Molecular Cloning, Expression, and Characterization of Novel Hemolytic Lectins from the Mushroom Laetiporus sulphureus, Which Show Homology to Bacterial Toxins
2003; Elsevier BV; Volume: 278; Issue: 42 Linguagem: Inglês
10.1074/jbc.m306836200
ISSN1083-351X
AutoresHiroaki Tateno, Irwin Goldstein,
Tópico(s)Biochemical and Structural Characterization
ResumoWe describe herein the cDNA cloning, expression, and characterization of a hemolytic lectin and its related species from the parasitic mushroom Laetiporus sulphureus. The lectin designated LSL (L. sulphureus lectin), is a tetramer composed of subunits of ∼35 kDa associated by non-covalent bonds. From a cDNA library, three similar full-length cDNAs, termed LSLa, LSLb, and LSLc, were generated, each of which had an open reading frame of 945 bp encoding 315 amino acid residues. These proteins share 80–90% sequence identity and showed structural similarity to bacterial toxins: mosquitocidal toxin (MTX2) from Bacillus sphaericus and α toxin from Clostridium septicum. Native and recombinant forms of LSL showed hemagglutination and hemolytic activity and both activities were inhibited by N-acetyllactosamine, whereas a C-terminal deletion mutant of LSLa (LSLa-D1) retained hemagglutination, but not hemolytic activity, indicating the N-terminal domain is a carbohydrate recognition domain and the C-terminal domain functions as an oligomerization domain. The LSL-mediated hemolysis was protected osmotically by polyethylene glycol 4000 and maltohexaose. Inhibition studies showed that lacto-N-neotetraose (Galβ1–4GlcNAcβ1–3Galβ1–4Glc) was the best inhibitor for LSL. These results indicate that LSL is a novel pore-forming lectin homologous to bacterial toxins. We describe herein the cDNA cloning, expression, and characterization of a hemolytic lectin and its related species from the parasitic mushroom Laetiporus sulphureus. The lectin designated LSL (L. sulphureus lectin), is a tetramer composed of subunits of ∼35 kDa associated by non-covalent bonds. From a cDNA library, three similar full-length cDNAs, termed LSLa, LSLb, and LSLc, were generated, each of which had an open reading frame of 945 bp encoding 315 amino acid residues. These proteins share 80–90% sequence identity and showed structural similarity to bacterial toxins: mosquitocidal toxin (MTX2) from Bacillus sphaericus and α toxin from Clostridium septicum. Native and recombinant forms of LSL showed hemagglutination and hemolytic activity and both activities were inhibited by N-acetyllactosamine, whereas a C-terminal deletion mutant of LSLa (LSLa-D1) retained hemagglutination, but not hemolytic activity, indicating the N-terminal domain is a carbohydrate recognition domain and the C-terminal domain functions as an oligomerization domain. The LSL-mediated hemolysis was protected osmotically by polyethylene glycol 4000 and maltohexaose. Inhibition studies showed that lacto-N-neotetraose (Galβ1–4GlcNAcβ1–3Galβ1–4Glc) was the best inhibitor for LSL. These results indicate that LSL is a novel pore-forming lectin homologous to bacterial toxins. By definition, a lectin is a sugar-binding protein or glycoprotein of non-immune origin, which agglutinates cells and/or precipitates glycoconjugates (1Goldstein I.J. Hughes R.C. Monsigny M. Osawa T. Sharon N. Nature. 1980; 285: 66Crossref Scopus (650) Google Scholar). It has been known that some lectins lyse as well as agglutinate cells. These proteins are called hemolytic lectins or toxic lectins. Several of these lectins have been isolated and characterized. One of these representatives is a type 2 ribosome-inactivating protein family (type II RIP) from higher plants, classified on the basis of structural and evolutionary development (2Van Damme E.J.M. Peumans W.J. Barre A. Rouge P. Crit. Rev. Plant Sci. 1998; 17: 575-692Crossref Scopus (584) Google Scholar). Ricin, a 65-kDa type II RIP from Ricinus communis, is the prototype of this lectin family (3Olsnes S. Kozlov J.V. Toxicon. 