Portal de Periódicos da CAPES

GDF6, a Novel Locus for a Spectrum of Ocular Developmental Anomalies

2007; Elsevier BV; Volume: 80; Issue: 2 Linguagem: Inglês

10.1086/511280

1537-6605

Mika Asai-Coakwell, Curtis R. French, K. Berry, Ming Ye, Ron Koss, Martin J. Somerville, Rosemary Mueller, Veronica van Heyningen, Andrew J. Waskiewicz, Ordan J. Lehmann,

Craniofacial Disorders and Treatments

Colobomata represent visually impairing ocular closure defects that are associated with a diverse range of developmental anomalies. Characterization of a chromosome 8q21.2-q22.1 segmental deletion in a patient with chorioretinal coloboma revealed elements of nonallelic homologous recombination and nonhomologous end joining. This genomic architecture extends the range of chromosomal rearrangements associated with human disease and indicates that a broader spectrum of human chromosomal rearrangements may use coupled homologous and nonhomologous mechanisms. We also demonstrate that the segmental deletion encompasses GDF6, encoding a member of the bone-morphogenetic protein family, and that inhibition of gdf6a in a model organism accurately recapitulates the proband's phenotype. The spectrum of disorders generated by morpholino inhibition and the more severe defects (microphthalmia and anophthalmia) observed at higher doses illustrate the key role of GDF6 in ocular development. These results underscore the value of integrated clinical and molecular investigation of patients with chromosomal anomalies. Colobomata represent visually impairing ocular closure defects that are associated with a diverse range of developmental anomalies. Characterization of a chromosome 8q21.2-q22.1 segmental deletion in a patient with chorioretinal coloboma revealed elements of nonallelic homologous recombination and nonhomologous end joining. This genomic architecture extends the range of chromosomal rearrangements associated with human disease and indicates that a broader spectrum of human chromosomal rearrangements may use coupled homologous and nonhomologous mechanisms. We also demonstrate that the segmental deletion encompasses GDF6, encoding a member of the bone-morphogenetic protein family, and that inhibition of gdf6a in a model organism accurately recapitulates the proband's phenotype. The spectrum of disorders generated by morpholino inhibition and the more severe defects (microphthalmia and anophthalmia) observed at higher doses illustrate the key role of GDF6 in ocular development. These results underscore the value of integrated clinical and molecular investigation of patients with chromosomal anomalies. Normal ocular development entails a series of tightly choreographed events, of which fusing the edges of the optic cup's embryonic fissure represents a key step in forming the future spherical eye. Disruption of this process results in colobomata (MIM 120200)—congenital anomalies affecting tissues in the posterior (retina, choroid, and optic nerve) and anterior (cornea, iris, and lens) ocular segments. Colobomata may, in turn, cause abnormal morphogenesis of other ocular tissues, because of the retina's inductive role in lens formation. Consequently, colobomata are frequently associated with ocular malformations, including cataract, microphthalmia, and anophthalmia; systemic anomalies—such as renal anomalies, mental retardation, and CHARGE (coloboma, heart defects, choanal atresia, retarded growth, and genital and ear anomalies [MIM 214800])1Gregory-Evans CY Williams MJ Halford S Gregory-Evans K Ocular coloboma: a reassessment in the age of molecular neuroscience.J Med Genet. 