Portal de Periódicos da CAPES

Characterization of Transcriptional Regulatory Elements in the Promoter Region of the Murine Blood Coagulation Factor VII Gene

1998; Elsevier BV; Volume: 273; Issue: 4 Linguagem: Inglês

10.1074/jbc.273.4.2277

1083-351X

Daniel Stauffer, Beatrice Chukwumezie, Julie Wilberding, Elliot D. Rosen, Francis Castellino,

Blood Coagulation and Thrombosis Mechanisms

To identify the 5′ sequences of the murine coagulation factor VII (fVII) gene that resulted in its efficient transcription, a variety of 5′-flanking sequences up to 7 kilobase pairs upstream of the translation ATG initiation codon were fused to the reporter gene, bacterial chloramphenicol acetyltransferase, and relative expression levels of this gene in mouse Hepa 1–6 cells were determined. It was found that the 5′ region extending approximately 85 base pairs (bp) upstream of the transcriptional initiation site served as the minimal DNA region that provided full relative promoter activity for chloramphenicol acetyltransferase expression. This region of the gene also contains consensus sequences for liver-enriched transcription factors, C/EBPβ and HNF4, as well as for the ubiquitous protein factors, AP1, H4TF1, NF1, and Sp1. In vitro DNase I footprinting of the 200-bp proximal region of the promoter with a murine Hepa 1–6 cell nuclear extract revealed a clear footprint of a region corresponding to −80 to −28 bp of the murine fVII gene, suggesting that liver factors interact with this region of the DNA. Competitive gel shift and supershift assays with different synthetic oligonucleotide probes demonstrate that proteins contained in the nuclear extract, identified as C/EBPβ, H4TF1, and HNF4, bind to a region of the murine fVII DNA from 85 to 32 bp upstream of the transcription start site. Purified Sp1 also interacts with this region of the DNA at a site that substantially overlaps, but is not identical to, the H4TF1 binding locus. Binding of Sp1 to the mouse DNA was not observed with the nuclear extract as the source of the transcription factors, suggesting that Sp1 is likely displaced from its binding site by H4TF1 in the crude extract. In vivo dimethyl sulfate footprint analysis confirmed the existence of these sites and additionally revealed two other binding regions slightly upstream of the CCAAT/enhancer-binding protein (C/EBP) binding locus that are homologous to NF1 binding sequences. The data demonstrate that appropriate transcription factor binding sites exist in the proximal promoter region of the murine fVII gene that are consistent with its strong liver-based expression in a highly regulated manner. To identify the 5′ sequences of the murine coagulation factor VII (fVII) gene that resulted in its efficient transcription, a variety of 5′-flanking sequences up to 7 kilobase pairs upstream of the translation ATG initiation codon were fused to the reporter gene, bacterial chloramphenicol acetyltransferase, and relative expression levels of this gene in mouse Hepa 1–6 cells were determined. It was found that the 5′ region extending approximately 85 base pairs (bp) upstream of the transcriptional initiation site served as the minimal DNA region that provided full relative promoter activity for chloramphenicol acetyltransferase expression. This region of the gene also contains consensus sequences for liver-enriched transcription factors, C/EBPβ and HNF4, as well as for the ubiquitous protein factors, AP1, H4TF1, NF1, and Sp1. In vitro DNase I footprinting of the 200-bp proximal region of the promoter with a murine Hepa 1–6 cell nuclear extract revealed a clear footprint of a region corresponding to −80 to −28 bp of the murine fVII gene, suggesting that liver factors interact with this region of the DNA. Competitive gel shift and supershift assays with different synthetic oligonucleotide probes demonstrate that proteins contained in the nuclear