JNK3. JNK1 and JNK2 have ubiquitous expression profiles, whereas JNK3 is primarily found in neural tissue (9Davis R.J. Cell. 2000; 103: 239-252Abstract Full Text Full Text PDF PubMed Scopus (3646) Google Scholar). The three JNK proteins are regulated by two MAPK kinases-MKK4 (also called JNKK1 or SEK1) and MKK7/JNKK2/SEK2 (25Holland P.M. Suzanne M. Campbell J.S. Noselli S. Cooper J.A. J. Biol. Chem. 1997; 272: 24994-24998Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 26Tournier C. Whitmarsh A.J. Cavanagh J. Barrett T. Davis R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7337-7342Crossref PubMed Scopus (340) Google Scholar, 27Moriguchi T. Toyoshima F. Masuyama N. Hanafusa H. Gotoh Y. Nishida E. EMBO J. 1997; 16: 7045-7053Crossref PubMed Google Scholar, 28Yao Z. Diener K. Wang X.S. Zukowski M. Matsumoto G. Zhou G. Mo R. Sasaki T. Nishina H. Hui C.C. Tan T.H. Woodgett J.P. Penninger J.M. J. Biol. Chem. 1997; 272: 32378-32383Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 29Wu Z. Wu J. Jacinto E. Karin M. Mol. Cell. Biol. 1997; 17: 7407-7416Crossref PubMed Scopus (95) Google Scholar, 30Lu X. Nemoto S. Lin A. J. Biol. Chem. 1997; 272: 24751-24754Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Optimal activation of JNK requires the activity of both MKK4 and MKK7; although both MEKs are capable of dual phosphorylation of JNK at the activation loop residues Thr and Tyr, MKK4 prefers the Tyr and MKK7 prefers the Thr (31Lawler S. Fleming Y. Goedert M. Cohen P. Curr. Biol. 1998; 8: 1387-1390Abstract Full Text Full Text PDF PubMed Google Scholar, 32Kishimoto H. Nakagawa K. Watanabe T. Kitagawa D. Momose H. Seo J. Nishitai G. Shimizu N. Ohata S. Tanemura S. Asaka S. Goto T. Fukushi H. Yoshida H. Suzuki A. Sasaki T. Wada T. Penninger J.M. Nishina H. Katada T. J. Biol. Chem. 2003; 278: 16595-16601Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). MKK4 is primarily activated by environmental stresses, whereas MKK7 is primarily activated by cytokines (10Weston C.R. Davis R.J. Curr. Opin. Genet. Dev. 2002; 12: 14-21Crossref PubMed Scopus (607) Google Scholar, 33Tournier C. Dong C. Turner T.K. Jones S.N. Flavell R.A. Davis R.J. Genes Dev. 2001; 15: 1419-1426Crossref PubMed Scopus (302) Google Scholar). Genetic studies in mice support a critical role for MKK7 in several aspects of cell and organismal physiology. MKK7 is essential for liver formation during embryogenesis; furthermore, loss of MKK7 in fibroblasts results in premature senescence and G2/M cell cycle arrest (34Wada T. Joza N. Cheng H.Y. Sasaki T. Kozieradzki I. Bachmaier K. Katada T. Schreiber M. Wagner E.F. Nishina H. Penninger J.M. Nat. Cell Biol. 2004; 6: 215-226Crossref PubMed Scopus (122) Google Scholar). In contrast, MKK7 is a negative regulator of cell growth in multiple hematopoietic lineages (35Sasaki T. Wada T. Kishimoto H. Irie-Sasaki J. Matsumoto G. Goto T. Yao Z. Wakeham A. Mak T.W. Suzuki A. Cho S.K. Zuniga-Pflucker J.C. Oliveira-dos-Santos A.J. Katada T. Nishina H. Penninger J.M. J. Exp. Med. 2001; 194: 757-768Crossref PubMed Scopus (54) Google Scholar). MAPK-docking sites are found in the N-terminal regulatory domains of many MKKs, where they contribute to accurate and efficient enzyme-substrate recognition by promoting the