Asp330 and Tyr331 in the C-terminal Cysteine-rich Region of the Luteinizing Hormone Receptor Are Key Residues in Hormone-induced Receptor Activation
2008; Elsevier BV; Volume: 283; Issue: 38 Linguagem: Inglês
10.1074/jbc.m804395200
ISSN1083-351X
AutoresMartijn Bruysters, Miriam Verhoef‐Post, Axel P. N. Themmen,
Tópico(s)Protein Kinase Regulation and GTPase Signaling
ResumoThe luteinizing hormone (LH) receptor plays an essential role in male and female gonadal function. Together with the follicle-stimulating hormone (FSH) and thyroid stimulating hormone (TSH) receptors, the LH receptor forms the family of glycoprotein hormone receptors. All glycoprotein hormone receptors share a common modular topography, with an N-terminal extracellular ligand binding domain and a C-terminal seven-transmembrane transduction domain. The ligand binding domain consists of 9 leucine-rich repeats, flanked by N- and C-terminal cysteine-rich regions. Recently, crystal structures have been published of the extracellular domains of the FSH and TSH receptors. However, the C-terminal cysteine-rich region (CCR), also referred to as the "hinge region," was not included in these structures. Both structure and function of the CCR therefore remain unknown. In this study we set out to characterize important domains within the CCR of the LH receptor. First, we mutated all cysteines and combinations of cysteines in the CCR to identify the most probable disulfide bridges. Second, we exchanged large parts of the LH receptor CCR by its FSH receptor counterparts, and characterized the mutant receptors in transiently transfected HEK 293 cells. We zoomed in on important regions by focused exchange and deletion mutagenesis followed by alanine scanning. Mutations in the CCR specifically decreased the potencies of LH and hCG, because the potency of the low molecular weight agonist Org 41841 was unaffected. Using this unbiased approach, we identified Asp330 and Tyr331 as key amino acids in LH/hCG mediated signaling. The luteinizing hormone (LH) receptor plays an essential role in male and female gonadal function. Together with the follicle-stimulating hormone (FSH) and thyroid stimulating hormone (TSH) receptors, the LH receptor forms the family of glycoprotein hormone receptors. All glycoprotein hormone receptors share a common modular topography, with an N-terminal extracellular ligand binding domain and a C-terminal seven-transmembrane transduction domain. The ligand binding domain consists of 9 leucine-rich repeats, flanked by N- and C-terminal cysteine-rich regions. Recently, crystal structures have been published of the extracellular domains of the FSH and TSH receptors. However, the C-terminal cysteine-rich region (CCR), also referred to as the "hinge region," was not included in these structures. Both structure and function of the CCR therefore remain unknown. In this study we set out to characterize important domains within the CCR of the LH receptor. First, we mutated all cysteines and combinations of cysteines in the CCR to identify the most probable disulfide bridges. Second, we exchanged large parts of the LH receptor CCR by its FSH receptor counterparts, and characterized the mutant receptors in transiently transfected HEK 293 cells. We zoomed in on important regions by focused exchange and deletion mutagenesis followed by alanine scanning. Mutations in the CCR specifically decreased the potencies of LH and hCG, because the potency of the low molecular weight agonist Org 41841 was unaffected. Using this unbiased approach, we identified Asp330 and Tyr331 as key amino acids in LH/hCG mediated signaling. The glycoprotein hormone luteinizing hormone (LH) 3The abbreviations used are: LHluteinizing hormoneTSHthyroid stimulating