2004; 41: 881-891Crossref PubMed Scopus (157) Google Scholar—are also observed in a small subset. Causal mutations for coloboma have been identified in only a small number of cases, and the genetic heterogeneity (OTX2 [MIM 600037],2Ragge NK Brown AG Poloschek CM Lorenz B Henderson RA Clarke MP Russell-Eggitt I Fielder A Gerrelli D Martinez-Barbera JP et al.Heterozygous mutations of OTX2 cause severe ocular malformations.Am J Hum Genet. 2005; 76: 1008-1022Abstract Full Text Full Text PDF PubMed Scopus (225) Google ScholarSHH [MIM 600725],3Schimmenti LA de la Cruz J Lewis RA Karkera JD Manligas GS Roessler E Muenke M Novel mutation in sonic hedgehog in non-syndromic colobomatous microphthalmia.Am J Med Genet A. 2003; 116: 215-221Crossref Scopus (127) Google ScholarMAF [MIM 177075],4Jamieson RV Perveen R Kerr B Carette M Yardley J Heon E Wirth MG van Heyningen V Donnai D Munier F et al.Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma.Hum Mol Genet. 2002; 11: 33-42Crossref PubMed Scopus (217) Google ScholarCHX10 [MIM 142993],5Ferda Percin E Ploder LA Yu JJ Arici K Horsford DJ Rutherford A Bapat B Cox DW Duncan AM Kalnins VI et al.Human microphthalmia associated with mutations in the retinal homeobox gene CHX10.Nat Genet. 2000; 25: 397-401Crossref PubMed Scopus (232) Google ScholarCHD7 [MIM 608892],6Vissers LE van Ravenswaaij CM Admiraal R Hurst JA de Vries BB Janssen IM van der Vliet WA Huys EH de Jong PJ Hamel BC et al.Mutations in a new member of the chromodomain gene family cause CHARGE syndrome.Nat Genet. 2004; 36: 955-957Crossref PubMed Scopus (869) Google Scholar, 7Lalani SR Safiullah AM Fernbach SD Harutyunyan KG Thaller C Peterson LE McPherson JD Gibbs RA White LD Hefner M et al.Spectrum of CHD7 mutations in 110 individuals with CHARGE syndrome and genotype-phenotype correlation.Am J Hum Genet. 2006; 78: 303-314Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar and PAX6 [MIM 607108]8Azuma N Yamaguchi Y Handa H Hayakawa M Kanai A Yamada M Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies.Am J Hum Genet. 1999; 65: 656-663Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar) reflects the diverse molecular interactions that control eye development. Although autosomal dominant, recessive, and X-linked inheritance9Toker E Elcioglu N Ozcan E Yenice O Ogut M Colobomatous macrophthalmia with microcornea syndrome: report of a new pedigree.Am J Med Genet A. 2003; 121: 25-30Crossref Scopus (15) Google Scholar, 10Lehman DM Sponsel WE Stratton RF Mensah J Macdonald JC Johnson-Pais TL Coon H Reveles XT Cody JD Leach RJ Genetic mapping of a novel X-linked recessive colobomatous microphthalmia.Am J Med Genet. 2001; 101: 114-119Crossref PubMed Scopus (20) Google Scholar, 11Porges Y Gershoni-Baruch R Leibu R Goldscher D Zonis S Shapira I Miller B Hereditary microphthalmia with colobomatous cyst.Am J Ophthalmol. 1992; 114: 30-34PubMed Scopus (40) Google Scholar of colobomata are observed, the absence of clear Mendelian inheritance patterns indicates the presence of a less straightforward molecular basis in some cases.2Ragge NK Brown AG Poloschek CM Lorenz B Henderson RA Clarke MP Russell-Eggitt I Fielder A Gerrelli D Martinez-Barbera JP et al.Heterozygous mutations of OTX2 cause severe ocular malformations.Am J Hum Genet. 2005; 76: 1008-1022Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 12Morlé L Bozon M Zech J-C Alloisio N Raas-Rothschild A Philippe C Lambert J-C Godet J Plauchu H Edery P A locus for autosomal dominant colobomatous microphthalmia maps to chromosome 15q12-q15.Am J Hum Genet. 2000; 67: 1592-1597Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 13Barros-Nunez P Medina C Mendoza R Sanchez-Corona J Garcia-Cruz D Unexpected familial recurrence of iris coloboma: a delayed mutation mechanism?.Clin Genet. 