2001; 39: 1723-1728Crossref PubMed Scopus (160) Google Scholar); it consists of two disulfide-linked polypeptides, A-chain and B-chain. The A-chain enters the cytosol and inactivates the ribosomes enzymatically, whereas the B-chain, which is composed of two tandemly repeated (QXW)3 domains, has lectin-like properties and binds to β-linked galactose at the cell surface. This binding is a prerequisite for translocation of the A-chain into the cytosol. The properties of a hemolytic lectin from marine invertebrate Cucumaria echinata (CEL-III) have also been well characterized (4Hatakeyama T. Nagatomo H. Yamasaki N. J. Biol. Chem. 1995; 270: 3560-3564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 5Hatakeyama T. Furukawa M. Nagatomo H. Yamasaki N. Mori T. J. Biol. Chem. 1996; 271: 16915-16920Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). CEL-III, a 47-kDa polypeptide, is also composed of two tandemly repeated (QXW)3 domains similar to ricin B-chain and a putative oligomerization domain. CEL-III is a pore-forming protein, which binds to carbohydrates on the cell membrane, forms oligomers, and creates ion-permeable pores. The isolation and partial characterization of an N-acetyllactosamine-specific hemolytic lectin from the mushroom Laetiporus sulfureus were first reported by Konska et al. (6Konska G. Guillot J. Dusser M. Damez M. Botton B. J. Biochem. (Tokyo). 1994; 116: 519-523Crossref PubMed Scopus (50) Google Scholar). The hemolytic lectin was isolated by affinity chromatography on Sepharose and was stated to be a heterotetrameric protein of 190 kDa, with subunits of 36 and 60 kDa. In this paper, we have undertaken the detailed sugar binding specificity, cDNA cloning, expression, and characterization of this unique hemolytic lectin and closely related lectins from L. sulfureus. Binding studies by the techniques of hemagglutination, hemolysis inhibition, and quantitative precipitation showed that the lectin possesses an extended binding site, which recognizes Galβ1–4GlcNAcβ1–3Galβ1–4Glc (lacto-N-neotetraose). cDNA sequencing revealed that the L. sulfureus lectins contain a (QXW)3-like motif at their N-termini and show sequence homology to bacterial toxins. The three lectin genes and a deletion mutant were expressed in Escherichia coli and their physicochemical characterization is investigated to shed light on the mechanism of hemolysis mediated by their novel-type of structures. Lacto-N-neotetraose, lacto-N-tetraose, lacto-N-neohexaose, and lacto-N-hexaose were purchased from V-LABS (Covington, LA). Unless stated otherwise, saccharides, their derivatives, and glycoproteins (including fetuin, asialofetuin, transferrin, thyroglobulin, α1-acid glycoproteins, bovine submaxillary mucin, etc.) were purchased from Sigma. Except for asialofetuin, asialoglycoproteins were prepared by heating the corresponding native glycoproteins in 0.1 m hydrochloric acid at 80 °C for 1 h, followed by dialysis and lyophilization; the removal of sialic acid was confirmed by the thiobarbituric assay (7Warren L. J. Biol. Chem. 1959; 234: 1971-1975Abstract Full Text PDF PubMed Google Scholar). Purification of the Lectin—L. sulfureus mushrooms were harvested in October 2002 in Ann Arbor, MI. Fresh mushrooms were cleaned of debris and chopped into small pieces. The chopped tissue (40 g) was homogenized in a Waring Blendor at 4 °C in 200 ml of PBS 1The abbreviations used are: PBS, phosphate-buffered saline; PBSE, phosphate-buffered saline containing