extract, identified as C/EBPβ, H4TF1, and HNF4, bind to a region of the murine fVII DNA from 85 to 32 bp upstream of the transcription start site. Purified Sp1 also interacts with this region of the DNA at a site that substantially overlaps, but is not identical to, the H4TF1 binding locus. Binding of Sp1 to the mouse DNA was not observed with the nuclear extract as the source of the transcription factors, suggesting that Sp1 is likely displaced from its binding site by H4TF1 in the crude extract. In vivo dimethyl sulfate footprint analysis confirmed the existence of these sites and additionally revealed two other binding regions slightly upstream of the CCAAT/enhancer-binding protein (C/EBP) binding locus that are homologous to NF1 binding sequences. The data demonstrate that appropriate transcription factor binding sites exist in the proximal promoter region of the murine fVII gene that are consistent with its strong liver-based expression in a highly regulated manner. Factor VII (fVII) 1The abbreviations used are: fVII, fIX, and fX, coagulation factors VII, IX, and X, respectively; fVIIa, fIXa, and fXa, activated coagulation factors VII, IX, and X, respectively; PC, anticoagulant protein C; TF, tissue factor; Gla, γ-carboxyglutamic acid; C/EBPα, CCAAT/enhancer-binding protein-α; C/EBPβ, CCAAT/enhancer-binding protein-β; HNF1/2/3/4, hepatocyte nuclear factors 1/2/3/4, respectively; H4TF1, histone H4 gene transcription factor-1; NF1, nuclear factor 1; Sp1, stimulating protein 1; CAT, chloramphenicol acetyltransferase; DMS, dimethyl sulfate; β-gal, β-galactosidase; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; LMPCR, ligand-mediated polymerase chain reaction; fpu, footprint unit(s); bp, base pair(s); kb, kilobase(s); PBS, phosphate-buffered saline; IL, interleukin. is a vitamin K-dependent plasma protein that serves as the precursor for fVIIa, a serine protease that functions as a procoagulant in the extrinsic blood coagulation pathway. This latter activity is derived in part from the ability of fVIIa to activate the coagulation zymogens, fIX and fX to their respective enzymes, fIXa and fXa (1Komiyama Y. Pedersen A.H. Kisiel W. Biochemistry. 1990; 29: 9418-9425Crossref PubMed Scopus (152) Google Scholar, 2Bom V.J.J. van Hinsberg V.W.M. Reinalda-Poot H.H. Mohanlal R.W. Bertina R.M. Thromb. Haemostasis. 1991; 66: 283-291Crossref PubMed Scopus (23) Google Scholar). The presence of a cofactor for fVII, TF, along with Ca2+, creates optimal conditions for the functioning of fVIIa. Tissue factor pathway inhibitor serves to down-regulate this coagulation pathway by inactivating both fXa and the fVIIa·TF complex (3Broze G.J.J. Miletich J.P. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 1886-1890Crossref PubMed Scopus (83) Google Scholar). Human fVII is synthesized in liver as a single-chain protein containing 406 amino acids. Activation of this zymogen occurs consequent to cleavage of the Arg152-Ile153 peptide bond. This step is catalyzed by fXa (4Radcliffe R. Nemerson Y. J. Biol. Chem. 1975; 250: 388-395Abstract Full Text PDF PubMed Google Scholar), thrombin (4Radcliffe R. Nemerson Y. J. Biol. Chem. 1975; 250: 388-395Abstract Full Text PDF PubMed Google Scholar), TF·fVIIa (5Nakagaki T. Foster D.C. Berkner K.L. Kisiel W. Biochemistry. 1991; 30: 10819-10824Crossref PubMed Scopus (126) Google Scholar), or hepsin (6Kazama Y. Hamamoto T. Foster D.C. Kisiel W. J. Biol. Chem. 1995; 270: 66-72Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar), and leads to an enzyme composed of a 152-amino acid light chain, disulfide-linked to a 254-residue heavy chain. Factor VII is organized as a series of domain units (7O'Hara P.J. Grant F.J. Haldeman B.A. Gray C.L. Insley M.Y. Hagen F.S. Murray M.J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5158-5162Crossref PubMed Scopus (268) Google Scholar) that are common to fIX (8Yoshitake S. Schach B.G. Foster D.C. Davie E.W. Kurachi K. Biochemistry. 