1995; 48: 160-161Crossref PubMed Scopus (10) Google Scholar Increasing the proportion of colobomata with a defined genetic origin would benefit the understanding of complex disease and provide novel insight for ocular development and may identify therapeutic targets for a frequently blinding disorder. Colobomata are associated with rearrangements affecting at least 10 autosomes,3Schimmenti LA de la Cruz J Lewis RA Karkera JD Manligas GS Roessler E Muenke M Novel mutation in sonic hedgehog in non-syndromic colobomatous microphthalmia.Am J Med Genet A. 2003; 116: 215-221Crossref Scopus (127) Google Scholar, 4Jamieson RV Perveen R Kerr B Carette M Yardley J Heon E Wirth MG van Heyningen V Donnai D Munier F et al.Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma.Hum Mol Genet. 2002; 11: 33-42Crossref PubMed Scopus (217) Google Scholar, 5Ferda Percin E Ploder LA Yu JJ Arici K Horsford DJ Rutherford A Bapat B Cox DW Duncan AM Kalnins VI et al.Human microphthalmia associated with mutations in the retinal homeobox gene CHX10.Nat Genet. 2000; 25: 397-401Crossref PubMed Scopus (232) Google Scholar, 6Vissers LE van Ravenswaaij CM Admiraal R Hurst JA de Vries BB Janssen IM van der Vliet WA Huys EH de Jong PJ Hamel BC et al.Mutations in a new member of the chromodomain gene family cause CHARGE syndrome.Nat Genet. 2004; 36: 955-957Crossref PubMed Scopus (869) Google Scholar, 8Azuma N Yamaguchi Y Handa H Hayakawa M Kanai A Yamada M Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies.Am J Hum Genet. 1999; 65: 656-663Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 12Morlé L Bozon M Zech J-C Alloisio N Raas-Rothschild A Philippe C Lambert J-C Godet J Plauchu H Edery P A locus for autosomal dominant colobomatous microphthalmia maps to chromosome 15q12-q15.Am J Hum Genet. 2000; 67: 1592-1597Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 14Eccles MR Schimmenti LA Renal-coloboma syndrome: a multi-system developmental disorder caused by PAX2 mutations.Clin Genet. 1999; 56: 1-9Crossref PubMed Scopus (123) Google Scholar15Nixon J Oldridge M Wilkie AO Smith K Interstitial deletion of 2q associated with craniosynostosis, ocular coloboma, and limb abnormalities: cytogenetic and molecular investigation.Am J Med Genet. 1997; 70: 324-327Crossref PubMed Scopus (37) Google Scholar, 16Zollino M Lecce R Fischetto R Murdolo M Faravelli F Selicorni A Buttè C Memo L Capovilla G Neri G Mapping the Wolf-Hirschhorn syndrome phenotype outside the currently accepted WHS critical region and defining a new critical region, WHSCR-2.Am J Hum Genet. 2003; 72: 590-597Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar,17Morrison DA FitzPatrick DR Fleck BW Iris coloboma and a microdeletion of chromosome 22: del(22)(q11.22).Br J Ophthalmol. 2002; 86: 1316Crossref PubMed Scopus (6) Google Scholar including several syndromes, such as CHARGE,7Lalani SR Safiullah AM Fernbach SD Harutyunyan KG Thaller C Peterson LE McPherson JD Gibbs RA White LD Hefner M et al.Spectrum of CHD7 mutations in 110 individuals with CHARGE syndrome and genotype-phenotype correlation.Am J Hum Genet. 2006; 78: 303-314Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar, 6Vissers LE van Ravenswaaij CM Admiraal R Hurst JA de Vries BB Janssen IM van der Vliet WA Huys EH de Jong PJ Hamel BC et al.Mutations in a new member of the chromodomain gene family cause CHARGE syndrome.Nat Genet. 2004; 36: 955-957Crossref PubMed Scopus (869) Google Scholar "Cat eye" syndrome (MIM 115470),17Morrison DA FitzPatrick DR Fleck BW Iris coloboma and a microdeletion of chromosome 22: del(22)(q11.22).Br J Ophthalmol. 