Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

ABT-737 Induces Expression of the Death Receptor 5 and Sensitizes Human Cancer Cells to TRAIL-induced Apoptosis

2008; Elsevier BV; Volume: 283; Issue: 36 Linguagem: Inglês

10.1074/jbc.m802511200

ISSN

1083-351X

Autores

Jin H. Song, Karthikeyan Kandasamy, Andrew S. Kraft,

Tópico(s)

RNA Interference and Gene Delivery

Resumo

Because Bcl-2 family members inhibit the ability of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) to induce apoptosis, we investigated whether ABT-737, a small molecule Bcl-2 inhibitor, enhances TRAIL killing. We demonstrate that a combination of ABT-737 and TRAIL induced significant cell death in multiple cancer types, including renal, prostate, and lung cancers, although each agent individually had little activity in these tumor cells. All of these cell lines expressed the Mcl-1 protein that is known to block the activity of ABT-737 and TRAIL but did not block the synergy between these agents. However, Bax-deficient cell lines, including DU145 and HCT116 cells and those cell lines expressing low levels of TRAIL receptor, were resistant to apoptosis induced by these agents. To understand how ABT-737 functions to markedly increase TRAIL sensitivity, the levels of specific death-inducing signaling complex components were evaluated. Treatment with ABT-737 did not change the levels of c-FLIP, FADD, and caspase-8 but up-regulated the levels of the TRAIL receptor DR5. DR5 up-regulation induced by ABT-737 treatment occurred through a transcriptional mechanism, and mutagenesis studies demonstrated that the NF-κB site found in the DR5 promoter was essential for the ability of ABT-737 to increase the levels of this mRNA. Using luciferase reporter plasmids, ABT-737 was shown to stimulate NF-κB activity. Together, these results demonstrate that the ability of ABT-737 and TRAIL to induce apoptosis is mediated through activation of both the extrinsic and intrinsic pathways. Combinations of ABT-737 and TRAIL can be exploited therapeutically where antiapoptotic Bcl-2 family members drive tumor cell resistance to current anticancer therapies. Because Bcl-2 family members inhibit the ability of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) to induce apoptosis, we investigated whether ABT-737, a small molecule Bcl-2 inhibitor, enhances TRAIL killing. We demonstrate that a combination of ABT-737 and TRAIL induced significant cell death in multiple cancer types, including renal, prostate, and lung cancers, although each agent individually had little activity in these tumor cells. All of these cell lines expressed the Mcl-1 protein that is known to block the activity of ABT-737 and TRAIL but did not block the synergy between these agents. However, Bax-deficient cell lines, including DU145 and HCT116 cells and those cell lines expressing low levels of TRAIL receptor, were resistant to apoptosis induced by these agents. To understand how ABT-737 functions to markedly increase TRAIL sensitivity, the levels of specific death-inducing signaling complex components were evaluated. Treatment with ABT-737 did not change the levels of c-FLIP, FADD, and caspase-8 but up-regulated the levels of the TRAIL receptor DR5. DR5 up-regulation induced by ABT-737 treatment occurred through a transcriptional mechanism, and mutagenesis studies demonstrated that the NF-κB site found in the DR5 promoter was essential for the ability of ABT-737 to increase the levels of this mRNA. Using luciferase reporter plasmids, ABT-737 was shown to stimulate NF-κB activity. Together, these results demonstrate that the ability of ABT-737 and TRAIL to induce apoptosis is mediated through activation of both the extrinsic and intrinsic pathways. Combinations