EDTA; LSL, L. sulphureus lectin; nLSL, native LSL; nLSL-p1, nLSL purified with PBS as an extraction buffer; nLSL-p2, native L. sulphureus lectin purified with PBSE containing protease inhibitor mixture as an extraction buffer; rLSL, recombinant LSL; RACE, rapid amplification of cDNA ends; Me, methyl. (10 mm sodium phosphate, 0.15 m NaCl, 0.04% sodium azide, pH 7.2) or PBSE (PBS containing 1 mm EDTA) containing 1 ml/liter protein inhibitor mixture (product P8215; Sigma). The homogenate was stirred for 3 h at 4 °C, squeezed through four layers of cheesecloth, and centrifuged at 12,000 × g for 15 min. The supernatant solution, filtered through glass wool to remove a small amount of floating debris was applied onto an affinity column (2.5 × 15 cm) of Sepharose 4B, which had been equilibrated in PBSE. The column was washed with PBSE until the absorbance of the effluent at 280 nm decreased to a minimum value. The affinity adsorbed lectin was eluted with 0.1 m lactose in PBSE and dialyzed against PBSE. Approximately 2 mg of purified lectin were obtained from 40 g of fresh mushroom. Protein and Carbohydrate Estimations—Protein was determined by a method of Lowry et al. (8Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar) using bovine serum albumin as a standard. Total neutral sugars were determined by the phenol/sulfuric acid method (9DuBois M. Gilles K.A. Hamilton J.K. Rebers P.A. Smith F. Anal. Chem. 1956; 28: 350-356Crossref Scopus (41197) Google Scholar). SDS-PAGE—SDS-PAGE was carried out on 0.75-mm slab gels in an alkaline buffer system (Tris glycine, pH 8.3) (10Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar), using a mini-Protean II apparatus (Bio-Rad). BenchMark prestained protein molecular mass standards used in SDS-PAGE were from Invitrogen. Subunit Structure—The subunit structure of purified lectins was determined by gel filtration through a G2000-SWXL Progel-TSK column (30 × 0.78 cm; Supelco, Bellefonte, PA) using a Beckman System Gold high-performance liquid chromatography system as described previously (11Winter H.C. Mostafapour K. Goldstein I.J. J. Biol. Chem. 2002; 277: 14996-15001Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar) and by SDS-PAGE performed on samples with and without heating for 5 min in boiling water, and in the presence or absence of 2-mercaptoethanol. Hemolytic Assay and Hapten Inhibition Assay—Hemolytic activity of the lectins was determined by absorbance at 540 nm because of hemoglobin release. A lectin solution (50 μl) and PBSE (50 μl) as a control were mixed with 50 μl of a 5% suspension of human type A erythrocytes, and incubated for 30 min at room temperature. After centrifugation at 1,500 × g for 5 min, the absorbance of the supernatant solution was measured at 540 nm against a control. Hapten inhibition was assayed in the same system. Increasing amounts of saccharides in 25 μl were incubated with 25 μl of purified lectin (1 μg) for 30 min at room temperature followed by addition of 50 μl of 5% cell suspension after 30 min. After incubation at 37 °C for 30 min followed by centrifugation to remove membranes and intact cells, the absorbance of the supernatant solution was recorded at 540 nm. Hemagglutination Assay and Hapten Inhibition Assay—The hemagglutinating activity of the lectin was determined by a 2-fold serial dilution procedure using formaldehyde-treated (12Novak T.P. Barondes S.H. Biochim. Biophys. Acta. 1975; 393: 115-123Crossref PubMed Scopus (71) Google Scholar) human and rabbit erythrocytes as described previously (13Mo H. Winter H.C. Goldstein I.J. J. Biol. Chem. 2000; 275: 10623-10629Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The sample (10 μl) (2-fold serial dilutions in PBSE) was combined with 