formation of relatively stable, high affinity MKK·MAPK complexes (2Enslen H. Davis R.J. Biol. Cell. 2001; 93: 5-14Crossref PubMed Scopus (115) Google Scholar). This paradigm of MAPK recognition was first established for the yeast MEK Ste7 (36Bardwell L. Cook J.G. Chang E.C. Cairns B.R. Thorner J. Mol. Cell. Biol. 1996; 16: 3637-3650Crossref PubMed Scopus (133) Google Scholar, 37Bardwell L. Thorner J. Trends Biochem. Sci. 1996; 21: 373-374Abstract Full Text PDF PubMed Scopus (104) Google Scholar, 38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar) and has since been extended to mammalian MEK1 (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 39Xu B. Wilsbacher J.L. Collisson T. Cobb M.H. J. Biol. Chem. 1999; 274: 34029-34035Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), MEK2 (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar), MKK3 and MKK6 (2Enslen H. Davis R.J. Biol. Cell. 2001; 93: 5-14Crossref PubMed Scopus (115) Google Scholar), MKK4 (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), and MEK5 (41Seyfried J. Wang X. Kharebava G. Tournier C. Mol. Cell. Biol. 2005; 25: 9820-9828Crossref PubMed Scopus (36) Google Scholar). The MAPK-docking sites in many MKKs, including yeast Ste7 and human MEK1/2, MKK3/6, and MKK4, share a core consensus sequence consisting of a cluster of about three basic residues, followed by a short spacer of 1–6 residues, and finally a hydrophobic-X-hydrophobic submotif (Fig. 1B) (37Bardwell L. Thorner J. Trends Biochem. Sci. 1996; 21: 373-374Abstract Full Text PDF PubMed Scopus (104) Google Scholar, 38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Hereafter, we shall refer to this class of MAPK-docking sites as "D-sites." D-sites have also been found in MAPK scaffolds, phosphatases, and substrates (2Enslen H. Davis R.J. Biol. Cell. 2001; 93: 5-14Crossref PubMed Scopus (115) Google Scholar, 42Kusari A.B. Molina D.M. Sabbagh W. Jr-Lau C.S. Bardwell L. J. Cell Biol. 2004; 164: 267-277Crossref PubMed Scopus (64) Google Scholar, 43Sharrocks A.D. Yang S.H. Galanis A. Trends Biochem. Sci. 2000; 25: 448-453Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar). D-sites in MKKs are crucial for the activation of their cognate MAPKs in vivo (44Enslen H. Brancho D.M. Davis R.J. EMBO J. 2000; 19: 1301-1311Crossref PubMed Scopus (187) Google Scholar, 45Grewal S. Molina D.M. Bardwell L. Cell. Signal. 2006; 18: 123-134Crossref PubMed Scopus (35) Google Scholar), where they function as portable, modular motifs that primarily serve to tether their cognate MAPKs near the kinase domain of MKKs (45Grewal S. Molina D.M. Bardwell L. Cell. Signal. 2006; 18: 123-134Crossref PubMed Scopus (35) Google Scholar). D-sites also display some selectivity in binding to MAPKs, suggesting a role in specificity (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 46Barsyte-Lovejoy D. Galanis A. Sharrocks A.D. J. Biol. Chem. 2002; 277: 9896-9903Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). For example, the D-sites in MEK1 and MEK2 do not bind effectively to JNK2 (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). As noted above, functional D-sites have been characterized in MEK/MKK1–4 and MKK6. MEK5 does not contain a D-site but instead contains a novel MAPK-docking