of ABT-737 and TRAIL can be exploited therapeutically where antiapoptotic Bcl-2 family members drive tumor cell resistance to current anticancer therapies. The recombinant TRAIL 2The abbreviations used are:TRAILtumor necrosis factor-related apoptosis-inducing ligandDISCdeath-inducing signaling complexDR5death receptor 5ROSreactive oxygen speciessiRNAsmall interfering RNAFACSfluorescence-activated cell sorterGAPDHglyceraldehyde-3-phosphate dehydrogenaseHRPhorseradish peroxidaseZbenzyloxycarbonylfmkfluoromethyl ketoneHEK293human embryonic kidney 293PARPpoly(ADP-ribose) polymerase. and agonist antibodies targeted against its receptor are capable of inducing the selective apoptotic death of human cancer cells while sparing normal human cells (1Ashkenazi A. Pai R.C. Fong S. Leung S. Lawrence D.A. Marsters S.A. Blackie C. Chang L. McMurtrey A.E. Hebert A. DeForge L. Koumenis I.L. Lewis D. Harris L. Bussiere J. Koeppen H. Shahrokh Z. Schwall R.H. J. Clin. Invest. 1999; 104: 155-162Crossref PubMed Scopus (2002) Google Scholar, 2Walczak H. Miller R.E. Ariail K. Gliniak B. Griffith T.S. Kubin M. Chin W. Jones J. Woodward A. Le T. Smith C. Smolak P. Goodwin R.G. Rauch C.T. Schuh J.C. Lynch D.H. Nat. Med. 1999; 5: 157-163Crossref PubMed Scopus (2233) Google Scholar, 3Hao C. Song J.H. Hsi B. Lewis J. Song D.K. Petruk K.C. Tyrrell D.L. Kneteman N.M. Cancer Res. 2004; 64: 8502-8506Crossref PubMed Scopus (129) Google Scholar, 4Ichikawa K. Liu W. Zhao L. Wang Z. Liu D. Ohtsuka T. Zhang H. Mountz J.D. Koopman W.J. Kimberly R.P. Zhou T. Nat. Med. 2001; 7: 954-960Crossref PubMed Scopus (498) Google Scholar). TRAIL binds to two receptors, DR5 (TRAIL-R2) and DR4 (TRAIL-R1) (5Walczak H. Krammer P.H. Exp. Cell Res. 2000; 256: 58-66Crossref PubMed Scopus (549) Google Scholar), and when bound to the cell (6Pan G. Ni J. Wei Y.F. Yu G. Gentz R. Dixit V.M. Science. 1997; 277: 815-818Crossref PubMed Scopus (1381) Google Scholar, 7Sheridan J.P. Marsters S.A. Pitti R.M. Gurney A. Skubatch M. Baldwin D. Ramakrishnan L. Gray C.L. Baker K. Wood W.I. Goddard A.D. Godowski P. Ashkenazi A. Science. 1997; 277: 818-821Crossref PubMed Scopus (1529) Google Scholar) recruits intracellular FADD and caspase-8 to form a death-inducing signaling complex (DISC) (8Kischkel F.C. Lawrence D.A. Chuntharapai A. Schow P. Kim K.J. Ashkenazi A. Immunity. 2000; 12: 611-620Abstract Full Text Full Text PDF PubMed Scopus (837) Google Scholar). Activation of the DISC leads to the cleavage of caspase-8 and the BH3 protein BID that can function to stimulate the intrinsic mitochondrial pathway, which in turn releases cytochrome c, Smac/DIABLO (mitochondria-derived activator of caspase/direct inhibitor of apoptosis binding protein with low pI), and induces the cleavage of caspase-9 and subsequently caspase-3 (9Igney F.H. Krammer P.H. Nat. Rev. Cancer. 2002; 2: 277-288Crossref PubMed Scopus (1649) Google Scholar, 10Li H. Zhu H. Xu C.J. Yuan J. Cell. 1998; 94: 491-501Abstract Full Text Full Text PDF PubMed Scopus (3790) Google Scholar). Although TRAIL holds great promise as a potential chemotherapeutic agent, multiple tumor types grown in culture or implanted in animals are resistant to this agent (11Jin H. Yang R. Fong S. Totpal K. Lawrence D. Zheng Z. Ross J. Koeppen H. Schwall R. Ashkenazi A. Cancer Res. 2004; 64: 4900-4905Crossref PubMed Scopus (97) Google Scholar, 12Nicholson D.W. Nature. 