2002; 86: 1316Crossref PubMed Scopus (6) Google Scholar, 18McTaggart KE Budarf ML Driscoll DA Emanuel BS Ferreira P McDermid HE Cat eye syndrome chromosome breakpoint clustering: identification of two intervals also associated with 22q11 deletion syndrome breakpoints.Cytogenet Cell Genet. 1998; 81: 222-228Crossref PubMed Scopus (82) Google Scholar Jacobsen syndrome (MIM 147791),19Pivnick EK Velagaleti GV Wilroy RS Smith ME Rose SR Tipton RE Tharapel AT Jacobsen syndrome: report of a patient with severe eye anomalies, growth hormone deficiency, and hypothyroidism associated with deletion 11 (q23q25) and review of 52 cases.J Med Genet. 1996; 33: 772-778Crossref PubMed Scopus (72) Google Scholar and Wolf-Hirschhorn syndrome (MIM 194190).16Zollino M Lecce R Fischetto R Murdolo M Faravelli F Selicorni A Buttè C Memo L Capovilla G Neri G Mapping the Wolf-Hirschhorn syndrome phenotype outside the currently accepted WHS critical region and defining a new critical region, WHSCR-2.Am J Hum Genet. 2003; 72: 590-597Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar Study of chromosomal anomalies has proved a fruitful means of identifying dosage- or position effect–sensitive genes, particularly for ocular disorders, since research is facilitated by the fact that the eye is composed of an interface of embryonically distinct tissues and by accessibility to detailed phenotyping.20Fang J Dagenais SL Erickson RP Arlt MF Glynn MW Gorski JL Seaver LH Glover TW Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome.Am J Hum Genet. 2000; 67: 1382-1388Abstract Full Text Full Text PDF PubMed Scopus (465) Google Scholar, 21Nishimura DY Swiderski RE Alward WL Searby CC Patil SR Bennet SR Kanis AB Gastier JM Stone EM Sheffield VC The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25.Nat Genet. 1998; 19: 140-147Crossref PubMed Scopus (362) Google Scholar, 22Crisponi L Deiana M Loi A Chiappe F Uda M Amati P Bisceglia L Zelante L Nagaraja R Porcu S et al.The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome.Nat Genet. 2001; 27: 159-166Crossref PubMed Scopus (764) Google Scholar, 23Fantes J Ragge NK Lynch SA McGill NI Collin JR Howard-Peebles PN Hayward C Vivian AJ Williamson K van Heyningen V et al.Mutations in SOX2 cause anophthalmia.Nat Genet. 2003; 33: 461-463Crossref PubMed Scopus (404) Google Scholar Detection of a segmental deletion syntenic with the murine ocular malformation locus Tcm24Zhou E Grimes P Favor J Koeberlein B Pretsch W Neuhauser-Klaus A Sidjanin D Stambolian D Genetic mapping of a mouse ocular malformation locus, Tcm, to chromosome 4.Mamm Genome. 1997; 8: 178-181Crossref PubMed Scopus (19) Google Scholar, 25Wang KS Zahn LE Favor J Huang KM Stambolian D Genetic and phenotypic analysis of Tcm, a mutation affecting early eye development.Mamm Genome. 2005; 16: 332-343Crossref PubMed Scopus (6) Google Scholar in a patient with colobomata enabled us to investigate the cause of the ocular developmental phenotype and the mechanism mediating this chromosomal rearrangement. Observation of features of nonallelic homologous recombination (NAHR) and nonhomologous end joining (NHEJ) in this segmental deletion extend the range of chromosome rearrangements associated with human disease. Analyses of genes within and adjacent to the segmental deletion led us to identify growth differentiation factor 6 (GDF6 [MIM 601147]) as a candidate gene for the patient's ocular phenotype. Morpholino inhibition of the function of gdf6 in zebrafish, performed to evaluate this gene's role in retinal development, recapitulated the patient's phenotype. Peripheral-blood samples were obtained from a family in which ocular and systemic developmental anomalies had been identified in one individual. In view of the breadth of the phenotype, karyotyping of the proband and her parents