site of acidic character (41Seyfried J. Wang X. Kharebava G. Tournier C. Mol. Cell. Biol. 2005; 25: 9820-9828Crossref PubMed Scopus (36) Google Scholar). No MAPK-docking site has heretofore been identified in MKK7; however, the N-terminal domain of the MKK7β isoform (the most prevalent isoform in humans) has been shown to be necessary and sufficient for high affinity complex formation with JNK1 (47Tournier C. Whitmarsh A.J. Cavanagh J. Barrett T. Davis R.J. Mol. Cell. Biol. 1999; 19: 1569-1581Crossref PubMed Google Scholar, 48Bardwell A.J. Abdollahi M. Bardwell L. Biochem. J. 2004; 378: 569-577Crossref PubMed Scopus (85) Google Scholar). Here we demonstrate that the N terminus of MKK7β contains three weak D-sites that interact in a partially additive, partially synergistic manner to create a high affinity JNK-docking platform. Genes—The MKK7β1 clone used in this paper corresponds to GenBankTM accession number NM_005043. Accession numbers of other genes used in this study have been given in an earlier work (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). Proteins and Antisera—Fusions of glutathione S-transferase (GST) to human c-Jun-(1–89), ATF2-(19–96), and Elk-1-(307–428) were purchased from Cell Signaling Technology. Activated JNK1α1 and JNK2α2 and unactivated JNK1α1 were purchased from Upstate Cell Signaling Solutions. Activated mouse ERK2 was purchased from New England Biolabs. Anti-FLAG M2 monoclonal and anti-FLAG polyclonal antibodies were purchased from Sigma. Anti-V5 was purchased from Invitrogen. Plasmids for in Vitro Transcription and Translation—Plasmids pGEM-MKK7β1 (48Bardwell A.J. Abdollahi M. Bardwell L. Biochem. J. 2004; 378: 569-577Crossref PubMed Scopus (85) Google Scholar) and pGEM-MKK4 (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) have been described previously. To construct pGEM-JNK1, the JNK1α1 coding region was amplified by high fidelity PCR using Pfu DNA polymerase, primers JNK1α1up and JNK1α1down1 (see Table 1), and Genestorm clone ID RG000191 (Invitrogen) as the template. The PCR product was digested with BamHI and SalI and inserted into the corresponding sites in pGEM4Z (Promega).TABLE 1Oligonucleotides used in this studyNameSequence (5′ → 3′)UseJB812BGCGGGATCCACCATGGCGGCGTCCTCCCTGpGEX-MKK7 (1-38, 1-60, 1-85), pGEM-MKK7JB818CCGCTCGACCTACCTGAAGAAGGGGCGGTGpGEM-MKK7MKK7-(1-38)-RGGCGTCGACTCACCGCTGGGGGCTGATATCCAGpGEX-MKK7-(1-38)MKK7-(1-60)-RGGCGTCGACGCTCTCTGAGGATGGCGAGCGGpGEX-MKK7-(1-60)MKK7-(1-85)-RGGCGTCGACGCGGGGTGTGAACAGGGTTGpGEX-MKK7-(1-85)M7For-(35-49)GATCCAGCCCACAGCGGCCCAGGCCCACCCTGCAGCTCCCGCTGGCCAACGpGEX-MKK7-D2MKK7Rev-(35-49)TCGACGTTGGCCAGCGGGAGCTGCAGGGTGGGCCTGGGCCGCTGTGGGCTGpGEX-MKK7-D2MKK7For-(67-80)GATCCCCTCCAGCTCGACCTCGACACATGCTGGGACTCCCTTCAACCTGAGpGEX-MKK7-D3MKK7Rev-(67-80)TCGACTCAGGTTGAAGGGAGTCCCAGCATCTGTCGAGGTCGAGCTGGAGGGpGEX-MKK7-D3MKK4For-(36-49)GATCCAGCATGCAGGGTAAACGCAAAGCACTGAAGTTGAATTTTGCAGpGEX-MKK4-DsMKK4Rev-(36-49)TCGACTGCAAAATTCAACTTCAGTGCTTTGCGTTTACCCTGCATGCTGpGEX-MKK4-DsMKK7D1mutForGAGAACCGGGAGGCCGAGGAGGAGATCGACGCCAACGCGGATATCAGCCCGCAGCGGCCCAGGpGEX-MKK7 D1 mutants, pcDNA-MKK7-D12-FLAGMKK7D1mutRevCCTGGGCCGCTCGGGCTGATATCCGCGTTGGCGTCGATCTCCTCCTCGGCCTCCCGGTTCTCpGEX-MKK7 D1 mutants, pcDNA-MKK7-D12-FLAGMKK7D2mutForCCTCAACCTGGATATCAGCCCGCAGGAGCCCGAGCCCACCGCGCAGGCCCGGCTGGCCAACGATGGGpGEX-MKK7 