1985; 24: 3736-3750Crossref PubMed Scopus (511) Google Scholar), fX (9Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar), and protein C (10Foster D.C. Yoshitake S. Davie E.W. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4673-4677Crossref PubMed Scopus (297) Google Scholar). Specifically, the light chain of fVIIa consists of a Gla-containing domain, followed by a short helical spacer region and two epidermal growth factor-like motifs. The functions of these modules are to provide binding sites for regulators of fVII activity, such as TF (11Toomey J.R. Smith K.J. Stafford D.W. J. Biol. Chem. 1991; 266: 19198-19202Abstract Full Text PDF PubMed Google Scholar, 12Ruf W. Kalnik M.W. Lund-Hansen T. Edgington T.S. J. Biol. Chem. 1991; 266: 15719-15725Abstract Full Text PDF PubMed Google Scholar). The heavy chain of fVIIa contains the serine protease catalytic machinery, as well as binding sites for TF (13Matsushita T. Kojima T. Emi N. Takahashi I. Saito H. J. Biol. Chem. 1994; 269: 7355-7363Abstract Full Text PDF PubMed Google Scholar, 14Banner D.W. D'Arcy A. Chene C. Winkler F.K. Guha A. Konigsberg W.H. Nemerson Y. Kirchofer D. Nature. 1996; 380: 41-46Crossref PubMed Scopus (686) Google Scholar, 15Bhardwaj D. Iino M. Kontoyianni M. Smith K.J. Foster D.C. Kisiel W. J. Biol. Chem. 1996; 271: 30685-30691Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The intron-exon organization of the human fVII gene (7O'Hara P.J. Grant F.J. Haldeman B.A. Gray C.L. Insley M.Y. Hagen F.S. Murray M.J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5158-5162Crossref PubMed Scopus (268) Google Scholar) and the entire genomic sequence of murine fVII (16Idusogie E. Rosen E.D. Carmeliet P. Collen D. Castellino F.J. Thromb. Haemostasis. 1996; 76: 957-964Crossref PubMed Google Scholar) have been established. Both of these genes contain approximately 12 kb, and include transcriptional and translation start sites, 5′-flanking transcriptional regulatory regions, and 3′-capping polyadenylation sites and polyadenylation enhancer elements. The positions of the introns in these genes are in identical locations, and splice the exonic regions that encode the protein domains. The human fVII DNA is organized in eight exons, with an optional exon in the leader peptide region. The murine fVII gene possesses seven introns and eight exons. The major transcriptional start site of murine fVII has been located nine nucleotides upstream of the ATG translation initiation site (16Idusogie E. Rosen E.D. Carmeliet P. Collen D. Castellino F.J. Thromb. Haemostasis. 1996; 76: 957-964Crossref PubMed Google Scholar). This short transcriptional initiator site in murine fVII presents a similar situation to that of the human gene, where in this latter case the major transcriptional start site was located 51 nucleotides 5′ of the translational initiation site (17Pollak E.S. Hung H.-L. Godin W. Overton G.C. High K.A. J. Biol. Chem. 1996; 271: 1738-1747Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). Although genetic deficiencies of human fVII have been reported, few patients present total fVII deficiency states. However, very low levels of this zymogen ( 3,000 Ci/mm; ICN, Costa Mesa, CA), using the Klenow fragment of DNA polymerase (Promega). The binding reactions were carried out in a total volume of 25 μl containing 50,000 cpm of the labeled probe, 1 μg of poly (dI-dC) (Pharmacia Biotech Inc.), 12 μg of nuclear extract, 1 mmEDTA, 5 mm MgCl2, 10 μmZnCl2, 1 mm β-mercaptoethanol, 4% (v/v) glycerol, 100 mm KCl, in 10 mm Tris-HCl, pH 7.5. The reaction mixtures were incubated for 30 min at room temperature and loaded onto a 6% polyacrylamide gel (acrylamide:bisacrylamide ratio, 19:1, w/w) in running buffer (50 mm Tris-HCl, 0.38 m glycine, 2 mmEDTA, pH 8.0). The samples were subjected to electrophoresis at 8 V/cm. The resulting gels were dried