2000; 407: 810-816Crossref PubMed Scopus (613) Google Scholar). tumor necrosis factor-related apoptosis-inducing ligand death-inducing signaling complex death receptor 5 reactive oxygen species small interfering RNA fluorescence-activated cell sorter glyceraldehyde-3-phosphate dehydrogenase horseradish peroxidase benzyloxycarbonyl fluoromethyl ketone human embryonic kidney 293 poly(ADP-ribose) polymerase. One common mechanism for the resistance to TRAIL-induced apoptosis is the overexpression of Bcl-2 or its family members that function to block the mitochondrial pathway. Bcl-2 protein overexpression protects prostate, breast, colon cancers, and melanoma from TRAIL-induced apoptosis (13Fulda S. Meyer E. Debatin K.M. Oncogene. 2002; 21: 2283-2294Crossref PubMed Scopus (335) Google Scholar, 14Munshi A. Pappas G. Honda T. McDonnell T.J. Younes A. Li Y. Meyn R.E. Oncogene. 2001; 20: 3757-3765Crossref PubMed Scopus (107) Google Scholar, 15Sinicrope F.A. Penington R.C. Tang X.M. Clin. Cancer Res. 2004; 10: 8284-8292Crossref PubMed Scopus (83) Google Scholar, 16Thomas W.D. Zhang X.D. Franco A.V. Nguyen T. Hersey P. J. Immunol. 2000; 165: 5612-5620Crossref PubMed Scopus (100) Google Scholar). Other members of the Bcl-2 family, including Bfi-1/A1, Mcl-1, and Bcl-xL, can also function in a similar fashion (17Bai J. Sui J. Demirjian A. Vollmer Jr., C.M. Marasco W. Callery M.P. Cancer Res. 2005; 65: 2344-2352Crossref PubMed Scopus (112) Google Scholar, 18Taniai M. Grambihler A. Higuchi H. Werneburg N. Bronk S.F. Farrugia D.J. Kaufmann S.H. Gores G.J. Cancer Res. 2004; 64: 3517-3524Crossref PubMed Scopus (198) Google Scholar, 19Werner A.B. de Vries E. Tait S.W. Bontjer I. Borst J. J. Biol. Chem. 2002; 277: 22781-22788Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). TRAIL treatment activates BH3-containing proteins, including PUMA, Bim, and Bak, that can be sequestered by Mcl-1, whereas TRAIL-activated Bax and Bid are bound to the Bcl-xL proteins (20Willis S.N. Chen L. Dewson G. Wei A. Naik E. Fletcher J.I. Adams J.M. Huang D.C. Genes Dev. 2005; 19: 1294-1305Crossref PubMed Scopus (1054) Google Scholar). Lowering the level of Mcl-1 by the use of short hairpin RNAs or pharmacologic maneuvers, such as treatment with sorafenib, releases Bim from the Mcl-1 protein (21Zhang W. Konopleva M. Ruvolo V.R. McQueen T. Evans R.L. Bornmann W.G. McCubrey J. Cortes J. Andreeff M. Leukemia (Basingstoke). 2008; 22: 808-818Crossref PubMed Scopus (144) Google Scholar) and sensitizes tumor cells to TRAIL-induced apoptosis (22Ricci M.S. Kim S.H. Ogi K. Plastaras J.P. Ling J. Wang W. Jin Z. Liu Y.Y. Dicker D.T. Chiao P.J. Flaherty K.T. Smith C.D. El-Deiry W.S. Cancer Cell. 2007; 12: 66-80Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 23Meng X.W. Lee S.H. Dai H. Loegering D. Yu C. Flatten K. Schneider P. Dai N.T. Kumar S.K. Smith B.D. Karp J.E. Adjei A.A. Kaufmann S.H. J. Biol. Chem. 2007; 282: 29831-29846Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). The central role that Bcl-2 family members play in resistance to chemotherapy in multiple malignancies, including chronic lymphocytic leukemia, follicular lymphoma, and acute lymphocytic leukemia, has led to the development of a small molecule high affinity (nanomolar) inhibitor of this protein, ABT-737 (24Certo M. Del Gaizo Moore V. Nishino M. Wei G. Korsmeyer S. Armstrong S.A. Letai A. Cancer Cell. 2006; 9: 351-365Abstract Full Text Full Text PDF PubMed Scopus (1003) Google Scholar, 25Oltersdorf T. Elmore S.W. Shoemaker A.R. Armstrong R.C. Augeri D.J. Belli B.A. Bruncko M. Deckwerth T.L. Dinges J. Hajduk P.J. Joseph M.K. Kitada S. Korsmeyer S.J. Kunzer A.R. Letai A. Li C. Mitten M.J. Nettesheim D.G. Ng S. Nimmer P.M. O'Connor J.M. Oleksijew A. Petros A.M. Reed J.C. Shen W. Tahir S.K. Thompson C.B. Tomaselli K.J. Wang B. Wendt M.D. Zhang H. Fesik S.W. Rosenberg S.H. Nature. 