Protein kinase Cbeta mediates hepatic induction of sterol-regulatory element binding protein-1c by insulin
2010; Elsevier BV; Volume: 51; Issue: 7 Linguagem: Inglês
10.1194/jlr.m004234
ISSN1539-7262
AutoresTakashi Yamamoto, Kazuhisa Watanabe, Noriyuki Inoue, Yoshimi Nakagawa, Naomi Ishigaki, Takashi Matsuzaka, Yoshinori Takeuchi, Kazuto Kobayashi, Shigeru Yatoh, Akimitsu Takahashi, Hiroaki Suzuki, Naoya Yahagi, Takanari Gotoda, Nobuhiro Yamada, Hitoshi Shimano,
Tópico(s)Peroxisome Proliferator-Activated Receptors
ResumoSterol-regulatory element binding protein-1c (SREBP-1c) is a transcription factor that controls lipogenesis in the liver. Hepatic SREBP-1c is nutritionally regulated, and its sustained activation causes hepatic steatosis and insulin resistance. Although regulation of SREBP-1c is known to occur at the transcriptional level, the precise mechanism by which insulin signaling activates SREBP-1c promoter remains to be elucidated. Here we show that protein kinase C beta (PKCbeta) is a key mediator of insulin-mediated activation of hepatic SREBP-1c and its target lipogenic genes. Activation of SREBP-1c in the liver of refed mice was suppressed by either adenoviral RNAi-mediated knockdown or dietary administration of a specific inhibitor of protein kinase C beta. The effect of PKCbeta inhibition was cancelled in insulin depletion by streptozotocin (STZ) treatment of mice. Promoter analysis indicated that PKCbeta activates SREBP-1c promoter through replacement of Sp3 by Sp1 for binding to the GC box in the sterol regulatory element (SRE) complex, a key cis-element of SREBP-1c promoter. Knockdown of Sp proteins demonstrated that Sp3 and Sp1 play reciprocally negative and positive roles in nutritional regulation of SREBP-1c, respectively. This new understanding of PKCbeta involvement in nutritional regulation of SREBP-1c activation provides a new aspect of PKCbeta inhibition as a potential therapeutic target for diabetic complications. Sterol-regulatory element binding protein-1c (SREBP-1c) is a transcription factor that controls lipogenesis in the liver. Hepatic SREBP-1c is nutritionally regulated, and its sustained activation causes hepatic steatosis and insulin resistance. Although regulation of SREBP-1c is known to occur at the transcriptional level, the precise mechanism by which insulin signaling activates SREBP-1c promoter remains to be elucidated. Here we show that protein kinase C beta (PKCbeta) is a key mediator of insulin-mediated activation of hepatic SREBP-1c and its target lipogenic genes. Activation of SREBP-1c in the liver of refed mice was suppressed by either adenoviral RNAi-mediated knockdown or dietary administration of a specific inhibitor of protein kinase C beta. The effect of PKCbeta inhibition was cancelled in insulin depletion by streptozotocin (STZ) treatment of mice. Promoter analysis indicated that PKCbeta activates SREBP-1c promoter through replacement of Sp3 by Sp1 for binding to the GC box in the sterol regulatory element (SRE) complex, a key cis-element of SREBP-1c promoter. Knockdown of Sp proteins demonstrated that Sp3 and Sp1 play reciprocally negative and positive roles in nutritional regulation of SREBP-1c, respectively. This new understanding of PKCbeta involvement in nutritional regulation of SREBP-1c activation provides a new aspect of PKCbeta inhibition as a potential therapeutic target for diabetic complications. Mammals have evolved a system for lipid synthesis to maintain nutritional homeostasis. Sterol regulatory element-binding protein (SREBP) is a transcription factor belonging to bHLH family (1.Brown M.S. Goldstein J.L. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor.Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (3004) Google Scholar) that controls genes involved in lipid synthesis. SREBP consists of three isoforms (SREBP-1a, SREBP-1c, and SREBP-2). SREBPs bind to specific elements (SRE) in the promoter of their target genes. The physiological role of each of the isoforms has been studied in transgenic mice overexpressing their nuclear forms (2.Shimano H. Horton J.D. Hammer R.E. Shimomura I. Brown M.S. Goldstein J.L. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a.J. Clin. Invest. 1996; 98: 1575-1584Crossref PubMed Scopus (698) Google Scholar, 3.Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells.J. Clin. Invest. 1997; 99: 846-854Crossref PubMed Scopus (684) Google Scholar, 4.Horton J.D. Shimomura I. Brown M.S. Hammer R.E. Goldstein J.L. Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2.J. Clin. Invest. 1998; 101: 2331-2339Crossref PubMed Google Scholar). In liver, SREBP-1c is predominantly expressed and is the master regulator of fatty acid and triglyceride synthesis due to its enhancement of the transcription of fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and stearoyl-CoA desaturase (SCD-1), which results in the conversion of excessive carbohydrates to lipid (5.Shimomura I. Shimano H. Horton J.D. Goldstein J.L. Brown M.S. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells.J. Clin. Invest. 1997; 99: 838-845Crossref PubMed Scopus (641) Google Scholar, 6.Shimano H. Sterol regulatory element-binding protein-1 as a dominant transcription factor for gene regulation of lipogenic enzymes in the liver.Trends Cardiovasc. Med. 2000; 10: 275-278Crossref PubMed Scopus (68) Google Scholar, 7.Shimano H. Yahagi N. Amemiya-Kudo M. Hasty A.H. Osuga J. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Harada K. et al.Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes.J. Biol. Chem. 1999; 274: 35832-35839Abstract Full Text Full Text PDF PubMed Scopus (580) Google Scholar, 8.Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c.J. Biol. Chem. 2002; 277: 9520-9528Abstract Full Text Full Text PDF PubMed Scopus (526) Google Scholar). The processing and regulation of SREBP genes have been extensively studied. SREBPs are initially translated as endoplasmic reticulum (ER)-membrane-bound proteins that remain in the ER until they are released by SREBP cleavage-activating protein (SCAP)-mediated proteolytic cleavage, allowing the active form to enter the nucleus and activate transcription. The cleavage of SREBP-2 is strictly regulated by cellular cholesterol concentrations and is a key process for sterol regulation (9.Korn B.S. Shimomura I. Bashmakov Y. Hammer R.E. Horton J.D. Goldstein J.L. Brown M.S. Blunted feedback suppression of SREBP processing by dietary cholesterol in transgenic mice expressing sterol-resistant SCAP(D443N).J. Clin. Invest. 1998; 102: 2050-2060Crossref PubMed Scopus (57) Google Scholar, 10.Matsuda M. Korn B.S. Hammer R.E. Moon Y.A. Komuro R. Horton J.D. Goldstein J.L. Brown M.S. Shimomura I. SREBP cleavage-activating protein (SCAP) is required for increased lipid synthesis in liver induced by cholesterol deprivation and insulin elevation.Genes Dev. 2001; 15: 1206-1216Crossref PubMed Scopus (266) Google Scholar). In contrast, transcriptional regulation of SREBP-1c depends upon nutritional status and controls lipogenic genes in the liver. In physiological conditions, SREBP-1c transcription is repressed in the fasted state and is drastically activated in the fed state, leading to storage of carbohydrates (11.Horton J.D. Bashmakov Y. Shimomura I. Shimano H. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice.Proc. Natl. Acad. Sci. USA. 1998; 95: 5987-5992Crossref PubMed Scopus (537) Google Scholar). Factors related to nutrition, such as insulin (12.Shimomura I. Bashmakov Y. Ikemoto S. Horton J.D. Brown M.S. Goldstein J.L. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes.Proc. Natl. Acad. Sci. USA. 1999; 96: 13656-13661Crossref PubMed Scopus (627) Google Scholar), insulin signal- related kinase (13.Ono H. Shimano H. Katagiri H. Yahagi N. Sakoda H. Onishi Y. Anai M. Ogihara T. Fujishiro M. Viana A.Y. et al.Hepatic Akt activation induces marked hypoglycemia, hepatomegaly, and hypertriglyceridemia with sterol regulatory element binding protein involvement.Diabetes. 2003; 52: 2905-2913Crossref PubMed Scopus (139) Google Scholar, 14.Matsumoto M. Ogawa W. Akimoto K. Inoue H. Miyake K. Furukawa K. Hayashi Y. Iguchi H. Matsuki Y. Hiramatsu R. et al.PKClambda in liver mediates insulin-induced SREBP-1c expression and determines both hepatic lipid content and overall insulin sensitivity.J. Clin. Invest. 