hormoneFSHfollicle stimulating hormoneGPIbαglycoprotein IbαhCGhuman chorionic gondotropinECDextracellular binding domainTMDtransmembrane domainCCRC-terminal cysteine-rich regionNCRN-terminal cysteine-rich clusterWTwild typeHAhemagglutininELISAenzyme-linked immunosorbent assayPBSphosphate-buffered salineNgrNogo66 receptorCREcAMP-responsive element. has an essential role in reproduction. In both sexes, LH regulates the production of gonadal androgens, which in women are almost completely converted to estrogens. Furthermore, in women the mid-cycle LH peak triggers ovulation of the mature oocyte ready to be fertilized, whereas the closely related pregnancy hormone, chorionic gonadotropin (hCG), supports the corpus luteum of pregnancy. Both LH and hCG act by binding and activating the LH receptor. The LH receptor has a modular architecture consisting of an ectodomain or extracellular hormone binding domain (ECD), linked to a seven-transmembrane signal transduction domain (7TMD). Together with the receptors for thyroid stimulating hormone (TSH) and follicle stimulating hormone (FSH), the LH receptor belongs to the glycoprotein hormone receptor family. The extracellular ligand binding domain of this family consists of a stretch of nine leucine-rich repeats (LRRs), flanked by N-terminal and C-terminal cysteine-rich clusters (NCR and CCR, respectively). The crystal structures that have been determined for major parts of FSHR and TSHR ECDs show that the LRRs are organized as β sheets, and give rise to a curved helical tube of which the concave surface forms the hormone-binding surface (1Sanders J. Chirgadze D.Y. Sanders P. Baker S. Sullivan A. Bhardwaja A. Bolton J. Reeve M. Nakatake N. Evans M. Richards T. Powell M. Miguel R.N. Blundell T.L. Furmaniak J. Smith B.R. Thyroid. 2007; 17: 395-410Crossref PubMed Scopus (175) Google Scholar, 2Fan Q.R. Hendrickson W.A. Nature. 2005; 433: 269-277Crossref PubMed Scopus (471) Google Scholar). The NCR provides an additional β strand to the binding surface. Because the CCR was not included in the protein expression procedures to obtain the crystals, its structure remains elusive. luteinizing hormone thyroid stimulating hormone follicle stimulating hormone glycoprotein Ibα human chorionic gondotropin extracellular binding domain transmembrane domain C-terminal cysteine-rich region N-terminal cysteine-rich cluster wild type hemagglutinin enzyme-linked immunosorbent assay phosphate-buffered saline Nogo66 receptor cAMP-responsive element. LRRs are considered versatile binding motifs often involving protein-protein interactions, and are observed in a large variety of proteins (3Kobe B. Deisenhofer J. Curr. Opin. Struct. Biol. 1995; 5: 409-416Crossref PubMed Scopus (322) Google Scholar, 4Kobe B. Kajava A.V. Curr. Opin. Struct. Biol. 2001; 11: 725-732Crossref PubMed Scopus (1289) Google Scholar). Also the non-glycoprotein hormone receptor LRRs contain an NCR and CCR and in those LRR proteins of which crystal structures have been resolved, the NCR and CCR form β strands that combine seamlessly with the β sheets formed by the LRRs (5Barton W.A. Liu B.P. Tzvetkova D. Jeffrey P.D. Fournier A.E. Sah D. Cate R. Strittmatter S.M. Nikolov D.B. EMBO J. 2003; 22: 3291-3302Crossref PubMed Scopus (194) Google Scholar, 6Huizinga E.G. Tsuji S. Romijn R.A. Schiphorst M.E. de Groot P.G. Sixma J.J. Gros P. Science. 2002; 297: 1176-1179Crossref PubMed Scopus (501) Google Scholar). Thus, the CCR of the glycoprotein hormone receptors may also be expected to form a prolongation of the LRR β sheets. The function of the CCR has been addressed in more detail by receptor mutagenesis studies. Ligand binding studies with mutant rat LH receptors indicate that LRR1–6 contribute most to high-affinity ligand binding, whereas a combined deletion of LRR9 and the CCR did not alter hCG affinity (7Thomas D. Rozell T.G. Liu X. Segaloff D.L. Mol. Endocrinol. 