2005; 435: 677-681Crossref PubMed Scopus (2946) Google Scholar). ABT-737 binds to the hydrophobic groove in Bcl-2, Bcl-xL, and Bcl-w and prevents them from sequestering proapoptotic BH3-only proteins such as tBid, Bad, and Bim (25Oltersdorf T. Elmore S.W. Shoemaker A.R. Armstrong R.C. Augeri D.J. Belli B.A. Bruncko M. Deckwerth T.L. Dinges J. Hajduk P.J. Joseph M.K. Kitada S. Korsmeyer S.J. Kunzer A.R. Letai A. Li C. Mitten M.J. Nettesheim D.G. Ng S. Nimmer P.M. O'Connor J.M. Oleksijew A. Petros A.M. Reed J.C. Shen W. Tahir S.K. Thompson C.B. Tomaselli K.J. Wang B. Wendt M.D. Zhang H. Fesik S.W. Rosenberg S.H. Nature. 2005; 435: 677-681Crossref PubMed Scopus (2946) Google Scholar, 26Konopleva M. Contractor R. Tsao T. Samudio I. Ruvolo P.P. Kitada S. Deng X. Zhai D. Shi Y.X. Sneed T. Verhaegen M. Soengas M. Ruvolo V.R. McQueen T. Schober W.D. Watt J.C. Jiffar T. Ling X. Marini F.C. Harris D. Dietrich M. Estrov Z. McCubrey J. May W.S. Reed J.C. Andreeff M. Cancer Cell. 2006; 10: 375-388Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar, 27Chen S. Dai Y. Harada H. Dent P. Grant S. Cancer Res. 2007; 67: 782-791Crossref PubMed Scopus (353) Google Scholar). ABT-737 binds with lower affinity to the Bcl-B, Mcl-1, and Bfi/A1 proteins. ABT-737 can induce concentration-dependent apoptosis when incubated with human leukemic cells (26Konopleva M. Contractor R. Tsao T. Samudio I. Ruvolo P.P. Kitada S. Deng X. Zhai D. Shi Y.X. Sneed T. Verhaegen M. Soengas M. Ruvolo V.R. McQueen T. Schober W.D. Watt J.C. Jiffar T. Ling X. Marini F.C. Harris D. Dietrich M. Estrov Z. McCubrey J. May W.S. Reed J.C. Andreeff M. Cancer Cell. 2006; 10: 375-388Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar) and is synergistic with paclitaxel in killing small cell lung cancer cells (28Shoemaker A.R. Oleksijew A. Bauch J. Belli B.A. Borre T. Bruncko M. Deckwirth T. Frost D.J. Jarvis K. Joseph M.K. Marsh K. McClellan W. Nellans H. Ng S. Nimmer P. O'Connor J.M. Oltersdorf T. Qing W. Shen W. Stavropoulos J. Tahir S.K. Wang B. Warner R. Zhang H. Fesik S.W. Rosenberg S.H. Elmore S.W. Cancer Res. 2006; 66: 8731-8739Crossref PubMed Scopus (138) Google Scholar). In multiple myeloma, combining ABT-737 with the proteasome inhibitor, bortezomib, mephalan, or dexamethasone induces additive cytotoxic effects (29Chauhan D. Velankar M. Brahmandam M. Hideshima T. Podar K. Richardson P. Schlossman R. Ghobrial I. Raje N. Munshi N. Anderson K.C. Oncogene. 2007; 26: 2374-2380Crossref PubMed Scopus (190) Google Scholar). Although some small cell lung carcinoma cell lines are moderately sensitive to this agent (30Tahir S.K. Yang X. Anderson M.G. Morgan-Lappe S.E. Sarthy A.V. Chen J. Warner R.B. Ng S.C. Fesik S.W. Elmore S.W. Rosenberg S.H. Tse C. Cancer Res. 2007; 67: 1176-1183Crossref PubMed Scopus (281) Google Scholar), the majority of cell lines of this tumor type and other solid tumors are resistant to ABT-737-induced apoptosis. An unbiased RNA interference-based screen demonstrated that Mcl-1, which does not bind ABT-737 with high affinity, is the protein causing resistance of small cell lung cancer to this compound (31Lin X. Morgan-Lappe S. Huang X. Li L. Zakula D.M. Vernetti L.A. Fesik S.W. Shen Y. Oncogene. 2007; 26: 3972-3979Crossref PubMed Scopus (217) Google Scholar). The importance of Mcl-1 to ABT-737 resistance has been demonstrated in multiple cell lines, including mouse lymphoma and human leukemia (26Konopleva M. Contractor R. Tsao T. Samudio I. Ruvolo P.P. Kitada S. Deng X. Zhai D. Shi Y.X. Sneed T. Verhaegen M. Soengas M. Ruvolo V.R. McQueen T. Schober W.D. Watt J.C. Jiffar T. Ling X. Marini F.C. Harris D. Dietrich M. Estrov Z. McCubrey J. May W.S. Reed J.C. Andreeff M. Cancer Cell. 2006; 10: 375-388Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar, 32van Delft M.F. Wei A.H. Mason K.D. Vandenberg C.J. Chen L. Czabotar P.E. Willis S.N. Scott C.L. Day C.L. Cory S. Adams J.M. Roberts A.W. Huang D.C. Cancer Cell. 2006; 10: 389-399Abstract Full Text Full Text PDF PubMed Scopus (1060) Google Scholar). Knocking down the levels of this protein with RNA interference or by the addition of compounds, including the kinase inhibitor sorafenib (BAY 43-9006) and the cyclin-dependent kinase inhibitor roscovitine, sensitizes both solid and liquid tumor cells to death induced by this agent (27Chen S. Dai Y. Harada H. Dent P. Grant S. Cancer Res. 2007; 67: 782-791Crossref PubMed Scopus (353) Google Scholar, 31Lin X. Morgan-Lappe S. Huang X. Li L. Zakula D.M. Vernetti L.A. Fesik S.W. Shen Y. Oncogene. 