and exposed to the x-ray film with an intensifying screen overnight at −80 °C. In competition experiments, oligonucleotide competitors were added in the amounts indicated in the figure legends. Reactions containing recombinant C/EBPα (30 μg/ml) or C/EBPβ (26 μg/ml) contained 2.0 μl of the protein and 1.0 μl of normal rabbit serum/25 μl of binding reaction. Reaction mixtures with Sp1 included 1.0 footprint unit (fpu) of purified Sp1 (1 fpu is defined as the amount of Sp1 needed to give full protection against DNase 1 digestion on the SV40 early promoter). Sp1-containing mobility shift assays were performed on 6% polyacrylamide gels in 0.5 × Tris borate/EDTA (44.5 mm Tris-HCl, pH 8.0, 44.5 mm boric acid, 1 mm EDTA). In supershift experiments, the antibodies were added 15 min after the initiation of the 30-min incubation period of the probe with the nuclear extract mixture. The sequences of double-stranded oligonucleotides used in the assays are as follows (the consensus sequences are indicated in bold lettering, the lowercase letters represent overhangs, the mutant sequences are indicated with an “m,” and the mutated bases are underlined): M7H4 (−44 to −66, mouse fVII promoter): gatcACCCCTCTCCCCTCCCCCCTGA; mM7H4: gatcACCTCTCTCTCCTCTCCTCTGA; HSp1 (−83 to −108, human fVII promoter): GTGTCCTCCCCTCCCCCATCCCTCT; mHSp1: GTGTCCTCCCCTCCACCATCCCTCT; M7HNF4: (−33 to −50, mouse fVII promoter): tcgaGGAGGGCAAAGGTCAGGG; HNF4 consensus (32Sladek F.M. Zhong W.M. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar): CTGGGCAAAGGTCATCTG; mHNF4 site: CTGGATAAACGTCATCTG; M7C/H: (−47 to −78, mouse fVII promoter): tcgaCCAGCTTTCTCCACCCCTCTCCCCTCCCCCCT; M7mC/H: tcgaCCAGCACTATCCACCCCTCTCCCCTCCCCCCT; Sp1 consensus, gatcGCTCGCCCCGCCCCGATCGAAT; H4TF1 consensus (33Dailey L. Hanly S.M. Roeder R.G. Heintz N. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 7241-7245Crossref PubMed Scopus (61) Google Scholar): CCCGGTGGGGGAGGGGAA. The wild-type and mutant Sp1 site oligonucleotides from the human fVII promoter (17Pollak E.S. Hung H.-L. Godin W. Overton G.C. High K.A. J. Biol. Chem. 1996; 271: 1738-1747Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar) were gifts from Dr. Eleanor Pollak (University of Pennsylvania, Philadelphia, PA). The DNase I footprint analysis was carried essentially as described (34Galas D.J. Schmitz A. Nucleic Acids Res. 1978; 5: 3157-3170Crossref PubMed Scopus (1334) Google Scholar). A quantity of 20 pmol of pCAT-200, containing 200 bp of the murine fVII promoter (−200 bp to −1 bp), was linearized with either restriction endonucleasesHindIII or XbaI, end-labeled as described above with [α-32P]dATP and [α-32P]dCTP (>3,000 Ci/mmol; ICN), and digested with the second enzyme to release the oligonucleotide insert. The 32P-labeled DNA was fractionated electrophoretically on a 5% polyacrylamide gel in TBE buffer (89 mm Tris-HCl, 89 mm boric acid, 2 mm EDTA, pH 8.0). The 32P-labeled DNA insert was electroeluted from an excised gel slice, extracted with phenol/CHCl3 (1:1, v/v) followed by CHCl3/isoamyl alcohol (24:1, v/v), and precipitated by addition of 1 ml of 100% ethanol. The pellet was washed with 1 ml of 80% ethanol, dried, and resuspended in 50 μl of a solution of 10 mm Tris-HCl, 1 mm EDTA, pH 8.0. An amount of 20,000 cpm of probe was incubated for 15 min on ice with 50 μg of nuclear extract protein in 50 μl of a solution containing 50 mm KCl, 10% (v/v) glycerol, 1.0 mmdithiothreitol, 2.5 mm MgCl2, 0.02% Nonidet P-40 (Sigma), 2.0% polyvinyl alcohol, 1 μg of poly(dI-dC), in 10 mm sodium Hepes, pH 7.6. A volume of 50 μl of 5 mm CaCl2, 10 mm MgCl2was included in the reaction mixture and incubated for 1 min at room temperature. This was followed by the addition of 2 μl of a 0.016 mg/ml (or 0.0025 mg/ml for the control without nuclear extract) stock solution of DNase I (Worthington). The mixture was incubated for 1 min and followed by addition of 