10 μl of a 2% cell suspension in v-shaped microtiter plates (96-well) and hemagglutination was observed after incubation for 30 min at room temperature. The titer was defined as the reciprocal value of the end point dilution causing hemagglutination. For hapten inhibition of hemagglutination, 10 μl of the serially diluted saccharide solutions were incubated with 10 μl of 8 agglutinin units of the lectin in microtiter plates followed by addition after 30 min of an erythrocyte suspension (20 μl). The lowest concentration of saccharide that visibly decreased the extent of agglutination was defined as the minimum inhibitory concentration. Quantitative Precipitation Assay—Assays were performed by a microprecipitation procedure (14Mo H. Winter H.C. Van Damme E.J.M. Peumans W.J. Misaki A. Goldstein I.J. Eur. J. Biochem. 2001; 268: 2609-2615Crossref PubMed Scopus (56) Google Scholar). Varying amounts of glycoproteins or polysaccharides ranging from 0 to 100 μg were added to 20 μg of the purified lectin in a total volume of 120 μl of PBSE. After incubation at 37 °C for 1 h, the reaction mixtures were stored at 4 °C for 48 h. The precipitates formed were washed twice with 500 μl of ice-cold PBS, dissolved in 0.05 m NaOH, and assayed for protein by Lowry's method (8Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar) using bovine serum albumin as standard. Peptide Sequencing and Analysis—Peptide sequences were determined by the Protein Structure Facility at the University of Michigan Core Facilities. Briefly, purified protein was reduced, S-carboxamidomethylated with monoiodoacetamide, and then digested with trypsin. The derived peptides were separated by reversed-phase high-performance liquid chromatography and the amino acid sequences of the isolated peptides were analyzed by a gas-phase protein sequencer. RNA Isolation and cDNA Cloning—Fresh tissue of the mushroom was ground to a powder with a pestle under liquid nitrogen. Total cellular RNA was isolated with Concert Plant RNA reagent (Invitrogen, CA) and subsequently poly(A)+ RNA was isolated with Micro-Fast-Track 2.0 kit (Invitrogen). Using this protocol, 5 μg of poly(A)+ RNA/1 g of mushroom was isolated. Adapter-ligated cDNA library was constructed with the Marathon cDNA amplification kit (Clontech). Two degenerate forward primers (LSLF1, GCNGTNWSNACNGTNGARWSNGGNATHATHAA; LSLF2, GTNGARWSNGGNATHATHAAYGTNCCNTTYAC) were designed from the amino acid sequence AVSTVDSGIINVPFT of a trypsin-digested fragment of the purified lectin for rapid amplification of cDNA ends (RACE). 3′-RACE was conducted with a combination of primers, adapter primer 1 (Invitrogen) and LSLF1, and Platinum Pfx DNA polymerase (Invitrogen) as follows. DNA was denatured at 94 °C for 3 min, followed by three-step cycles (40 cycles); 92 °C for 0.5 min, 55 °C for 0.5 min, and 68 °C for 1 min, and further extended at 68 °C for 5 min. The amplified DNA fragment was subsequently amplified with LSLF2 and adapter primer 2 (Invitrogen). The amplified 1-kilobase pair fragment was cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen). Inserted DNA was sequenced with T7 and SP6 primers by the DNA Sequencing Core facility of the University of Michigan, and three similar but different genes (termed LSLa, LSLb, and LSLc) including poly(A)+ were obtained. A gene-specific reverse primer (LSLR1, ATCATTGACTTTCGACACGCAACATTGATAGAGC) was designed and 5′-RACE was conducted with adapter primer 1 and LSLR1. Finally, a gene-specific forward primer (LSLF3, CCTAACGTACACGTTACGCTCCCATTCACC) was designed and 3′-RACE was conducted with adapter primer 1 and LSLF3 to confirm full-length cDNA sequences. Construction, Expression, and Purification of Recombinant L. sulfureus lectin—The protein