1996; 10: 760-768PubMed Google Scholar). Truncation of the rat LH receptor demonstrates that neither the 7TMD nor the CCR are essential to high affinity binding (8Braun T. Schofield P.R. Sprengel R. EMBO J. 1991; 10: 1885-1890Crossref PubMed Scopus (312) Google Scholar). A similar approach in the human LH receptor, systematically truncating the receptor at exon boundaries showed a stepwise decrease in affinity loss with severity of truncation (9Hong S. Phang T. Ji I. Ji T.H. J. Biol. Chem. 1998; 273: 13835-13840Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). Here, deleting both 7TMD, and the C-terminal part of the CCR, did not alter hCG affinity. Notably, the above mentioned deletion and truncation mutants failed to be expressed at the plasma membrane. In most LRR proteins the CCR has four cysteines, of which the first two are either directly adjacent or separated by one amino acid resulting in two disulfide bonds (10Matsushima N. Tachi N. Kuroki Y. Enkhbayar P. Osaki M. Kamiya M. Kretsinger R.H. Cell Mol. Life Sci. 2005; 62: 2771-2791Crossref PubMed Scopus (85) Google Scholar). Also in the CCR of the LH receptor the first two (of a total of six) cysteines are located adjacently. Because the CCR is a conserved feature, yet is not required for high-affinity ligand binding, its role may be to structurally preserve the ECD structure, and/or to selectively transduce signals from the ECD to the 7TMD. Crystal structures of the glycoprotein Ibα (GPIbα) suggest a role for the CCR in responding to ligand binding: a 16-residue β-hairpin (β-switch) is formed in the CCR of GPIbα upon binding of the von Willebrand factor (6Huizinga E.G. Tsuji S. Romijn R.A. Schiphorst M.E. de Groot P.G. Sixma J.J. Gros P. Science. 2002; 297: 1176-1179Crossref PubMed Scopus (501) Google Scholar). Noteworthy, all disease-causing gain-of-function mutations are present in this β-switch (11Miller J.L. Cunningham D. Lyle V.A. Finch C.N. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4761-4765Crossref PubMed Scopus (143) Google Scholar, 12Russell S.D. Roth G.J. Blood. 1993; 81: 1787-1791Crossref PubMed Google Scholar). Also for the TSH receptor such a concept has been proposed. Based on a series of constitutively active TSH receptors, Mueller and co-workers (13Mueller S. Kleinau G. Jaeschke H. Neumann S. Krause G. Paschke R. J. Biol. Chem. 2006; 281: 31638-31646Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar) proposed an activation mechanism in which the CCR is key. The authors propose that the CCR acts as a lever linking the ECD LRRs to the 7TMD, in which the conserved cysteine tandem of the CCR serves as a fulcrum. Modification on either site of the lever, by mutation, ligand interaction, or tryptic clipping, changes the conformation of the CCR, and results in 7TMD activation (13Mueller S. Kleinau G. Jaeschke H. Neumann S. Krause G. Paschke R. J. Biol. Chem. 2006; 281: 31638-31646Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Also in the LH receptor, mutation of Ser277 close to the CCR leads to constitutive receptor activation (14Nakabayashi K. Kudo M. Kobilka B. Hsueh A.J. J. Biol. Chem. 2000; 275: 30264-30271Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), supporting a similar mechanism in this receptor as well. Besides via the extracellular domain, the LH receptor can also be activated directly via the 7TMD. Illustrating for this phenomenon is that most of activating LH receptor mutations observed in patients are single amino acid changes within the transmembrane helices (for reviews see Refs. 15Themmen A.P.N. Reproduction. 