2003; 112: 935-944Crossref PubMed Scopus (154) Google Scholar), glucose (15.Hasty A.H. Shimano H. Yahagi N. Amemiya-Kudo M. Perrey S. Yoshikawa T. Osuga J. Okazaki H. Tamura Y. Iizuka Y. et al.Sterol regulatory element-binding protein-1 is regulated by glucose at the transcriptional level.J. Biol. Chem. 2000; 275: 31069-31077Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 16.Matsuzaka T. Shimano H. Yahagi N. Amemiya-Kudo M. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. Tomita S. Sekiya M. et al.Insulin-independent induction of sterol regulatory element-binding protein-1c expression in the livers of streptozotocin-treated mice.Diabetes. 2004; 53: 560-569Crossref PubMed Scopus (148) Google Scholar), protein kinase A (PKA) (17.Yamamoto T. Shimano H. Inoue N. Nakagawa Y. Matsuzaka T. Takahashi A. Yahagi N. Sone H. Suzuki H. Toyoshima H. Yamada N. Protein kinase A suppresses sterol regulatory element-binding protein-1c expression via phosphorylation of liver X receptor in the liver.J. Biol. Chem. 2007; 282: 11687-11695Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar), polyunsaturated fatty acid (PUFA) (18.Yoshikawa T. Shimano H. Yahagi N. Ide T. Amemiya-Kudo M. Matsuzaka T. Nakakuki M. Tomita S. Okazaki H. Tamura Y. et al.Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c promoter activity by inhibition of liver X receptor (LXR) binding to LXR response elements.J. Biol. Chem. 2002; 277: 1705-1711Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 19.Ou J. Tu H. Shan B. Luk A. DeBose-Boyd R.A. Bashmakov Y. Goldstein J.L. Brown M.S. Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand-dependent activation of the LXR.Proc. Natl. Acad. Sci. USA. 2001; 98: 6027-6032Crossref PubMed Scopus (406) Google Scholar), and nuclear receptor Liver X receptor (LXR) (20.Yoshikawa T. Shimano H. Amemiya-Kudo M. Yahagi N. Hasty A.H. Matsuzaka T. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. et al.Identification of liver X receptor-retinoid X receptor as an activator of the sterol regulatory element-binding protein 1c gene promoter.Mol. Cell. Biol. 2001; 21: 2991-3000Crossref PubMed Scopus (434) Google Scholar) have been reported to regulate SREBP-1c expression. However, the precise molecular mechanism of SREBP-1c transcription is not fully understood. Accumulating evidence suggests that protein kinase C (PKC) is involved in signals of insulin, glucose, and nutrients relating to a variety of signals systems, such as diacyl-glycerol (DAG) and phosphatidylserine (PS). Thus we postulated that PKC may regulate SREBP-1c cleavage and activation. PKC is a serine/threonine kinase and is categorized into three subfamilies (classical, novel, and atypical) based on distinct N-terminal regulatory domains. As a nutrient sensor, it has been reported that several PKCs are activated by insulin and glucose. The atypical PKC isoforms (zeta/lambda) have been also implicated to participate in insulin signaling, and PKC lambda liver-specific knockout attenuates expression of SREBP-1c in mRNA level (14.Matsumoto M. Ogawa W. Akimoto K. Inoue H. Miyake K. Furukawa K. Hayashi Y. Iguchi H. Matsuki Y. Hiramatsu R. et al.PKClambda in liver mediates insulin-induced SREBP-1c expression and determines both hepatic lipid content and overall insulin sensitivity.J. Clin. Invest. 2003; 112: 935-944Crossref PubMed Scopus (154) Google Scholar). Recent reports suggest that other isoforms also modulate insulin signal-related proteins through phosphorylation or direct interaction (21.Sampson S.R. Cooper D.R. Specific protein kinase C isoforms as transducers and modulators of insulin signaling.Mol. Genet. Metab. 