D2 mutants pcDNA-MKK7-D12-FLAGMKK7D2mutRevCCCATCGTTGGCCAGCCGGGCCTGCGCGGTGGGCTCGGGCTCCTGCGGGCTGATATCCAGGTTGAGGpGEX-MKK7 D2 mutants pcDNA-MKK7-D12-FLAGMKK7D3mutForCCCGCAGCACCCGACGCCACCCGCCGAGCCCGAACACATGGCGGGCCTCCCGTCAACCCTGTTCACACpGEX-MKK7D3 mutantsMKK7D3mutRevGTGTGAACAGGGTTGACGGGAGGCCCGCCATGTGTTCGGGCTCGGCGGGTGGCGTCGGGTGCTGCGGGpGEX-MKK7D3 mutantsMKK7D2mutFixFGCCAACGCGGATATCAGCCCGCAGGAGCCCGAGCCCACCGCGCAGGCCpGEX-MKK7 D12 mutants pcDNA-MKK7-D12-FLAGMKK7D2mutFixRGGCCTGCGCGGTGGGCTCGGGCTCCTGCGGGCTGATATCCGCGTTGGCpGEX-MKK7 D12 mutants pcDNA-MKK7-D12-FLAGMKK7KDFor2CAGGCCACATCATTGCTGTTGCGCAAATGCGGCGCTCTGGGAACpcDNA-MKK7-KD-FLAGMKK7KDRev2GTTCCCAGAGCGCCGCATTTGCGCAACAGCAATGATGTGGCCTGpcDNA-MKK7-KD-FLAG Open table in a new tab Plasmids for the Production of GST Fusion Proteins—The vector used for generating the GST fusion proteins was pGEXLB (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar), a derivative of pGEX-4T-1 (Amersham Biosciences). In pGEXLB, an encoded Pro residue is replaced with a Gly-Gly-Gly-Gly-Gly-Ser-Gly sequence to promote the independent functioning of the GST and fusion moieties. The cloning of pGEXLB-JNK1α1 was described previously (48Bardwell A.J. Abdollahi M. Bardwell L. Biochem. J. 2004; 378: 569-577Crossref PubMed Scopus (85) Google Scholar). To generate GST-MKK7-(1–85), GST-MKK7-(1–60), and GST-MKK7-(1–38), PCR was used to amplify the specific fragments and introduce a BamHI at the N terminus and a SalI site at the C terminus. The primers used are shown in Table 1; a human MKK7β1 cDNA clone (48Bardwell A.J. Abdollahi M. Bardwell L. Biochem. J. 2004; 378: 569-577Crossref PubMed Scopus (85) Google Scholar) was used as the template. The PCR products were digested with BamHI and SalI and subsequently inserted into the appropriate sites on pGEX-LB. To generate the plasmids for GST fused to the independent MKK7β-docking sites (see Fig. 3), an adaptor oligonucleotide approach was used. pGEX-LB was cut with BamHI and SalI, and the polylinker insert was removed. The excised fragment was replaced by annealed oligonucleotide pairs that encoded the independent docking sites. To encode MKK7-D2, the oligonucleotide pair used was MKK7For 35–49 and MKK7Rev 35–49; for MKK7-D3, MKK7For 67–80 and MKK7Rev 67–80; for the D-site from MKK4, MKK4For 36–49 and MKK4Rev 36–49 (Table 1). Site-directed mutagenesis (Quickchange, Stratagene) was used to generate the GST-MKK7-(1–85)-docking site mutant constructs used in Fig. 4. The template used in these mutagenesis reactions was pGEM-MKK7-(1–85). The following complement primers were used to mutate each respective docking site as follows: for D1, MKK7D1mutFor and MKK7D1mutRev; for D2, MKK7D2mutFor and MKK7D2mutRev; and for D3, MKK7D3mutFor and MKK7D3mutRev (Table 1). The double and triple D-site mutants were generated by mutating one D-site at a time. The D12 and D123 mutants required an additional primer pair to correct the return to wild-type caused by the D1 mutation primers. The accuracy of all mutant constructs was verified by sequencing. Plasmids for Tissue Culture Transfections—To generate pcDNA3.1-MKK7β1-FLAG ("MKK7-FLAG"), containing full-length MKK7β1 tagged at its C terminus with the FLAG epitope, the MKK7β1 coding sequence