coding region of LSL amplified by PCR using synthetic oligonucleotides incorporating NdeI and BamHI, or NdeI and XhoI restriction enzyme sites were used for cloning purposes. The approximately 1-kilobase pair PCR products cloned into expression vector pET-43a (Novagen), yielding pET-LSLa, pET-LSLb, and pET-LSLc. A deletion mutant (LSLa-D1) was generated by PCR using the GeneTailor site-directed mutagenesis system (Invitrogen), pET-LSLa as a template, and mutagenesis primers (LSLaD1F, CATCATCCCAGACCCAGGAGTAGTCATTTAAT; LSLaD1R, CTCCTGGGTCTGGGATGATGTATTCTCGAG) following by the manufacturer's protocol. Underlined nucleotides of LSLaD1F (see above) were altered to introduce a stop codon to generate a deletion mutant of LSLa (Met1-Glu187) and the nucleotide sequence of mutant clones was verified by DNA sequencing. Nova Blue (DE3) strain of E. coli harboring expression vector was pre-cultured in 5 ml of Luria broth (LB) medium containing 50 μg/ml ampicillin at 37 °C for 3 h and was added to 1 liter of medium. After the optical density at 600 nm reached 0.4–0.6, 1 ml of 1 m isopropyl-1-thio-β-d-galactoside was added to the medium, and the cells were further cultured at 25 °C overnight. The induced cells were collected by centrifugation, resuspended in a lysis buffer (10 mm sodium phosphate, 0.15 m NaCl, 1 mm EDTA, 0.04% sodium azide, pH 7.2 (PBS), containing 1% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 1 mm 2-mercaptoethanol, and proteinase inhibitor mixture (Roche Diagnostics)), and sonicated at 0 °C. The insoluble fraction was removed by centrifugation at 10,000 × g for 30 min at 0 °C. Recombinant lectins were purified from the soluble fraction by absorption on a Sepharose 4B column and elution by 0.2 m lactose. Circular Dichroism Spectroscopy—Circular dichroism (CD) spectra were measured on a Jasco J-715 spectropolarimeter (Japan Spectroscopic Co.) using a protein concentration of 0.3 mg/ml in 10 mm phosphate buffer (pH 7.2) and an optical path length of 1 mm. Buffer baselines were measured under the same conditions and subtracted from the corresponding spectrum. The data were transformed to mean residue molar ellipticity and smoothed using the standard analysis program. Secondary structure was calculated based on the method of Yang et al. (15Yang J.T. Wu C.-S. Martinez H.M. Methods Enzymol. 1986; 130: 208-269Crossref PubMed Scopus (1740) Google Scholar). Sequence Data Processing—Multiple sequence alignment was performed by the Clustal W program (16Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (56002) Google Scholar). Homologous sequences were searched for by the FASTA program. Internal repeats were searched for by the SMART program (17Schultz J. Milpetz F. Bork P. Ponting C.P. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5857-5864Crossref PubMed Scopus (3029) Google Scholar, 18Letunic I. Goodstadt L. Dickens N.J. Doerks T. Schultz J. Mott R. Ciccarelli F. Copley R.R. Ponting C.P. Bork P. Nucleic Acids Res. 2002; 30: 242-244Crossref PubMed Scopus (569) Google Scholar). Hydropathy profile analysis was performed on the basis of the primary structure by the procedure of Kyte and Doolittle (19Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17296) Google Scholar). Purification of the Lectin—Initially, lectin was extracted from L. sulfureus with PBS without protease inhibitors followed by the method of Konska et al. (6Konska G. Guillot J. Dusser M. Damez M. Botton B. J. Biochem. (Tokyo). 