2006; 89: 32-47Crossref PubMed Scopus (77) Google Scholar). PKCbeta belongs to the classical PKC subfamily and is activated by both glucose and insulin. Chronic exposure to hyperglycemia is believed to activate PKCbeta in a variety of vascular tissues, leading to the diabetic microangiopathy (22.Way K.J. Katai N. King G.L. Protein kinase C and the development of diabetic vascular complications.Diabet. Med. 2001; 18: 945-959Crossref PubMed Scopus (276) Google Scholar). In the current study, we examine whether classical and/or novel PKCs are involved in nutritional induction of SREBP-1c. Using in vivo and in vitro techniques, we demonstrate that PKCbeta is a regulator for induction of SREBP-1c in a fed state. Male C57BL/6J mice and male SD rat were purchased from CLEA (Tokyo, Japan) and maintained on a 14-h light/10-h dark cycle. Mice were sacrificed between 9:00 and 12:00. Before being killed, mice were weighed and blood samples were taken. Streptozotocin (STZ) mice were produced as follows: C57BL/6J mice (7-weeks old) were administered streptozotocin (100 mg/kg) via intraperitoneal injection two times every other day. One week following the last injection, blood glucose level was checked and mice with high glucose (350 mg/dl or above) were used in the experiments. Animals were treated according the guidelines for ethical use of animals established at the University of Tsukuba. Control chow diet containing a PKCbeta selective inhibitor (LY333531, 10 mg/kg) was provided by Elli Lilly and Co. (Indianapolis, IN). Anti-HA (12CA5) antibody and anti-c- myc antibody were purchased from Roche. Anti-SREBP-1 (H-160) antibody (sc-8984), anti-LXRalpha (H-144) antibody (sc-13068), anti-RXR (D-20) antibody (sc-553), anti-PKCbeta1 (C-16) antibody (sc-209), anti-PKCbeta2 (C-18) antibody (sc-210), anti-PKCepsilon (C-15) antibody (sc-214), anti-Sp1 (1C6) antibody (sc-420), anti-Sp2 (K-20) antibody (sc-643), anti-Sp3 (D-20) antibody (sc-644), anti-USF-1 (C-20) antibody (sc-229), anti-USF-2 (C-20) antibody (sc-862), and anti-CBF-C (N-19) (NF-Y) antibody (sc-7715) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-α-Tubulin antibody, PMA (phorbol-12-myristate-13-acetate), bisindolylmaleimide I (GF 109203X), U0126, and U0124 were purchased from Calbiochem. Streptozotocin, mithramycin A, and insulin were purchased from Sigma. LY333531 was purchased from A. G. Scientific (San Diego, CA), and oligo DNA primers were purchased from Operon Biotechnologies. HepG2 cells, HEK293T cells, and human mesangial-derived MES cells were purchased from ATCC. Culture medium (MEM, DMEM, and F-12) were purchased from Sigma. HepG2 cells were maintained in MEM medium (10% FBS, 1% penicillin-streptomycin solution stabilized, 1 mM sodium pyruvate), HEK293T cells in DMEM medium (5% FBS and 1% penicillin-streptomycin solution stabilized), and MES13 cells in DMEM:F-12 = 3:1 medium (5% fetal bovine serum, 1% penicillin-streptomycin solution stabilized, 14 mM HEPES) in monolayer culture at 37°C in a 5% CO2 incubator. Hepatocytes were isolated from rat liver by collagenase methods as previously described (23.Ide T. Shimano H. Yahagi N. Matsuzaka T. Nakakuki M. Yamamoto T. Nakagawa Y. Takahashi A. Suzuki H. Sone H. et al.SREBPs suppress IRS-2-mediated insulin signalling in the liver.Nat. Cell Biol. 2004; 6: 351-357Crossref PubMed Scopus (280) Google Scholar). Cell viability was assessed by the Trypan Blue exclusion test and was always higher than 80%. The measurement of liver PKC activity was measured by using SignaTECT Protein Kinase C (PKC) Assay System (Promega) according to manufacturer's instruction. Briefly, whole liver samples were homogenized and passed over DEAE column [HiTrap DEAE FF (GE Healthcare)] by using HPLC [ÄKTAexplorer 10S (GE Healthcare)]. The collected fractions were assayed for PKC activity using [γ-32P] ATP, and the radioactivity was determined by using a liquid scintillation counter. Northern blot analysis was performed as previously described (24.Yamamoto T. Shimano H. Nakagawa Y. Ide T. Yahagi N. Matsuzaka T. Nakakuki M. Takahashi A. Suzuki H. Sone H. et al.SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes.J. Biol. Chem. 2004; 279: 12027-12035Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). mRNA was isolated by using PolyATract (R) mRNA Isolation System (Promega). All cDNA probes were radiolabeled with [α-32P] dCTP using RediprimeII Random Prime Labeling System. cDNA probe for 36B4 was used as a loading