90 μl of DNase I stop buffer (1%, w/v, sodium dodecyl sulfate, 0.2 m NaCl, 250 μg/ml glycogen, 20 mm EDTA, pH 8.0). The samples were then digested with 10 μl of 2.5 mg/ml proteinase K for 5 min at room temperature. The solution was extracted with phenol/chloroform (1:1, v/v) and precipitated by addition of 1 ml of 100% ethanol. The samples were the resuspended in formamide loading buffer (80% formamide, 1 mm EDTA, 0.1% xylene cyanol, 0.1% bromphenol blue) at 1,500 cpm/μl, and a total of 5,000 cpm was loaded on a 6% polyacrylamide sequencing gel. The corresponding murine fVII sequence generated by the Maxam and Gilbert method (35Maxam A.M. Gilbert W. Methods Enzymol. 1980; 65: 499-560Crossref PubMed Scopus (9013) Google Scholar) was placed in a lane alongside the reactions. Methylation interference was conducted as described previously (34Galas D.J. Schmitz A. Nucleic Acids Res. 1978; 5: 3157-3170Crossref PubMed Scopus (1334) Google Scholar). A 30-bp fragment extending from bp −45 to bp −66 of the mouse fVII promoter was subcloned into the SmaI site of the pBSKII+ vector (Stratagene). The resulting plasmid was linearized with either EcoRI orBamHI. A quantity of 20 pmol of plasmid was end-labeled with [α-32P]dATP and [α-32P]dCTP (>3,000 Ci/mmol), as described above. The labeled plasmid was then digested with the second enzyme to release the oligonucleotide insert. Labeled DNA was purified by polyacrylamide gel electrophoresis. An amount of 1 × 107 cpm of labeled probe was mixed with 0.5 μl of DMS in 200 μl of DMS reaction buffer (50 mm sodium cacodylate, 1 mm EDTA, pH 8.0) for 2.5 min at room temperature. This was followed immediately by the addition of 40 μl of DMS stop buffer (1.5 m NaOAc, 1 mβ-mercaptoethanol, pH 7.0), 1 μl of 10 mg/ml yeast tRNA solution, and 600 μl of 100% ethanol. This solution was mixed and placed for 10 min in a dry ice/ethanol bath and microcentrifuged for 15 min at 4 °C. The supernatant was discarded. This step was repeated three times, and the final pellet obtained was dried and resuspended in a buffer containing 10 mm Tris-HCl, 1 mm EDTA, pH 8.0, at 100,000 cpm/μl. Five standard gel shift reactions using either Hepa 1–6 nuclear extract or purified Sp1 were conducted as described above. Following electrophoresis, the gels were exposed to film overnight at room temperature. Gel slices containing the bound and free probe were removed. The probe was then electroeluted from the slices, extracted with phenol/CHCl3 (1:1, v/v), and precipitated with 100% ethanol. The probe was then incubated with 1m piperidine at 95 °C for 30 min, followed by three rounds of lyophilization, and resuspended in formamide loading dye (see previous section) at 1,500 cpm/μl. A total of 5,000 cpm was loaded onto a 12% sequencing gel for electrophoretic analysis at 1500 V for 1.5 h. The gel was exposed to x-ray film overnight at −80 °C with an intensifying screen. For footprinting the bottom (non-coding) strand, the following primers were employed: 1, 5′-ATATGGACATCCATCGGTGG; 2, 5′-TGTTCACACCTCCGGTCTGA; 3, 5′-CGGTCTGAGCCCACATTGCC. The primers used to footprint the top (coding) strand were: 4, 5′-TTCCTGTTGATGTCCCAGCT; 5, 5′-ACTCCGTGCACAGAGAAACC; 6, 5′-CCCTGGAGCTGGAGCAGAAA. For the unidirectional linker mix, the following oligonucleotides were used: 7, 5′-GCGGTGACCCGGGAGATCTGAATTC; 8, 5′-GAATTCAGATC. Primers 3 and 6 were then end-labeled with polynucleotide kinase (Amersham Life Science) in the following manner. A concentration of 20 pmol of primer was combined with 2 μl of 10 × kinase buffer, 120 μCi of [γ-32P]ATP (ICN, Costa Mesa, CA; 4500 Ci/mmol), and water to a final volume of 20 μl. A 1:10 dilution of polynucleotide kinase (30 units/ml) was prepared with kinase buffer, and 1 μl of this solution was added to the reaction tube. The reaction was incubated at 37 °C for 30 min, after which a second 1-μl aliquot of enzyme was added and incubation