1994; 116: 519-523Crossref PubMed Scopus (50) Google Scholar). The lectin was adsorbed onto Sepharose 4B and eluted by 0.2 m lactose. SDS-PAGE analysis of the purified lectin (nLSL-p1) revealed the presence of two major bands at 35 and 17 kDa (Fig. 1). The absence of 2-mercaptoethanol in the sample preparation buffer did not change the pattern of bands, indicating the absence of interchain disulfide bonding. A sample prepared without heating showed a major band at approximately 170 kDa and lesser amounts of other bands, suggesting that 35- and 17-kDa subunits are associated into an oligomeric structure that is dissociated by SDS at room temperature (Fig. 1). N-terminal amino acid sequences of the 35- and 17-kDa subunits were identical except for the first two residues (XD) present in the 35-kDa subunit (35-kDa subunit, XDIYIPPEGL; 17-kDa subunit, IYIPPEGLYF), suggesting that the 17-kDa subunit might be a truncated form of the 35-kDa subunit and that the 17-kDa subunit presumably was generated by proteolytic cleavage of the 35-kDa subunit. To prevent any metalloproteinase degradation of the lectin, metal-free buffer containing EDTA and proteinase inhibitor mixture was used throughout subsequent purification. It should be noted that hemagglutination activity of the lectin was unchanged by extensive dialysis of the lectin in metal-free buffer containing EDTA, indicating the absence of a divalent metal ion requirement (data not shown). As shown in Fig. 1, upon SDS-PAGE at pH 8.3 with unheated samples, the purified lectin (nLSL-p2) showed a single band at approximately 170 kDa. When the lectin was boiled in SDS with 2-mercaptoethanol, a single band of 35 kDa was observed, suggesting that the native structure is an oligomer of this monomer. This preparation was used for further investigation. Subunit Structure—The molecular mass was also estimated by size exclusion chromatography on a silica-based matrix. The purified lectin migrated as a single, nearly symmetrical band of approximately 140 kDa, based on standardization with known proteins (data not shown). Together with the SDS-PAGE analysis, these results indicate that the lectin exists as a tetramer of subunits of approximately 35 kDa that requires boiling in SDS to dissociate completely. Hemagglutination and Hemolysis—The hemagglutination and hemolytic activity of nLSL was assayed toward erythrocytes from several mammalian species. The lectin agglutinated formaldehyde-treated rabbit erythrocytes at a minimum concentration of approximately 1 ng/ml, whereas formaldehyde-treated sheep, dog, and human erythrocytes of any blood type required 80 or 160 ng/ml for agglutination (Table I). As shown in Fig. 2A, the lectin hemolyzed rabbit, sheep, and human erythrocytes of any blood type in a dose-dependent manner. The concentrations of the lectin required to induce 50% hemolysis were determined to be 0.9, 14, 17, 14, and 17 μg/ml for rabbit, human A, human B, human O, and sheep erythrocytes, respectively. In contrast, dog erythrocytes were only slightly hemolyzed by the lectin (Fig. 2A).Table IHemagglutination (HA) and hemolytic (HL) activity of native and recombinant lectinsCell typeaMinimum concentration required for 50% hemolysis of fresh erythrocytesnLSLrLSLarLSLbLSLa-D1HAaMinimum concentration required for 50% hemolysis of fresh erythrocytesHLbMinimum concentration required for hemagglutination of formaldehyde-treated erythrocytesHAaMinimum concentration required for 50% hemolysis of fresh erythrocytesHLbMinimum concentration required for hemagglutination of formaldehyde-treated erythrocytesHAaMinimum concentration required for 50% hemolysis of fresh erythrocytesHLbMinimum concentration required for hemagglutination of formaldehyde-treated erythrocytesHAaMinimum concentration required for 50% hemolysis of fresh erythrocytesHLbMinimum concentration required for hemagglutination of formaldehyde-treated erythrocytesμg/mlμg/mlμg/mlμg/mlRabbit0.00120.90.04NDcND, not determined0.08ND0.2NDHuman