was undertaken, together with subsequent multiplex-FISH (M-FISH) analysis. This study was approved by the University of Alberta Hospital Health Research Ethics Board, and informed consent was obtained from all participants. After initial karyotyping (at the University of Alberta Hospital Cytogenetics Laboratory) revealed a chromosome 8q segmental deletion, M-FISH was undertaken using region-specific and partially overlapping chromosome probes (mBAND X Cyte8 probe set [MetaSystems]).26Speicher MR Gwyn Ballard S Ward DC Karyotyping human chromosomes by combinatorial multi-fluor FISH.Nat Genet. 1996; 12: 368-375Crossref PubMed Scopus (1017) Google Scholar Each contains a unique fluorochrome, which permits quantitative analysis of fluorescence intensity along a chromosome. The deletion's extent was next refined by fluorescent microsatellite-marker genotyping (centromeric: D8S1697, D8S1702, D8S1838, D8S461, D8S1912, and D8S1119; telomeric: D8S1699, D8S1127, D8S1772, D8S1129, and D8S1778). Subsequently, comparative genomic hybridization (CGH) was performed with a custom array comprising isothermal, long oligonucleotide probes tiled at a 5-kb density across the repeat-masked genomic interval encompassing the segmental deletion (Nimblegen). The mean probe density was increased to 1 kb in regions predicted by microsatellite-marker genotyping to correspond to the centromeric and telomeric breakpoints. CGH was performed as described elsewhere,27Selzer RR Richmond TA Pofahl NJ Green RD Eis PS Nair P Brothman AR Stallings RL Analysis of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using fine-tiling oligonucleotide array CGH.Genes Chromosomes Cancer. 2005; 44: 305-319Crossref PubMed Scopus (225) Google Scholar with use of the proband's DNA labeled with Cy3, hybridized with a Cy5-labeled reference DNA. Guided by the CGH results and bioinformatic sequence information, multiple primer pairs were designed to amplify a junctional fragment that spanned the segmental deletion. One of these nine primer permutations (F2-R3) yielded an amplicon in the proband, through use of long-range PCR (Elongase [Invitrogen]), which was purified with Montage (Millipore) and was sequenced using these and internal primers (table 1), with a BigDye (v3.1) terminator kit and 3100 DNA sequencer (Applied Biosystems). Subsequent in silico analyses of the sequence adjacent to the breakpoint were performed with Ensembl, University of California–Santa Cruz (UCSC), and National Center for Biotechnology Information (NCBI) Entrez genome browsers. Through use of BLASTn (NCBI BLAST),28Altschul SF Gish W Miller W Myers EW Lipman DJ Basic local alignment search tool.J Mol Biol. 1990; 215: 403-410PubMed Scopus (0) Google Scholar homologous sequences adjacent to the breakpoint were identified, and the boundaries of the repeat elements were determined using PipMaker29Schwartz S Zhang Z Frazer KA Smit A Riemer C Bouck J Gibbs R Hardison R Miller W PipMaker—a web server for aligning two genomic DNA sequences.Genome Res. 2000; 10: 577-586Crossref PubMed Scopus (961) Google Scholar and Ensembl, UCSC, NCBI Entrez, and NCBI BLAST.Table 1.Primers Used to Amplify the Chromosome 8q22 Junctional Fragment and for RT-PCR of Murine and Zebrafish gdf6Primer (5′→3′)AnalysisForwardReverseAnnealing Temperature (°C)Fragment: F2-R3CCATGACGTGTGAAACCAACTCATTGGTCTGGGTAGAGC60 Chromosome 8-4AGGCACAACAGGAAATGAAGTTGTTGACACTCCTTCCCTCCA60 Chromosome 8-5GAAGCACTTACATCAGCACCTGGACCCCATCTCTTATTCTTGCTT60 Chromosome 8-6TAGGCTGCCTGAGTGTCCTTGGTTCGTGGTCTCACTGGTT60RT-PCR: MurineGCGCGTGGTGCCTCACGAGTACGGGGCGCGATAATCCAGTCGTC60 ZebrafishCGCGGTCCAAGAAGAGAGAGAACTTGCGCGTCTTTACGCATCGTTCAAGT60 gdf6aGTGAGACACGGCTCCACTTTACTCGAAGGTTGTAGACGCCTGATGGGG55 