was inserted into the pcDNA3.1/FLAG vector using the HindIII and KpnI sites. MKK7-KD-FLAG, a catalytically inactive ("kinase dead") mutant (K149A) of MKK7-FLAG, was created by site-directed mutagenesis using primers MKK7KDFor2 and MKK7KDRev2. MKK7-D12-FLAG, the D1/D2 double mutant of MKK7-FLAG, was created using the same primers and site-directed mutagenesis procedure used to make the MKK7-(1–85)-D12 mutant described above. Mutant constructs were confirmed by sequencing the full-length coding sequence. Plasmid pcDNA3.1-JNK1α1-V5-His, encoding C-terminally epitope-tagged JNK1, was obtained from the Invitrogen. Transcription and Translation in Vitro—Proteins labeled with [35S]methionine were produced by coupled transcription and translation reactions, partially purified by ammonium sulfate precipitation, and quantified as described previously (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Binding Assays—GST fusion proteins were expressed in bacteria and purified by affinity chromatography using glutathione-Sepharose (Amersham Biosciences) and quantified as described elsewhere (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Binding assays were performed, analyzed, and quantified as described previously (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Dissociation constant (Kd) estimates are calculated from multiple replicate experiments (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar); an example is shown in Table 2.TABLE 2Binding assay data for MKK7-(1–85)-JNK1 interactionExperimentaBinding reactions (200 μl) contained ∼1 pmol (∼5 nm) of 35S-labeled, in vitro translated JNK1 and 40 μg (5.6 μm) of GST-MKK7-(1-85) fusion protein.BindingbPercent of the input 35S-labeled protein that bound to the GST fusion protein.KdcCalculation was based on the known input concentrations and percent binding, as described elsewhere (38, 40).%μmA-16.483A-25.499A-35.3101A-45.0106A-55.695A-67.372Mean93S.D.13S.E.6a Binding reactions (200 μl) contained ∼1 pmol (∼5 nm) of 35S-labeled, in vitro translated JNK1 and 40 μg (5.6 μm) of GST-MKK7-(1-85) fusion protein.b Percent of the input 35S-labeled protein that bound to the GST fusion protein.c Calculation was based on the known input concentrations and percent binding, as described elsewhere (38Bardwell A.J. Flatauer L.J. Matsukuma K. Thorner J. Bardwell L. J. Biol. Chem. 2001; 276: 10374-10386Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). Open table in a new tab Peptides—The soluble peptides used for the binding competition and kinase inhibition experiments were synthesized by United Biochemical Research Inc. Peptide sequences are shown in Table 3.TABLE 3Peptides used in this studyNameSequence (NH2 → COOH)Residues of proteinMKK4MQGKRKALKLNFANPP37-52MKK4EAGMQGEAKALKGNFANPPJIP-1YRPKRPTTLNLF152-163MKK7-D1REARRRIDLNLDISP22-36MKK7-D2QRPRPTLQLPLANDG37-51MKK7-D3PPARPRHMLGLPSTLFT67-83MEK1MPKKKPTPIQLNPAPDG1-17MEK2MLARRKPVLPALTINPTIAE1-20MEK2EEAAMLAEEKPVLPAATANPTIAE Open table in a new tab Protein Kinase Assays—The protein kinase assays for ERK2 phosphorylation of Elk-1 (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) and for JNK2 phosphorylation of c-Jun or ATF2 (40Ho D.T. Bardwell A.J. Abdollahi M. Bardwell L. J. Biol. Chem. 2003; 278: 