2007; 26: 3972-3979Crossref PubMed Scopus (217) Google Scholar). Additionally, the phosphorylation of Bcl-2 can also inhibit the activity of ABT-737 in leukemic samples and agents that block the mitogen-activated protein kinase pathway can reverse this resistance (26Konopleva M. Contractor R. Tsao T. Samudio I. Ruvolo P.P. Kitada S. Deng X. Zhai D. Shi Y.X. Sneed T. Verhaegen M. Soengas M. Ruvolo V.R. McQueen T. Schober W.D. Watt J.C. Jiffar T. Ling X. Marini F.C. Harris D. Dietrich M. Estrov Z. McCubrey J. May W.S. Reed J.C. Andreeff M. Cancer Cell. 2006; 10: 375-388Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar). Given the role of the Bcl-2 family members in inhibiting TRAIL-induced apoptosis, we combined ABT-737 and TRAIL to examine their ability to synergize in multiple tumor types, including lung, prostate, and renal cancers. We find that these compounds are highly synergistic even in the face of elevated levels of Mcl-1. Solid tumor cell lines that are resistant to combination therapy prove to have low levels of either Bax protein or the TRAIL receptor DR5. In resistant cell lines, ABT-737 treatment up-regulates the levels of the TRAIL receptor, DR5, through a transcriptional mechanism based on activation of NF-κB. Therefore, our study demonstrates that ABT-737 through modulation of the intrinsic pathway can markedly enhance the apoptotic activity of the extrinsic pathway activated by TRAIL. Cell Lines, Antibodies, and Reagents—Human cancer cell lines were grown in either Dulbecco's modified Eagle's medium or RPMI 1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen), 100 units/ml penicillin, and 100 μg/ml streptomycin. Antibodies were obtained from the following sources: GAPDH, CHOP, β-actin, Bim, Bik, Puma and Mcl-1 from Santa Cruz Biotechnology (Santa Cruz, CA); Bcl-2, Bax, cytochrome c, poly(ADP-ribose) polymerase, Itch, TRAF2, and RIP from BD Biosciences; Bid and caspase-9 from Cell Signaling Technology (Danvers, MA); Bak (NT) from Upstate Biotechnology (Lake Placid, NY); caspase-3 from StressGen Bioreagents (Victoria, British Columbia, Canada); caspase-8 from MBL International (Nagoya, Japan); FLIP from Alexis; DR4 and DR5 from ProSci Inc. (Poway, CA); and FLAG antibody and FLAG-agarose beads from Sigma. HRP-conjugated goat anti-rabbit and goat anti-mouse antibodies were from GE Healthcare. Anti-mouse IgG2b-HRP was obtained from Southern Biotech (Birmingham, AL). The following reagents were obtained from the indicated sources: Z-VAD-fmkfromR&D Systems (Minneapolis, MN), human recombinant nontagged TRAIL from PeproTech (Rocky Hill, NJ), and FLAG-tagged TRAIL from Alexis were used. ABT-737 (A-779024.0) and its enantiomer (A-793844.0) were a gift of Abbott Laboratories. Both compounds were dissolved in dimethyl sulfoxide (DMSO; Sigma) at the concentration of 50 mm, and aliquots were stored at -80 °C. Cytotoxicity Assays—Cells were seeded in 96-well plates or culture dishes and treated with recombinant TRAIL in the absence or presence of ABT-737. Cell viability was determined by an acid phosphatase assay (33Song J.H. Wang C.X. Song D.K. Wang P. Shuaib A. Hao C. J. Biol. Chem. 2005; 280: 12896-12901Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 34Song J.H. Slot A.J. Ryan R.W. Ross G.M. Neuropharmacology. 