A0.08140.16150.085.21>1000Human B0.08170.3190.167.31>1000Human O0.08140.16170.084.72>1000Sheep0.08170.39>500.60.90.2>1000Dog0.16>3800.63>500.161.815.6>1000a Minimum concentration required for 50% hemolysis of fresh erythrocytesb Minimum concentration required for hemagglutination of formaldehyde-treated erythrocytesc ND, not determined Open table in a new tab Amino Acid Sequencing—N-terminal amino acid sequencing of the electroblotted protein yielded a very weak signal, indicating that the protein is blocked at the N terminal. Despite the weak signal, the sequence XDIYIPPEGL was determined. Enzymatic digestion with trypsin, purification of peptide fragments, and Edman degradation of the tryptic peptides yielded three peptide sequences: AVSTVDSGIINVPFT, STGFEVTTEGI, and GVSSWDLR. Carbohydrate Analysis—Neutral sugar was not detected in the purified lectin by the phenol/sulfuric acid assay. Inhibition of Hemagglutination—The sugar binding specificity of the lectin was initially investigated by hemagglutination inhibition assay (Table II). Of the mono- and disaccharides tested, Meβ-N-acetyllactosaminide was the best inhibitor.Table IIInhibition of hemagglutination activity of native and recombinant lectins by saccharidesSaccharidesnLSLrLSLa PrbPotency relative to lactose with nLSLrLSLb PrbPotency relative to lactose with nLSLLSLa-D1 PrbPotency relative to lactose with nLSLIC50aMinimum concentration required for 50% inhibition of hemagglutination activity of native and recombinant lectins against human type A erythrocytesPrbPotency relative to lactose with nLSLmMGalβ1,4Glc (lactose)6.3[1]222Galβ1,4GlcNAc (LacNAc)1.64244Galβ1,4GlcNAcOMe (Me-β-LacNAc)16.36.36.36.3Galβ1,4Frucf(lactulose)250.30.30.30.3Galβ1,4Glucitol (lactitol)500.130.130.130.13Galβ1,4Man12.50.50.50.50.5Galβ1,3Ara250.30.30.30.3Galβ1,3GalβOMe250.30.30.30.3a Minimum concentration required for 50% inhibition of hemagglutination activity of native and recombinant lectins against human type A erythrocytesb Potency relative to lactose with nLSL Open table in a new tab Inhibition of Hemolysis—The detailed sugar binding properties of the lectin were further elucidated by hemolysis inhibition assay (Fig. 3) and the concentration of saccharides required for 50% inhibition is shown in Table III. Galβ1,4Glc (lactose) was about 4–10 times more active than lactose-related saccharides such as Galβ1,4Man, Galβ1,4Fru (lactulose), and Galβ1,4Glucitol (lactitol). Galβ1,4Gal (galactobiose) showed only 26% inhibition at 12.5 mm. Galβ1,4GlcNAc (N-acetyllactosamine) was approximately twice as active as Galβ1,4Glc, about 8 times more active than Galβ1,3GlcNAc (lacto-N-biose) and Galβ1,3Ara, indicating that the lectin has a preference for the β1,4-linked isomers. The Me- and p-nitrophenyl glycosides of Galβ1,4GlcNAc were the best inhibitors among disaccharides tested, and were 3.8 times more active than Galβ1,4Glc and twice more active than Galβ1,4GlcNAc. Of the oligosaccharides tested, Galβ1,4GlcNAcβ1,3Galβ1,4Glc (lacto-N-neo- tetraose) was the best inhibitor, which was about 27 times more active than Galβ1,4Glc, and 4 times more active than Galβ1,3GlcNAcβ1,3Galβ1,4Glc and (Galβ1,4GlcNAc)2β1,6 Galβ1,4Glc (lacto-N-neohexaose).Table IIIInhibition of hemolytic activity of native and recombinant lectins by saccharidesSaccharidesNative LSLrLSLa P rbPotency relative to lactose with nLSLrLSLb P rbPotency relative to lactose with nLSLI50aMinimum concentration required for 50% inhibition of hemolytic activity of native and recombinant lectins with human type A erythrocytesP rbPotency relative to lactose with nLSLmMGalβ1,4Glc (lactose)3.0[1]0.81.9pNp-β-lactoside1.91.6NDcND, not determinedNDGalβ1,4GlcNAc (LacNAc)1.42.12.72Me