Open table in a new tab Database analyses of genes lying in the deleted region or adjacent to the breakpoints were performed to identify candidate(s) for the ocular phenotype (Ensembl, UCSC, and UniGene). FISH was also undertaken with the BAC clone RP11-516P9, to validate database predictions. The expression of one gene (GDF6) was investigated by RT-PCR of murine (adult and embryonic) and zebrafish (18 and 42 h postfertilization [hpf]) tissue (through use of primers shown in table 1 and Superscript III RT-PCR [Invitrogen]). Ethidium bromide–stained amplicons were visualized on 1% agarose gels. Whole-mount in situ hybridization was undertaken using digoxigenin-labeled antisense RNA probes specific to retinal developmental genes that are primarily markers of regional identity. cDNA from hmx3b (nkx5.1/soho1), aldh1a2 (raldh2), and foxg1 were generated, and in situ hybridization was performed as described elsewhere30Prince VE Moens CB Kimmel CB Ho RK Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino.Development. 1998; 125: 393-406PubMed Google Scholar on wild-type and gdf6a-morphant zebrafish. Zebrafish possess two orthologues, gdf6a (radar) and gdf6b (dynamo),31Davidson AJ Postlethwait JH Yan YL Beier DR van Doren C Foernzler D Celeste AJ Crosier KE Crosier PS Isolation of zebrafish gdf7 and comparative genetic mapping of genes belonging to the growth/differentiation factor 5, 6, 7 subgroup of the TGF-beta superfamily.Genome Res. 1999; 9: 121-129PubMed Google Scholar with gdf6a expressed in developing retina, dorsal fin, dorsal neural tube, and posterior endoderm.32Rissi M Wittbrodt J Delot E Naegeli M Rosa FM Zebrafish radar: a new member of the TGF-beta superfamily defines dorsal regions of the neural plate and the embryonic retina.Mech Dev. 1995; 49: 223-234Crossref PubMed Scopus (78) Google Scholar, 33Hall CJ Flores MV Davidson AJ Crosier KE Crosier PS Radar is required for the establishment of vascular integrity in the zebrafish.Dev Biol. 2002; 251: 105-117Crossref PubMed Scopus (20) Google Scholar Zebrafish embryos have two sources of gdf6a: unspliced zygotic and prespliced maternal gdf6a mRNA. Morpholino inhibition of zebrafish zygotic gdf6a function results in cranial and dorsal neural-tube apoptosis, whereas inhibition of both maternal and zygotic gdf6a (with a translation-blocking morpholino) generates an earlier dorsalized phenotype, thereby preventing analysis of eye development.34Sidi S Goutel C Peyrieras N Rosa FM Maternal induction of ventral fate by zebrafish radar.Proc Natl Acad Sci USA. 2003; 100: 3315-3320Crossref PubMed Scopus (50) Google Scholar Accordingly, two splice-blocking morpholino antisense oligonucleotides (MOs) were designed to independently target gdf6a splicing, which enables comparison of the phenotype generated by each. The first (gdf6aMO1) targets the 5′ splice site, whereas the second (gdf6aMO2) targets the intron 1–exon 2 boundary. Additional morpholinos were designed to target the translation start site of gdf6b (gdf6bMO) and to provide a capability to reduce apoptotic cell death to the translation start site of p53 (p53MO). Oligonucleotides gdf6aMO1 (GCAATACAAACCTTTTCCCTTGTCC),34Sidi S Goutel C Peyrieras N Rosa FM Maternal induction of ventral fate by zebrafish radar.Proc Natl Acad Sci USA. 2003; 100: 3315-3320Crossref PubMed Scopus (50) Google Scholargdf6aMO2 (GAGATCGTCTGCAAGATAAAGAGAA), and p53MO (GCGCCATTGCTTTGCAAGAATTG)35Langheinrich U Hennen E Stott G Vacun G Zebrafish as a model organism for the identification and characterization of drugs and genes affecting p53 signaling.Curr Biol. 2002; 12: 2023-2028Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar were provided by Gene