control. Total RNA was prepared from mouse liver using TRIzol Reagent. First-strand cDNA was synthesized from total RNA (2 μg) with mixture of random hexamer and oligo dT using ThermoScript RT-PCR System (Invitrogen). Real-time PCR using the SYBR green reagents was performed with the ABI PRISM 7000 Sequence Detector (Applied Biosystems). The relative amount of all mRNA was calculated, and 36B4 mRNA was used as the loading control. Primer sequences of genes used are as follows: SREBP-1a: (5′-aggcggctctggaacaga-3′) (5′-tcaaaaccgctgtgtccagtt-3′); SREBP-1c: (5′-cggcgcggaagctgt-3′) (5′-tgcaatccatggctccgt-3′); and 36B4: (5′-cctgaagtgctcgacatcaca-3′) (5′-gcgcttgtacccattgatga-3′). SREBP-1c-Luc vectors (pBP-1c-2600, pBP-1c-550, and pBP-1c-90) were previously described (20.Yoshikawa T. Shimano H. Amemiya-Kudo M. Yahagi N. Hasty A.H. Matsuzaka T. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. et al.Identification of liver X receptor-retinoid X receptor as an activator of the sterol regulatory element-binding protein 1c gene promoter.Mol. Cell. Biol. 2001; 21: 2991-3000Crossref PubMed Scopus (434) Google Scholar). SREBP-1c (TATA)-Luc (pBP-1c-TATA-Luc) and SREBP-1c (-550(ΔSRE complex))-Luc (pBP-1c-550(ΔSRE complex)-Luc) were constructed by cloning these sequences to pGL2basic (Promega). Expression vector for SREBP-1a was previously described (24.Yamamoto T. Shimano H. Nakagawa Y. Ide T. Yahagi N. Matsuzaka T. Nakakuki M. Takahashi A. Suzuki H. Sone H. et al.SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes.J. Biol. Chem. 2004; 279: 12027-12035Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). Expression vector for HA-tagged Sp3 was generated by PCR amplification and cloned into pcDNA3 (Invitrogen). Expression vectors for PKCbetaCA (pCO2) and PKCepsilonCA (pMT2) were kindly provided by Dr Peter Parker. Recombinant adenoviruses were produced by ViraPower Adenoviral Expression System (Invitrogen) according to manufacturer's protocol. PKCbeta wild-type sequence was cloned into pENTR (Invitrogen) carrying CAG promoter. Adenoviruses targeting lacZ, PKCbeta, PKCepsilon, Sp1 and Sp3 were generated by using BLOCK-iT U6 RNAi Entry Vector Kit (Invitrogen). Briefly, targeting sequences for knockdown of lacZ, PKCbeta (NM_008855), PKCepsilon (NM_011104), Sp1 (NM_013672), and Sp3 (NM_001018042) were synthesized and ligated into pENTR/U6 (Invitrogen). By homologous recombination procedure, these fragments were integrated in pAd/PL-DEST (Invitrogen) followed by transfection into 293A cells for adenovirus production. Transfection and luciferase assay were performed as previously described (24.Yamamoto T. Shimano H. Nakagawa Y. Ide T. Yahagi N. Matsuzaka T. Nakakuki M. Takahashi A. Suzuki H. Sone H. et al.SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes.J. Biol. Chem. 2004; 279: 12027-12035Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar) using OPTI-MEM I (GIBCO) and FuGENE 6 Transfection Reagent (Roche). As control of transfection efficiency, Renilla luciferase (pRL-SV40, Promega) was used as described in the figure legend. Total DNA for transfection was adjusted to 0.5 μg/well by using empty vector. All experiments were performed in triplicate. Similar experiments were repeated at least two times. Preparation of nuclear fraction from mouse liver as previously described (7.Shimano H. Yahagi N. Amemiya-Kudo M. Hasty A.H. Osuga J. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Harada K. et al.Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes.J. Biol. Chem. 1999; 274: 35832-35839Abstract Full Text Full Text PDF PubMed Scopus (580) Google Scholar). Each group of nuclear fraction was pooled and washed by ice-cold PBS. After adding of formaldehyde to samples, cross-linking was performed by incubation at 37°C for 10 min and stopped by glycine. After washing of hepatic nuclear samples by PBS, pellets were dissolved in SDS lysis buffer [50 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH8.0), 1% SDS and protease inhibitor cocktail (Roche)]. DNA fragmentation was performed by sonication (Sonifer 250) for 30 s (power 1, duty cycle 