2005; 130: 263-274Crossref PubMed Scopus (87) Google Scholar and 16Themmen A.P.N. Huhtaniemi I.T. Endocr. Rev. 2000; 21: 551-583Crossref PubMed Google Scholar). Recently, some thienopyr(im)idine derivatives (i.e. Org 41841 and Org 42599) were characterized as a novel class of low molecular weight LH receptor agonists (17van Straten N.C. Schoonus-Gerritsma G.G. van Someren R.G. Draaijer J. Adang A.E. Timmers C.M. Hanssen R.G. van Boeckel C.A. Chembiochem. 2002; 3: 1023-1026Crossref PubMed Scopus (79) Google Scholar, 18Kelder J. Wagener M. Timmers M. Noordik J.H. Cheminformatics Developments. 1. IOS Press, Amsterdam2004: 111-127Google Scholar). These ligands can activate the receptor by interacting directly with the 7TMD, rather than with the receptor ectodomain (19Jäschke H. Neumann S. Moore S. Thomas C.J. Colson A.O. Costanzi S. Kleinau G. Jiang J.K. Paschke R. Raaka B.M. Krause G. Gershengorn M.C. J. Biol. Chem. 2006; 281: 9841-9844Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 20Moore S. Jaeschke H. Kleinau G. Neumann S. Costanzi S. Jiang J.K. Childress J. Raaka B.M. Colson A. Paschke R. Krause G. Thomas C.J. Gershengorn M.C. J. Med. Chem. 2006; 49: 3888-3896Crossref PubMed Scopus (68) Google Scholar). In the present study we unravel the constellation of disulfide bridges in the CCR, and further set out to characterize the requirements of the CCR for hormone-induced signaling. Hereto we exchanged and deleted (parts of) the LH receptor CCR, followed by detailed alanine scanning. This led to the identification of two amino acid residues, Asp330 and Tyr331, as key CCR residues, involved in LH/hCG mediated signaling. In addition we introduce the low molecular weight agonists Org 41841 and Org 42599 as tools to evaluate intrinsic receptor functionality. Materials—Unless stated otherwise, cell culture reagents were purchased from Invitrogen (Paisley, UK): restriction enzymes and polymerases from Roche; fine chemicals from Sigma; oligonucleotides were from Biolegio (Nijmegen, The Netherlands). hCG, LH, Org 41841, and Org 42599 are kind gifts of NV Organon, Oss, The Netherlands. Construction of WT and Mutant LH Receptor Expression Plasmids—Construction of the expression plasmid pSG5-hLHRWT is described elsewhere (21Kraaij R. Post M. Kremer H. Milgrom E. Epping W. Brunner H.G. Grootegoed J.A. Themmen A.P. J. Clin. Endocrinol. Metab. 1995; 80: 3168-3172Crossref PubMed Google Scholar). An N-terminal HA tag was inserted immediately C-terminal to the signal peptide by inserting the primer-dimer (5′GTACCCATACGATGTTCCAGATTACGC and complement) into the Eco47III site at position 84 in the LH receptor cDNA. In this background, the deletion or domain-exchange LH receptor mutants were created by a series of fusion PCRs (see supplemental materials). In short, two or three separate PCR were done to amplify different domains of the LH receptor or, if required, other receptors (pSG5-FSHR (22Minegishi T. Igarashi S. Nakamura K. Nakamura M. Tano M. Shinozaki H. Miyamoto K. Ibuki Y. J. Endocrinol. 1994; 141: 369-375Crossref PubMed Scopus (23) Google Scholar), pSVL-TSHR (23Costagliola S. Swillens S. Niccoli P. Dumont J.E. Vassart G. Ludgate M. J. Clin. Endocrinol. Metab. 1992; 75: 1540-1544Crossref PubMed Scopus (0) Google Scholar), pCDNA3-GP1bα (6Huizinga E.G. Tsuji S. Romijn R.A. Schiphorst M.E. de Groot P.G. Sixma J.J. Gros P. Science. 