Tools; gdf6bMO (TCAAAAGTATCCCGCAGGCACACAT) was provided by Open Biosystems. The efficiency of the two gdf6a morpholinos was evaluated by RT-PCR of mRNA derived from 18-hpf uninjected and morphant embryos, by use of gdf6a primers spanning the intron (table 1). Zebrafish (AB strain) were obtained from the zebrafish stock center ZIRC and were maintained under standard conditions. Morpholino (2–4 nl) was injected into one-cell–stage zebrafish embryos, at a concentration of 2.5 mg/ml, as described elsewhere.36Waskiewicz AJ Rikhof HA Moens CB Eliminating zebrafish pbx proteins reveals a hindbrain ground state.Dev Cell. 2002; 3: 723-733Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar All injections of gdf6a morpholino included 3 ng of p53MO to reduce apoptotic cell death, a known side effect of morpholino injection. Morphological observations were made with an Olympus SZX12 stereomicroscope and were recorded using a Qimaging micropublisher digital (charged-couple device) camera. For histological analysis, larvae were fixed in a 2.5% glutaraldehyde, 1% paraformaldehyde mix, followed by 4% osmium tetroxide, embedded in Epon, and a thin (1 μm) section cut with an ultramicrotome. Richardson's and phalloidin stains were used to visualize structural details within the retina and surrounding tissues. The proband exhibited multiple developmental defects, including neurodevelopmental impairment (performance IQ 74), bilateral soft-tissue syndactyly of the 2nd and 3rd toes, an atrial septal defect, and ocular malformations (fig. 1). The latter comprised bilateral retinochoroidal colobomata with optic-nerve involvement (fig. 1A and 1B), plus a unilateral iris coloboma (fig. 1C), which reduced vision to counting fingers and 20/50 in the right and left eyes, respectively. Although the proband's father was asymptomatic, ocular examination revealed features of much milder developmental defects that included a minor degree of optic-nerve dysplasia, anomalous retinal vascular branching, and small retinochoroidal colobomata (fig. 1G and 1H). The changes were associated with corrected acuities of 20/20−2 and 20/30 (normal ∼20/20). Karyotyping identified a chromosome 8q segmental deletion—46,XX, del (8)(q21.2q22.1)—in the proband but in neither parent (data not shown). These findings were confirmed by M-FISH, with the segmental deletion present in all 13 examined metaphase preparations (fig. 1J–1L). The informativeness of microsatellite-marker genotyping was constrained by the small pedigree size and polymorphism-information-content values of available markers. Nonetheless, it confirmed that the deletion was present in the paternally derived chromosome 8, and the semiquantitative dosage information it provided localized the centromeric and telomeric breakpoints to ∼3-Mb regions. CGH accurately defined the extent of the segmental deletion (10.37 Mb) and refined the breakpoint positions to ∼10-kb intervals (data not shown). Long-range PCR amplified a 4.5-kb junctional fragment in the proband but in neither parent (fig. 2C). Sequence analysis of the junctional fragment revealed the insertion of four nucleotides (AGCT) at the junction of the centromeric and telomeric breakpoints (fig. 2A and 2B). The telomeric breakpoint lies in a long terminal repeat (LTR) of family MaLR, within a 3.6-kb region of repetitive sequence (fig. 2A). The centromeric breakpoint is within an Alu element located within a 5.7-kb stretch of contiguous repeats (short interspersed nuclear elements [SINEs], long interspersed nuclear elements [LINEs], LTRs, and simple repeats). The proband's retinal phenotype and the known molecular conservation of ocular development were used to identify candidate genes