20%) five times. After centrifugation for 10 min at room temperature 15000 rpm, supernatant was diluted by 9 vol of dilution buffer [50 mM Tris-HCl (pH 8.0), 167 mM NaCl, 1.1% Triton X-100, 0.11% sodium deoxycholate and protease inhibitor cocktail (Roche)]. To remove unspecific binding, protein G beads were added and rotated for 30 min at 4°C. Supernatant was mixed with antibodies overnight and 50% protein G beads [Protein G Sepharose 4 Fast Flow (GE Healthcare)] were added and rotated for 3 h at 4°C. After washing by low salt wash buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA (pH8.0), 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate], high-salt wash buffer [50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 1 mM EDTA (pH8.0), 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate], LiCl wash buffer [10 mM Tris-HCl (pH8.0), 0.25 M LiCl, 1 mM EDTA (pH 8.0), 0.5% NP40 and 0.5% sodium deoxycholate], and TE buffer. DNA-protein complex was eluted by incubation with elution buffer (1% SDS, 0.1 M NaHCO3) for 30 min at room temperature. After incubation overnight at 65°C, DNA samples was purified as previously described (23.Ide T. Shimano H. Yahagi N. Matsuzaka T. Nakakuki M. Yamamoto T. Nakagawa Y. Takahashi A. Suzuki H. Sone H. et al.SREBPs suppress IRS-2-mediated insulin signalling in the liver.Nat. Cell Biol. 2004; 6: 351-357Crossref PubMed Scopus (280) Google Scholar) and subjected to PCR experiment. Antibodies for the ChIP assay were anti-Sp1 antibody (07-645), anti-Sp3 antibody (sc-644X) and normal rabbit IgG (sc-2027). PCR conditions were as follows: denature one cycle (95°C for 3 min); amplification 30 cycles (94°C 1 min, 55.5°C 30 s, 72°C 30 s). PCR primer sequences were as follows: sense (gaaccagcggtgggaacacagagc); antisense (aggctttaaagcccgccgat). Preparation of nuclear protein from mouse liver and cultured cells was as previously described (7.Shimano H. Yahagi N. Amemiya-Kudo M. Hasty A.H. Osuga J. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Harada K. et al.Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes.J. Biol. Chem. 1999; 274: 35832-35839Abstract Full Text Full Text PDF PubMed Scopus (580) Google Scholar). EMSA and Western blot analysis were performed as previously described (24.Yamamoto T. Shimano H. Nakagawa Y. Ide T. Yahagi N. Matsuzaka T. Nakakuki M. Takahashi A. Suzuki H. Sone H. et al.SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes.J. Biol. Chem. 2004; 279: 12027-12035Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). Sequences for EMSA probe are as follows (antisense strand omitted). SREBP-1c SRE complex (-92 to -35): (5′-gcggctgctgattggccatgtgcgctcacccgaggggcggggcacggaggcgatcgg-3′); SREBP-1c SRE complex mut: (5′-gcggctgctgattggccatgtgcgctcacccgaggtttaaagcacggaggcgatcgg-3′); -90bp region (-46 to +8): (5′-ggcggggcacggaggcgatcggcgggctttaaagcctcgcggggcctgacaggtgaaatcggcgc-3′); 90bp region (-6 to +43): (5′-ggtgaaatcggcgcggaagctgtcggggtagcgtctgcacgccctagg-3′); NFkappaB consensus site: (5′-gagttgaggggactttcccagg-3′). Plasma glucose, triglycerides, nonesterified fatty acid, and cholesterol were determined with a kit purchased from WAKO. Plasma insulin levels were determined with insulin kit (mouse-T) purchased from Shibayagi. All animal experiments were performed at least two times. Luciferase assay, PKC activity, plasma parameters, body weight, tissue weight, and mRNA expression levels are presented as means ± SD. The significance was tested by Dunnett test or Student's t-test. A mouse SREBP-1c promoter construct spanning a 2.6 kb 5′ flanking region containing LXR and SREBP binding sites (schematized in Fig. 1A) was used in reporter assays in the hepatic cell line HepG2. PMA, a general activator of all PKC isoforms, dose-dependently and saturably elevated SREBP-1c promoter activity, suggesting that PKC activates the SREBP-1c promoter (Fig. 1B). Deletion studies indicated that the region of the SREBP-1c promoter responsible for PMA activation was located within the proximal 90 bp region, which contains the SRE complex (Fig. 1C, D). Deletion constructs was confirmed by LXR synthetic