2004; 46: 984-993Crossref PubMed Scopus (16) Google Scholar), and cellular apoptosis was quantitated under phase-contrast microscopy. Percentage of cell death was evaluated by trypan blue exclusion assay as described previously (36Song J.H. Song D.K. Pyrzynska B. Petruk K.C. Van Meir E.G. Hao C. Brain Pathol. 2003; 13: 539-553Crossref PubMed Scopus (71) Google Scholar). The data shown reflect the percent activity when compared with vehicle-treated control cells. FACS Analysis—Cell-surface DR5 expression was analyzed by flow cytometry (35Song J.H. Tse M.C. Bellail A. Phuphanich S. Khuri F. Kneteman N.M. Hao C. Cancer Res. 2007; 67: 6946-6955Crossref PubMed Scopus (127) Google Scholar). The procedure for direct antibody staining and subsequent flow cytometric analysis of this cell-surface protein was described previously (35Song J.H. Tse M.C. Bellail A. Phuphanich S. Khuri F. Kneteman N.M. Hao C. Cancer Res. 2007; 67: 6946-6955Crossref PubMed Scopus (127) Google Scholar). Phycoerythrin-conjugated mouse monoclonal anti-human DR5 (clone DJR2-4), anti-human DR4 (clone DJR1), and phycoerythrin-conjugated mouse IgG1 isotype control (MOPC21/P3) were purchased from eBioscience (San Diego, CA). Detection of Bax and Bak conformational change was carried out using cell pellets (1 × 106). Pellets were washed with phosphate-buffered saline and incubated for 40 min at 4 °C with either mouse IgG1 antibody as a negative control, a mouse monoclonal antibody against amino acids 1-52 of Bak (AM03, clone TC100; Oncogene Research Products), or a mouse monoclonal antibody against amino acids 12-24 of Bax (clone 6A7; BD Biosciences). After washing with phosphate-buffered saline, the binding of antibody was visualized with fluorescein isothiocyanate-conjugated anti-mouse IgG (1:200) (Sigma). 10,000 cells were analyzed using Cell Quest™ software (BD Biosciences). Cytosolic Fractionation, DISC Immunoprecipitation, and Western Blotting—Cytosolic S100 fraction was prepared from cells according to a method described previously (36Song J.H. Song D.K. Pyrzynska B. Petruk K.C. Van Meir E.G. Hao C. Brain Pathol. 2003; 13: 539-553Crossref PubMed Scopus (71) Google Scholar). TRAIL-induced DISC was immunoprecipitated and subjected to Western blot analysis according to a previously reported protocol (35Song J.H. Tse M.C. Bellail A. Phuphanich S. Khuri F. Kneteman N.M. Hao C. Cancer Res. 2007; 67: 6946-6955Crossref PubMed Scopus (127) Google Scholar). To examine protein expression, the cells were lysed in ice-cold lysis buffer (20 mmol/liter Tris-HCl (pH 7.4), 150 mmol/liter NaCl, 2 mmol/liter EDTA, 10% glycerol, 1% Triton X-100, 1% protease inhibitor mixture, and 1 mmol/liter phenylmethylsulfonyl fluoride). Equal amounts of proteins were subjected to SDS-PAGE and transferred onto nitrocellulose membranes. The membranes were incubated with the antibodies as indicated overnight at 4 °C. The membranes were washed and incubated for 1 h at room temperature with the anti-mouse IgG2b-HRP, anti-mouse IgG-HRP, or anti-rabbit IgG-HRP. The blots were again washed and developed by enhanced chemiluminescence reagents (GE Healthcare). Silencing of Gene Expression with Small Interfering RNA (siRNA) and Gene Transfection—Gene silencing was achieved by transfecting cells with siRNA duplexes using the Lipofectamine 2000 transfection reagent (Invitrogen) following the manufacturer's instructions and siRNAs duplexes targeting human DR5 (5′-AACTACCAGAAAGGTATACCT-3′), Mcl-1 (5′-AAAAGTATCACAGACGTTCTC-3′), Bcl-2 (5′-AACCGGGAGATAGTGATGAAG-3′), Bcl-xl (5′-TAGGGTGGCCCTTGCAGTTCA-3′), Bax (5′-AACATGGAGCTGCAGAGGATGA-3′) or siRNA duplexes targeting human Bak 5′-AAGCGAAGTCTTTGCCTTCTC-3′. Scrambled sequence of nonsilencing control siRNA oligonucleotides, which does not match any human genome sequence, that target the sequence 5′-AATTCTCCGAACGTGTCACGT-3′ were purchased from Qiagen (Valencia, CA). Gene transfection of human FLAG-tagged Bax cDNA in pcDNA3 were described previously (37Lilly M. Sandholm J. Cooper J.J. Koskinen P.J. Kraft A. Oncogene. 