2002; 297: 1176-1179Crossref PubMed Scopus (501) Google Scholar), and pOTB7-Nogo66-receptor (5Barton W.A. Liu B.P. Tzvetkova D. Jeffrey P.D. Fournier A.E. Sah D. Cate R. Strittmatter S.M. Nikolov D.B. EMBO J. 2003; 22: 3291-3302Crossref PubMed Scopus (194) Google Scholar)). By using extended oligos in these PCRs, overlap was created between bordering PCR fragments and in a second series of PCR, this overlap was used to fuse individual fragments and amplify the fusion product. The resulting product was subcloned into the pSG5-5′HA-hLHR WT construct. Alanine scanning mutagenesis was done using the QuikChange Site-directed Mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's protocol. Oligonucleotides used for mutagenesis are depicted in supplemental materials. All constructs were verified by dideoxynucleotide sequencing. Cell Culture and Transfection—HEK 293 cells were maintained in culture medium, Dulbecco's modified Eagle's medium/F-12 + Glutamax supplemented with 1 × 105 IU/liter penicillin, 0.1 mg/liter streptomycin, and 10% fetal bovine serum. Two days prior to transfection, cells are plated at a density of 20% in 25-cm2 tissue culture flasks (Nalge Nunc International, Rochester, NY). For transfection, 7 μg of LH WT/mutant receptor cDNA (in pSG5), 1.4 μg of pCRE6lux, and 1.4 μgof pRL-SV40 was added to 350 μl of 150 mm NaCl and mixed with 350 μl, 0.03 mg/liter polyethyleneimine (linear Mr ∼ 25,000; Polysciences Inc., Warrington, PA) in 150 mm NaCl. Medium was replaced by serum-free medium and supplemented with a cDNA/polyethyleneimine mixture. After 4 h, medium was supplemented with fetal bovine serum to a final concentration of 10%. Reporter Gene Analysis—To analyze LH receptor activity, WT and mutant expression constructs were transfected to HEK 293 cells (see above). 24 h post-transfection, cells were detached using trypsin/EDTA, and transferred to white μClear TC-treated plates (Greiner Bio-one Alphen a/d Rijn, The Netherlands), 48 h post-transfection, medium was replaced by serum-free culture medium supplemented with 0.1% bovine serum albumin and 25 mm HEPES and a 2-fold dilution series of LH, hCG, Org 41841, or Org 42599. For mass to mole conversion for LH and hCG, molecular masses of 29.5 and 36.7 kDa were assumed, respectively (24Basu A. Shrivastav T.G. Maitra S.K. J. Immunoassay Immunochem. 2005; 26: 313-324Crossref PubMed Scopus (17) Google Scholar, 25Roseman D.S. Baenziger J.U. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9949-9954Crossref PubMed Scopus (68) Google Scholar). After 6 h stimulation, wells were aspired and cells were lysed with 25 mm Tris phosphate, pH 7.8, 8 mm MgCl, 1 mm dithiothreitol, 15% glycerol, 1% Triton X-100 and analyzed for luciferase (cAMP-responsive element driven) and Renilla luciferase (transfection control) activities using the Dual-Luciferase Reporter Assay System according to the manufacturer's instructions (Promega Corporation, Madison, WI). Data were analyzed using Prism3 (Graphpad Software Inc., San Diego, CA). Only ≥3-fold changes in EC50 (compared with WT) are considered relevant, and are tested for statistical significance by Student's t test. p values <0.05 were considered to indicate a significant difference (*, p < 0.05; **, p < 0.01; ***, p < 0.001). ELISA—WT and mutant expression constructs were transfected to HEK 293 cells (see above). 24 h post-transfection, cells were detached using trypsin/EDTA, and transferred to 96-well clear plates (Corning Inc., Corning, NY) that were polylysine coated for ELISA. 48 h post-transfection, cells were washed with PBS and fixed with freshly made 4% paraformaldehyde in PBS (30 min, 22 °C) and blocked with 3% bovine serum albumin in PBS (1 h, 37 °C). Wells were washed 4 times with PBS and incubated (1 h, 37 °C) with 1:1000 dilution of Anti-HA-peroxidase, (3F10, Roche, Mannheim, Germany) in PBS, 3% bovine serum albumin. Wells were washed 6 times for 10 min with PBS and peroxidase activity was assayed using 1-Step Ultra TMB-ELISA (Pierce) according to the manufacturer's instruction. Constellation of Disulfide Bridges in the CCR—Despite the apparent structural resemblance of glycoprotein hormone