in silico. Of 31 genes within and 10 adjacent to the segmental deletion, 14 were expressed in both fetal eye and retinal tissue, and, of these, 11 (CA2, CA3, WWP1, NBN, FAM82B, TMEM64, TMEM55A, UQCRB, PTDSS1, SDC2, and GDF6) had orthologues present in Fugu or Danio. Because of its involvement in bone morphogenetic protein (BMP) signaling, its developmental role, and the location of Gdf6 within the Tcm locus,24Zhou E Grimes P Favor J Koeberlein B Pretsch W Neuhauser-Klaus A Sidjanin D Stambolian D Genetic mapping of a mouse ocular malformation locus, Tcm, to chromosome 4.Mamm Genome. 1997; 8: 178-181Crossref PubMed Scopus (19) Google ScholarGDF6 was selected for more-detailed study. Subsequent refinement of the Tcm locus from a 26-Mb24Zhou E Grimes P Favor J Koeberlein B Pretsch W Neuhauser-Klaus A Sidjanin D Stambolian D Genetic mapping of a mouse ocular malformation locus, Tcm, to chromosome 4.Mamm Genome. 1997; 8: 178-181Crossref PubMed Scopus (19) Google Scholar to a 1.3-Mb25Wang KS Zahn LE Favor J Huang KM Stambolian D Genetic and phenotypic analysis of Tcm, a mutation affecting early eye development.Mamm Genome. 2005; 16: 332-343Crossref PubMed Scopus (6) Google Scholar interval permitted comparison of the five genes or transcripts (unknown, helicase-related, Cralbp-related, Asph, and Gdf6) within the Tcm locus with those encompassed by the segmental deletion. Because of a synteny break between human chromosome 8 and murine chromosome 4, Gdf6/GDF6 is the only gene common to the Tcm and chromosome 8q segmental deletion intervals (fig. 2D). Previous studies have examined the role of gdf6a in early dorsal-ventral axis formation, but its function during retinal development remains to be elucidated. The expression of zebrafish gdf6a was examined with in situ hybridization and was shown to be specific for the dorsotemporal region of the developing retina at 18 and 24 hpf (fig. 3A and 3B). The expression pattern of Gdf6 is evolutionarily conserved, as determined by our RT-PCR results of murine retina during early development and the published expression in the dorsal retina of Xenopus37Chang C Hemmati-Brivanlou A Xenopus GDF6, a new antagonist of noggin and a partner of BMPs.Development. 1999; 126: 3347-3357Crossref PubMed Google Scholar (data not shown). Splice-blocking gdf6a morpholinos were injected into one-cell–stage zebrafish embryos; RT-PCR confirmed that >70% of gdf6a mRNA was aberrantly spliced in both gdf6aMO1- and gdf6aMO2-injected morphants (fig. 3C). Morpholino inhibition of gdf6a function revealed the axial vasculature, dorsal fin, hypochord, and dorsal neural-tube anomalies (reported elsewhere32Rissi M Wittbrodt J Delot E Naegeli M Rosa FM Zebrafish radar: a new member of the TGF-beta superfamily defines dorsal regions of the neural plate and the embryonic retina.Mech Dev. 1995; 49: 223-234Crossref PubMed Scopus (78) Google Scholar, 33Hall CJ Flores MV Davidson AJ Crosier KE Crosier PS Radar is required for the establishment of vascular integrity in the zebrafish.Dev Biol. 2002; 251: 105-117Crossref PubMed Scopus (20) Google Scholar). In situ hybridization with probes to aldh1a2, hmx3b, and foxg1 demonstrated that gdf6a morpholinos profoundly altered retinal patterning (fig. 3D–3L). Expression of aldh1a2, a marker of dorsotemporal retina, was completely eliminated in 90% and 97% of gdf6aMO1- and gdf6aMO2-injected embryos, respectively (n=113) (fig. 3D–3F). Expression of hmx3b, an early marker of dorsal retina, was strongly reduced in 81% and 85% of gdf6aMO1- and gdf6aMO2-injected embryos, respectively (n=110) (fig. 3G–3I). In contrast, expression of foxg1, a marker of ventral-nasal retina, was expanded in 77% and 88% of gdf6aMO1-