1999; 18: 4022-4031Crossref PubMed Scopus (153) Google Scholar). The pRC/CMV-Bak vector was identical to one described previously (38Eguchi H. Suga K. Saji H. Toi M. Nakachi K. Hayashi S.I. Cell Death Differ. 2000; 7: 439-446Crossref PubMed Scopus (31) Google Scholar). Luciferase Activity Assay—Luciferase activities were measured with the dual-luciferase assay kits (Promega, Madison, WI). To examine the effects of ABT-737 on DR5 promoter activity, 6 × 105 cells were cotransfected with 4 μg of pGVB2-DR5 reporter plasmids (a gift of Dr. Toshyuki Sakai) (39Yoshida T. Shiraishi T. Nakata S. Horinaka M. Wakada M. Mizutani Y. Miki T. Sakai T. Cancer Res. 2005; 65: 5662-5667Crossref PubMed Scopus (150) Google Scholar) and as an internal control 0.01 μg of pEF-Renilla-luc using Lipofectamine 2000 reagent. Twenty hours later, cells were treated with ABT-737. Luciferase activities were determined by normalization of firefly luciferase to Renilla luciferase activity. The reporter constructs containing a 552-bp 5′-flanking region of the DR5 gene with a wild-type or mutated CHOP-binding site, NF-κB-binding site, or Elk-binding site were generously provided by Dr. H. G. Wang (University of South Florida College of Medicine, Tampa, FL) (40Yamaguchi H. Wang H.G. J. Biol. Chem. 2004; 279: 45495-45502Abstract Full Text Full Text PDF PubMed Scopus (643) Google Scholar). The pNF-κB-luc (4 μg) plasmids and control vector plasmid were a gift of Drs. Kurtz and Nieminen (Medical University of South Carolina, Charleston, SC). Quantitative Real Time-PCR—For quantitative real time-PCR, total RNA isolated from the cells using RNeasy kit (Qiagen, Valencia, CA) was reverse-transcribed using oligo(dT) and Superscript II RT (Invitrogen), and the resulting cDNA was used for PCR amplification using gene-specific primer pairs. PCR conditions for these reactions were as follows: 95 °C, 10 s; 58 °C, 30 s; 72 °C 10 s for 40 cycles. A Bio-Rad iQ5 multicolor PCR detection system and iQ5 optical system software analysis were used for quantifying gene expression (Bio-Rad, version 2.0). The expression level of DR5 was normalized to GAPDH. The primers used for real time PCR were as follows: DR5 forward ATCACCCAACAAGACCTAGC and reverse TTCTGAGATATGGTGTCCAGG; GAPDH forward CAGCCTCAAGATCATCAGCA and reverse GTCTTCTGGGTGGCAGTGAT. Synergy of TRAIL and ABT-737 to Induce Apoptosis—Adding TRAIL or ABT-737 alone to PV10 and KRC/Y renal cancer cells failed to induce cell death, but combinations of ABT-737 and TRAIL resulted in rapid apoptotic death beginning within 3 h (Fig. 1, A and B). A dose-response analysis showed increasing ABT-737-sensitized TRAIL-resistant renal carcinoma PV10 and KRC/Y cells to TRAIL (Fig. 1A). The cell death was easily visualized by phase-contrast microscopy (Fig. 1B). The dose-dependent induction of cleavage of caspase-8, -9, and -3 and PARP in both renal cancer cell lines PV10 and KRC/Y (Fig. 1, C and D) demonstrates that cell death was driven by both the intrinsic and extrinsic apoptotic pathways. The synergistic ability to induce cell death is not limited to these two renal cancer cell lines but is found in multiple kidney cancer cell lines, A498, ACHN, and prostate cancer cell lines PC3R and LNCaP (Fig. 2A) and is correlated with cleavage of caspase-8, -9, -3, and Bid (Fig. 2B). The slight differences in the extent of caspase cleavage between Fig. 1 and Fig. 