receptors, the overall sequence identity in the ECD is low, approximately 40% (26Vassart G. Pardo L. Costagliola S. Trends Biochem. Sci. 2004; 29: 119-126Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). However, several sequence motifs are conserved: 4 cysteines in the N-terminal part of the ECD, 9 leucine-rich repeat motifs (XXLXLXX), and 6 cysteines at the C-terminal side of the extracellular domain. These cysteines are always present in even numbers, suggesting that they are conserved as disulfide pairs. To study the importance of the 6 cysteines in the CCR we individually mutated them to alanine and assayed the mutant receptors for functionality in a CRE-driven reporter gene assay. Mutation of Cys304 or Cys336 to alanine does not affect the maximum response to LH (Fig. 1A), and only results in a small (3–5-fold) decrease in LH potency (supplemental materials Fig. S1). In contrast, mutation of Cys279, Cys280, Cys343, or Cys353 completely abolished LH-mediated signaling (Fig. 1A), and mutant receptors could not be detected at the plasma membrane (Fig. 1B). Remarkably, CRE signaling remained possible after stimulation of these mutant receptors with Org 42599 (Fig. 1A). Org 42599 is a low molecular weight LH receptor agonist, based on lead optimization of Org 41841 (18Kelder J. Wagener M. Timmers M. Noordik J.H. Cheminformatics Developments. 1. IOS Press, Amsterdam2004: 111-127Google Scholar) and, as Org 41841 binds to and activates the receptor directly at the 7TMD (17van Straten N.C. Schoonus-Gerritsma G.G. van Someren R.G. Draaijer J. Adang A.E. Timmers C.M. Hanssen R.G. van Boeckel C.A. Chembiochem. 2002; 3: 1023-1026Crossref PubMed Scopus (79) Google Scholar, 19Jäschke H. Neumann S. Moore S. Thomas C.J. Colson A.O. Costanzi S. Kleinau G. Jiang J.K. Paschke R. Raaka B.M. Krause G. Gershengorn M.C. J. Biol. Chem. 2006; 281: 9841-9844Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 20Moore S. Jaeschke H. Kleinau G. Neumann S. Costanzi S. Jiang J.K. Childress J. Raaka B.M. Colson A. Paschke R. Krause G. Thomas C.J. Gershengorn M.C. J. Med. Chem. 2006; 49: 3888-3896Crossref PubMed Scopus (68) Google Scholar), and does not require the ECD. It should be noted that, compared with WT, not only the maximal effect, but also the potency of Org 42599 was reduced (supplemental materials Fig. S1). We observed similar shifts in potencies and maximal effects of both Org 42599 and LH when we transfected decreasing amounts of WT LH receptor plasmid (supplemental Fig. S2). We utilized the residual Org 42599 responsiveness of individual Cys to Ala mutant LH receptors to probe disulfide bridges in the CCR. We argued that mutation of both cysteines of the same disulfide bridge would have the same effect as mutation of only one cysteine, because in both cases only one bridge is broken. In contrast, mutating two cysteines that are not interconnected would break two disulfide bridges and would aggravate the effect of the individual mutations. To test this hypothesis we substituted the following pairs of cysteines by alanines: Cys279 + Cys343, Cys279 + Cys353, Cys280 + Cys343, and Cys280 + Cys353. As is clearly illustrated by Fig. 1C, only the combinations C279A + C343A and C280A + C353A responded to Org 42599, suggesting that disulfide bonds are present between cysteines 279 and 343, and between 280 and 353. A third disulfide bridge is possible between Cys304 and Cys336. Both single cysteine to alanine mutants as well as the double alanine substitution C304A, C336A only result in a small (maximum 5-fold) decrease in potency of LH. From these data we cannot conclude whether a disulfide bridge is present or there is no disulfide bridge at all. Clear, however, is that the contribution of Cys304 and Cys336 