32662-32672Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) have been described previously. Kinase reactions (20 μl) for JNK1 phosphorylation of c-Jun or ATF2 contained kinase assay buffer (50 mm Tris-HCl (pH 7.5), 10 mm MgCl2, 1 mm EGTA, and 2 mm dithiothreitol), 1 μm (740 ng) GST-c-Jun, or 1 μm (700 ng) GST-ATF2, 0.8 milliunits (2.6 ng) of active JNK1, 50 μm ATP, 1 μCi of [γ-32P]ATP, and the indicated concentration of peptide. Reactions were for 20 min at 30 °C. Substrate phosphorylation was quantified by SDS-PAGE (12% gels), followed by analysis of relative incorporation using the PhosphorImager. Tissue Culture and Transfections—HEK293 cells were cultured using Dulbecco's modified Eagle's medium enriched with 10% heat-inactivated fetal bovine serum (Invitrogen), penicillin, streptomycin, and sodium bicarbonate. The cells were seeded at a density of 5 × 105 cells per well in a 6-well dish. The culture was maintained in a humidified environment at 37 °C and 5% CO2. Transient transfections were performed with Lipofectamine (Invitrogen) following the manufacturer's recommended procedures. Cells were harvested 48 h after transfection. Co-immunoprecipitation Assay—HEK293 cells were transfected with 1 mg of MKK7-FLAG, MKK7-D12-FLAG, or pcDNA3.1/FLAG plasmid DNA and co-transfected with 1 μg of pcDNA3.1-JNK1α1-V5-His plasmid DNA. At 48 h post-transfection, cells from two 35-mm wells were lysed into 200 μl of lysis buffer (50 mm Hepes (pH 7.6), 150 mm NaCl, 1.5 mm MgCl2, 1 mm EDTA, 1% Triton X-100, 10% glycerol, 1 mm sodium orthovanadate, 25 mm β-glycerophosphate, 1× protease inhibitor mixture (Sigma)) and centrifuged at 14,000 × g for 15 min at 4 °C. The supernatant was then cleared with 20 μl of a 50% slurry of Protein G Plus/Protein A-agarose beads for 30 min at 4 °C. The cleared lysates were then incubated for 1 h at 4 °C with 20 μl of beads (50% slurry) that had been preincubated with 1 μl of anti-V5 antibody for 30 min at 4 °C. The beads were washed twice with 0.5 ml of wash buffer (20 mm Hepes (pH 7.6), 150 mm NaCl, 0.1% Triton X-100, 10% glycerol) and resuspended in SDS sample buffer. Immunoprecipitation Kinase Assays—HEK293 cells were transfected with 1 μg of plasmid DNA encoding either FLAG-tagged wild-type MKK7, docking site mutated MKK7, kinase-dead MKK7, or empty vector. After 48 h, the cells were serum-starved for 30 min and then treated with anisomycin (20 μg/ml) and IL-1 (5 ng/ml) for another 30 min. Cells were lysed, and MKK7-FLAG derivatives were immunoprecipitated as above. The immunoprecipitation complexes were then washed twice with wash buffer and once with kinase buffer (50 mm Tris-HCl (pH 7.5), 10 mm MgCl2, 1 mm EGTA, and 2 mm dithiothreitol). The activity of MKK7 was determined in a reaction at 30 °C for 30 min in 40 μl of kinase buffer containing 0.5 μg of unactivated JNK1, 2 μg of GST-c-Jun, 50 μm ATP, and 1 μCi of [γ-32P]ATP. The reactions were terminated by the addition of SDS sample buffer, resolved by SDS-PAGE, detected by immunoblot and autoradiography, and quantified on a PhosphorImager. Three Putative Docking Sites in the N Terminus of MKK7β—Because all other human MKKs had been shown to contain MAPK-docking sites near their N termini, we inspected the amino acid sequence of MKK7 f

Referência(s)