2B are a result of the 3-versus 24-h incubation with TRAIL and ABT-737, as well as the increased overexposure of Fig. 2A to demonstrate all caspase cleavage products. The differences caused by different lengths of incubation are highlighted for a single cell line, A498 cells, in supplemental Fig. S1A and S1B. This loss of cell viability occurs with an increase in apoptosis in 12 different renal, prostate, and lung cancer cell lines (Fig. 2C). A number of cell lines were found to be resistant to combination treatment, including DU145 prostate cancer cells, 786-O renal cancer cells, human embryonic kidney 293 (HEK293) cells, and normal renal epithelial cell line HK-2 cells. All of the cell lines that were sensitive to the combination treatment demonstrated increased cleavage of caspase-8, Bid, caspase-9, and caspase-3, whereas resistant cell lines, including HK-2 and HEK293, did not demonstrate these changes.FIGURE 2ABT-737 enhances TRAIL-induced apoptosis in renal, prostate, and lung cancer cells but not in normal kidney cells. A, renal cancer (A498, ACHN, and 786-0), prostate cancer (PC3R and LNCaP), and human embryonic kidney cells 293 (HEK293) were treated with DMSO, 100 ng/ml TRAIL, 10 μm ABT-737, or a combination of the two agents for 24 h. Cell viability was determined by an acid phosphatase assay (mean ± S.D., n = 4). B, cleavage of caspase (Casp)-8, -9, and -3 and Bid was examined on the Western blots. Arrows denote procaspase-8 (p55 and p53), first cleavage fragments (p47 and p43), and the active p18 form of caspase-8; procaspase-9 (p47) processed to produce the active p37 and p35 forms; procaspase-3 (p32) processed to produce active p21 and p17 products; and full-length Bid (p22) and p15 truncated Bid. C, percentages of cell death in response to ABT-737, TRAIL, and ABT-737 plus TRAILs were assessed by the trypan blue exclusion assay. Each cell line was treated with either DMSO, 100 ng/ml TRAIL, 10 μm ABT-737, or the combination for 24 h (mean ± S.D., n = 4).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Regulation of Tumor Cell Sensitivity to Combined or Single Agent Treatment—To explore to the reason for differences in drug sensitivity between these cell lines, we examined the expression of components of the apoptotic cascade by Western blotting, including DISC proteins and Bcl-2 family members (Fig. 3A). Both the renal cancer cell line 786-O and the normal renal epithelial cells HK-2 display significantly lower levels of the TRAIL receptor DR5 expression than other cell lines. Because the other TRAIL receptor DR4 is not expressed in these cell lines or the majority of cell lines examined, an inability to bind TRAIL to the DR5 receptor could make these cells resistant to the combination therapy. Western blot analysis demonstrated that DU145 and a subset of colon cancer HCT116 cells (Fig. 3A), which did not contain Bax protein, were resistant to combination therapy. In comparison, the parental HCT116 cells that contained Bax were sensitive to the combination therapy (supplemental Fig. S2A and S2B). Bax has been shown to be essential for TRAIL killing (41LeBlanc H. Lawrence D. Varfolomeev E. Totpal K. Morlan J. Schow P. Fong S. Schwall R. Sinicropi D. Ashkenazi A. Nat. Med. 2002; 8: 274-281Crossref PubMed Scopus (484) Google Scholar, 42Deng Y. Lin Y. Wu X. Genes Dev. 2002; 16: 33-45Crossref PubMed Scopus (432) Google Scholar), and the addition of ABT-737 does not overcome this blockade. ABT-737 occupies a hydrophobic pocket at one end of the BH3 binding groove that interferes with Bcl-2 family protein-protein interactions (25Oltersdorf T. Elmore S.W. Shoemaker A.R. Armstrong R.C. Augeri D.J. Belli B.A. Bruncko M. Deckwerth T.L. Dinges J. Hajduk P.J. Joseph M.K. K

Referência(s)