to the overall receptor structure is limited. Assuming the third disulfide bridge between Cys304 and Cys336, an overall structure results as depicted in Fig. 2. LH/hCG-mediated Signaling Requires CCR of Glycoprotein Hormone Receptor—Because sequence homology between the glycoprotein hormone receptors is relatively low, we defined the CCR as the region between LRRs and 7TMD, ranging from the first to the last cysteine (in the LH receptor: Cys279 to Cys353). To probe the specific relevance of the LH receptor CCR for the function of the LH receptor, we deleted it, or replaced it by CCRs of other related (FSH receptor and TSH receptor) or unrelated proteins (Nogo66 receptor (NgR) and GPIbα). The latter two are not 7TMD receptors, but do contain LRRs with flanking CCR and NCR of which crystal structures are available (5Barton W.A. Liu B.P. Tzvetkova D. Jeffrey P.D. Fournier A.E. Sah D. Cate R. Strittmatter S.M. Nikolov D.B. EMBO J. 2003; 22: 3291-3302Crossref PubMed Scopus (194) Google Scholar, 6Huizinga E.G. Tsuji S. Romijn R.A. Schiphorst M.E. de Groot P.G. Sixma J.J. Gros P. Science. 2002; 297: 1176-1179Crossref PubMed Scopus (501) Google Scholar). Fig. 3 shows that the introduction of non-related CCRs (NgR and GPIbα), as well as the complete deletion of the CCR, rendered the mutant receptors completely unresponsive to LH. Analysis of cell surface expression (by ELISA) showed that these mutant receptors were not expressed at the cell surface (data not shown). In contrast, the CCR of the FSH and TSH receptors are much better tolerated as replacements of the original CCR. These exchange mutants are well expressed (not shown). Furthermore, the mutant LH receptor in which the complete CCR is replaced by that of the FSH receptor (hereafter referred to F281–352) responds to LH and hCG with unaltered potency (Fig. 3 and Table 1). Using the TSH receptor as CCR donor, the mutant receptor is also functional, but the potency of LH and the maximal effect are reduced (Fig. 3 and Table 1).TABLE 1LH or hCG activation of WT or CCR exchange mutants of the LH receptor Open table in a new tab Fragment Exchange within CCR Shows That Amino Acids 305–335 Are of Key Importance in LH/hCG-mediated Activation—The six cysteines in the CCR of the receptor define four intercysteine stretches consisting of amino acids 281–303, 305–335, 337–342, and 344–352 (Fig. 2). To unravel the function of the CCR we replaced several of these stretches of the LH receptor with the corresponding sequences of the FSH receptor and tested the mutant receptors in our CRE-driven reporter gene assay. Replacing the first intercysteine domain or a combination of domains 1, 2, and 3 by their FSH receptor counterparts (F281–303 and F281–342) did not alter the potency of LH, whereas replacement of intercysteine domains 2, 3, and 4 (F305–352) resulted in an 8-fold decrease of LH potency (Table 1). Zooming in on this region, we individually replaced intercysteine stretches 2, 3, and 4 (F305–335, F337–342, and F344–352, respectively). Replacement of intercysteine stretch 2 (F305–335) resulted in a nearly 30-fold decrease in LH potency, whereas the other exchanges were relatively ineffective (Table 1). Using the homologous hormone hCG a similar trend is observed, although effects are generally more moderate (Table 1). None of the intercysteine replacement mutants displayed altered receptor expression (supplemental Fig. S3). Focused Deletion within the CCR Leads to Complete Nonresponsiveness to LH/hCG—As reported earlier (27Müller T. Gromoll J. Simoni M. J. Clin. Endocrinol. Metab. 