β-LacNAc0.83.84.30.3pNp-β-LacNAc0.83.8NDNDGalβ1,4Frucf (lactulose)14.70.20.160.27Galβ1,4Glucitol (lactitol)27.80.10.130.17Galβ1,4Gal12.5 (26%)dMaximum concentration tested (percentage of inhibition observed)NDNDGalβ1,4Man11.20.270.240.24Galβ1,3GlcNAc (lacto-N-biose)11.50.26NDNDGalβ1,3Ara10.60.280.260.16Galβ1,3GalNAcβOMe7.00.43NDNDGalβ1,3GalαOMe25.40.12NDNDMe β-Gal84.50.04NDND2-Fucosyllactose11.30.27NDND3′-Fucosyllactose23.70.13NDNDGalα1,3lactose15.50.19NDNDGalβ1,3lactose5.50.54NDNDGalβ1,4lactose2.41.25NDNDGalβ1,6lactose2.91.0NDNDLacto-N-hexaose1.392.166<2.3Lacto-N-neohexaose0.535.66103Galβ1,3GlcNAcβ1,3Galβ1,4Glc (Lacto-N-tetraose)0.535.66153.3Galβ1,4GlcNAcβ1,3Galβ1,4Glc (Lacto-N-neotetraose)0.1127.333.34.3a Minimum concentration required for 50% inhibition of hemolytic activity of native and recombinant lectins with human type A erythrocytesb Potency relative to lactose with nLSLc ND, not determinedd Maximum concentration tested (percentage of inhibition observed) Open table in a new tab Quantitative Precipitation—The ability of various glycoproteins and polysaccharides to precipitate the purified nLSL was investigated by the quantitative precipitation assay; among those examined were: both native and desialylated fetuin, α1-acid glycoproteins, thyroglobulin, transferrin, ovine submaxillary mucin, bovine submaxillary mucin, glycophorin, β-tetragalactosylglucose, and pneumococcus type 14 polysaccharide. Although the hemagglutination and hemolytic activity of nLSL was specifically inhibited by lactose and N-acetyllactosamine, asialo α1-acid glycoproteins and asialofetuin, which contain mixtures of N-acetyllactosamine-type N-linked glycans, failed to precipitate the lectin. Of many glycoproteins and polysaccharides examined, only pneumococcus type 14 polysaccharide gave a precipitation curve with nLSL (Fig. 4). Molecular Cloning of L. sulfureus Lectin—3′-RACE with the adapter primers and the degenerate primers that were designed from the trypsin-digested fragment yielded a 1-kilobase pair product. Cloning and sequencing of 5′-RACE products generated three different full-length nucleotide sequences including polyadenylation (termed LSLa, LSLb, and LSLc). Of 17 clones, 9 clones appeared to contain LSLa, whereas 6 clones contained LSLb and 2 clones contained LSLc. LSLa, LSLb, and LSLc contain a 57-bp 5′-untranslated region, followed by a 945-bp open reading frame encoding 315 amino acid residues, and the 218, 122, and 124 bp 3′-untranslated regions, respectively (Fig. 5). None of them contain an adenylation signal sequence. The calculated molecular masses of LSLa (34,964 Da), LSLb (35,150 Da), and LSLc (35,101 Da) without N-terminal Met are in good agreement with the molecular mass of native lectin (35 kDa) estimated by SDS-PAGE. The deduced amino acid sequences revealed that LSLa contains precisely the same sequence as the sequenced peptides of purified lectin, whereas the two other lectins contain slightly different sequences (Fig. 5). No signal sequence could be discerned in the deduced amino acid sequences of the LSLs, indicating their synthesis on free polysomes. LSLa and LSLc have two, and LSLb has one potential N-linked glycosylation site(s) (Asn-Xaa-Ser/Thr) in their sequences (Fig. 5). However, as indicated above, no carbohydrate was detected in the native lectin. These data suggested that LSLa corresponds to the same protein as nLSL. Osmotic Protection of Erythrocytes—Because L. sulfureus lectin showed sequence identity with several pore-forming toxins, it was postulated that the hemolytic activity of the lectin was because of the formation of ion-permeable pores in the membrane. Therefore, osmotic protection experiments were performed in the presence of human type A erythrocyte
Referência(s)