ligand T0901317 (indicated as T1317 in Fig. 1D). T1317 robustly activates the SREBP-1c promoter in pBP-1c550 and pBP-1c550 (ΔSRE complex) constructs containing LXRE but not in pBP-1c90 and pBP-1cTATA-Luc constructs. Activation of this minimal promoter by PMA was dose-dependently inhibited by GF 109203X (GFX), an inhibitor of PKC, confirming that PMA activation of the SREBP-1c promoter was mediated by PKC (Fig. 2A). It is well established that mitogen-activated protein kinases are downstream of PKC (25.Kaneki M. Kharbanda S. Pandey P. Yoshida K. Takekawa M. Liou J.R. Stone R. Kufe D. Functional role for protein kinase Cbeta as a regulator of stress-activated protein kinase activation and monocytic differentiation of myeloid leukemia cells.Mol. Cell. Biol. 1999; 19: 461-470Crossref PubMed Scopus (66) Google Scholar, 26.Zhang J. Anastasiadis P.Z. Liu Y. Thompson E.A. Fields A.P. Protein kinase C (PKC) betaII induces cell invasion through a Ras/Mek-, PKC iota/Rac 1-dependent signaling pathway.J. Biol. Chem. 2004; 279: 22118-22123Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 27.Schonwasser D.C. Marais R.M. Marshall C.J. Parker P.J. Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes.Mol. Cell. Biol. 1998; 18: 790-798Crossref PubMed Scopus (684) Google Scholar). PMA activation of the 90 bp-Luc promoter was also abolished by U0126, an inhibitor of MEK, but not by U0124, its inactive analog, indicating that MEK activation mediates the process in PMA activation of the SREBP-1c promoter.Fig. 2Activation of SREBP-1c promoter by PKCbeta and PKCepsilon. A: Effect of PKC inhibitor on SREBP-1c promoter activity. HepG2 cells were cotransfected with pBP-1c2600-Luc. After transfection, PMA, GFX, U0126, U0124, or vehicle were added for 20 h as indicated in figure. RLU (firefly luciferase activity:renilla luciferase activity ratio) is shown. ∗P < 0.01 versus PMA treatment. B: Effect of PKCbeta inhibition by LY333531 on SREBP-1c promoter. HepG2 cells were cotransfected with pBP-1c2600-Luc. After transfection, PMA (0.1 μM) and LY333531 (0, 10, 30, 100, 300, 1000 nM) were added for 20 h. RLU (firefly activity:renilla luciferase activity ratio) is shown. ∗P < 0.01 versus PMA treatment. C: Effect of PKCbeta and PKCepsilon on SREBP-1c promoter. HepG2 cells were cotransfected with pBP-1c2600-Luc and PKCbetaCA (constitutive active form) vector, PKCepsilonCA, or empty vector. RLU (firefly luciferase activity:renilla luciferase activity ratio) is shown. ∗P < 0.01 versus empty vector. LXR, liver X receptor; GFX, GF 109203X; LXRE, LXR response element; PKC, protein kinase C; PMA, phorbol-12-myristate-13-acetate; Sp, specificity protein; SRE, sterol regulatory element; SREBP, sterol regulatory element-binding protein.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because of the potential involvement of several different PKC isoforms, we tested the effect of LY333531, a specific inhibitor of PKCbeta. This PKCbeta inhibitor dose-dependently abolished PMA-induced activation of the SREBP-1c promoter, although its effect on the basal activity was minimal (Fig. 2B). Conversely, expression of PKCbeta, as well as PKCepsilon, dose-dependently activated the SREBP-1c promoter (Fig. 2C). Gel-shift assay focusing on the responsible 90 bp region demonstrated that nuclear extract from HepG2 cells treated with PMA exhibited a robust and consistent binding to the SRE complex probe (−92bp and −35bp) (Fig. 3A), whereas no signal was obtained from other probes to other sections of the SREBP-1c promoter (data not shown). These data suggest that the SRE complex could be the site for PMA activation. The signal was slightly diminished by addition of antibodies against transcription factors that bind to the SRE complex, such as SREBP-1, upstream transcription factors, Sp proteins, and nuclear transcription factor-Y (28.Amemiya-Kudo M. Shimano H. Yoshikawa T. Yahagi N. Hasty A.H. Okazaki H. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. et al.Promoter analysis of the mouse sterol regulatory element-binding protein-1c gene.J. Biol. Chem. 2000; 275: 31078-31085Abs
Referência(s)