2003; 88: 2242-2249Crossref PubMed Scopus (94) Google Scholar), deletion of the exon 10-encoded part of the LH receptor (Δ290–316), resulted in a mutant receptor for which potencies of especially LH, and to a lesser extent hCG, were reduced (15- and 4-fold, respectively, Table 2). Because replacement of the second intercysteine stretch with its FSHR counterpart (F305–335) also effectively reduced the potencies of LH and hCG (28- and 13-fold, respectively), we expected the overlap with exon 10 to be involved. However, deleting this overlap, i.e. the C-terminal 12 amino acids of exon 10 (Δ305–316), left the LH and hCG potencies unaffected (Table 2). Because the patient phenotype could not be mimicked by deleting amino acids 305–316, we also set out to delete the other amino acids encoded by exon 10 (Δ290–303). Remarkably, also this deletion did not result in large changes of LH/hCG potencies (Table 2).TABLE 2LH or hCG activation of WT or partial CCR deletion mutants of the LH receptor Open table in a new tab Apparently, the exon 10-encoded part of the second intercysteine stretch does not mediate the decreased potency observed for FSH receptor exchange mutant F305–335. In sharp contrast, deleting the exon 11-encoded part of this second intercysteine stretch (Δ317–335) rendered the LH receptor completely unresponsive to both hCG and LH (Fig. 4A and Table 2) without altering its plasma membrane expression (Fig. 4C). Because the mutation may cause intrinsic incapability of the receptor to signal, we applied the low molecular weight agonist Org 41841. In contrast to the glycoprotein hormones, Org 41841 binds directly to the transmembrane region and may therefore activate the receptor irrespective of mutations in the CCR. Indeed, despite the complete abolishment of the response to LH and hCG, the Δ317–335 mutant receptor responded with unaltered potency to Org 41841 (Fig. 4B). Deletion of the N-terminal amino acids of intercysteine domain 2, Δ317–324 did not result in changes in LH/hCG potencies, indicating the importance of amino acids 325–335 in LH/hCG mediated signaling. Alanine Scanning Mutagenesis Shows That Asp330 and Tyr331 Are Crucial Residues in CCR—Because deletion of amino acids 317–335, but not 317–324, was deleterious to LH/hCG induced signaling, we applied alanine scanning on amino acids 325–335 to identify important residues in the 324–335 region. Hereto, amino acids Glu325 to Phe335 were individually mutated to alanines. Major changes in potency for LH, but not for Org 41841 were observed for D330A and Y331A mutant LH receptors (22- and 75-fold, respectively; Fig. 5 and Table 3). For mutant receptors W329A and F335A, decreases in LH potency were smaller (3- and 4-fold, respectively). None of the other mutations resulted in a major change in LH potency. Again, for hCG similar, but milder, changes were observed, whereas potencies of Org 41841 remained unaltered for all mutant receptors (Table 3).TABLE 3Alanine scanning of residue 325 to 335 of the LH receptor Open table in a new tab Recently, structures of the extracellular domain of both FSH (2Fan Q.R. Hendrickson W.A. Nature. 2005; 433: 269-277Crossref PubMed Scopus (471) Google Scholar) and TSH receptors (1Sanders J. Chirgadze D.Y. Sanders P. Baker S. Sullivan A. Bhardwaja A. Bolton J. Reeve M. Nakatake N. Evans M. Richards T. Powell M. Miguel R.N. Blundell T.L. Furmaniak J. Smith B.R. Thyroid. 2007; 17: 395-410Crossref PubMed Scopus (175) Google Scholar) have been resolved. Unfortunately, the CCR was not included in these crystallization attempts and the structure of the CCRs thus remains elusive. To the best of our knowledge, attempts to provide structural clues on the structure of the CCR have proven unsuccessful. Because disulfide bridges may be critical in upholding the structure of the CCR, we set out to unravel the constellation of the six cysteines in this domain. Mutation of individual
Referência(s)