Disruption of adaptor protein 2μ ( AP ‐2μ) in cochlear hair cells impairs vesicle reloading of synaptic release sites and hearing
2015; Springer Nature; Volume: 34; Issue: 21 Linguagem: Inglês
10.15252/embj.201591885
ISSN1460-2075
AutoresSangyong Jung, Tanja Maritzen, Carolin Wichmann, Zhizi Jing, Andreas Neef, Natalia H. Revelo, Hanan Al‐Moyed, Sandra Meese, Sonja M. Wojcik, Iliana Panou, Haydar Bulut, Peter Schu, Ralf Ficner, Ellen Reisinger, Silvio O. Rizzoli, Jakob Neef, Nicola Strenzke, Volker Haucke, Tobias Moser,
Tópico(s)Cellular transport and secretion
ResumoArticle7 October 2015free access Disruption of adaptor protein 2μ (AP-2μ) in cochlear hair cells impairs vesicle reloading of synaptic release sites and hearing SangYong Jung SangYong Jung Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Search for more papers by this author Tanja Maritzen Tanja Maritzen Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany NeuroCure Cluster of Excellence & Collaborative Research Center 958, Freie Universität Berlin, Berlin, Germany Search for more papers by this author Carolin Wichmann Carolin Wichmann Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Architecture of Synapses Group, Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Zhizi Jing Zhizi Jing Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Auditory Systems Physiology Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Andreas Neef Corresponding Author Andreas Neef Bernstein Group Biophysics of Neural Computation, Max Planck Institute for Dynamics and Self-Organization, Göttingen, Germany Search for more papers by this author Natalia H Revelo Natalia H Revelo Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Neuro- and Sensory Physiology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Hanan Al-Moyed Hanan Al-Moyed Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Architecture of Synapses Group, Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Sandra Meese Sandra Meese Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Molecular Structural Biology, Institute for Microbiology and Genetics, University of Göttingen, Göttingen, Germany Search for more papers by this author Sonja M Wojcik Sonja M Wojcik Department of Molecular Neurobiology, Max Planck Institute of Experimental Medicine, Göttingen, Germany Search for more papers by this author Iliana Panou Iliana Panou Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Search for more papers by this author Haydar Bulut Haydar Bulut Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany Search for more papers by this author Peter Schu Peter Schu Department of Cellular Biochemistry, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Ralf Ficner Ralf Ficner Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Molecular Structural Biology, Institute for Microbiology and Genetics, University of Göttingen, Göttingen, Germany Search for more papers by this author Ellen Reisinger Ellen Reisinger Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Biology of Cochlear Neurotransmission Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Silvio O Rizzoli Silvio O Rizzoli Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Neuro- and Sensory Physiology, University Medical Center Göttingen, Göttingen, Germany Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University of Göttingen, Göttingen, Germany Search for more papers by this author Jakob Neef Jakob Neef Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Search for more papers by this author Nicola Strenzke Nicola Strenzke Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Auditory Systems Physiology Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Volker Haucke Corresponding Author Volker Haucke Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany NeuroCure Cluster of Excellence & Collaborative Research Center 958, Freie Universität Berlin, Berlin, Germany Search for more papers by this author Tobias Moser Corresponding Author Tobias Moser Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University of Göttingen, Göttingen, Germany Search for more papers by this author SangYong Jung SangYong Jung Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Search for more papers by this author Tanja Maritzen Tanja Maritzen Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany NeuroCure Cluster of Excellence & Collaborative Research Center 958, Freie Universität Berlin, Berlin, Germany Search for more papers by this author Carolin Wichmann Carolin Wichmann Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Architecture of Synapses Group, Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Zhizi Jing Zhizi Jing Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Auditory Systems Physiology Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Andreas Neef Corresponding Author Andreas Neef Bernstein Group Biophysics of Neural Computation, Max Planck Institute for Dynamics and Self-Organization, Göttingen, Germany Search for more papers by this author Natalia H Revelo Natalia H Revelo Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Neuro- and Sensory Physiology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Hanan Al-Moyed Hanan Al-Moyed Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Architecture of Synapses Group, Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Sandra Meese Sandra Meese Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Molecular Structural Biology, Institute for Microbiology and Genetics, University of Göttingen, Göttingen, Germany Search for more papers by this author Sonja M Wojcik Sonja M Wojcik Department of Molecular Neurobiology, Max Planck Institute of Experimental Medicine, Göttingen, Germany Search for more papers by this author Iliana Panou Iliana Panou Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Search for more papers by this author Haydar Bulut Haydar Bulut Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany Search for more papers by this author Peter Schu Peter Schu Department of Cellular Biochemistry, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Ralf Ficner Ralf Ficner Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Molecular Structural Biology, Institute for Microbiology and Genetics, University of Göttingen, Göttingen, Germany Search for more papers by this author Ellen Reisinger Ellen Reisinger Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Molecular Biology of Cochlear Neurotransmission Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Silvio O Rizzoli Silvio O Rizzoli Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Department of Neuro- and Sensory Physiology, University Medical Center Göttingen, Göttingen, Germany Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University of Göttingen, Göttingen, Germany Search for more papers by this author Jakob Neef Jakob Neef Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Search for more papers by this author Nicola Strenzke Nicola Strenzke Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Auditory Systems Physiology Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany Search for more papers by this author Volker Haucke Corresponding Author Volker Haucke Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany NeuroCure Cluster of Excellence & Collaborative Research Center 958, Freie Universität Berlin, Berlin, Germany Search for more papers by this author Tobias Moser Corresponding Author Tobias Moser Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany Collaborative Research Center 889, University of Göttingen, Göttingen, Germany Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University of Göttingen, Göttingen, Germany Search for more papers by this author Author Information SangYong Jung1,2,3,‡, Tanja Maritzen4,5,‡, Carolin Wichmann2,6,‡, Zhizi Jing2,7, Andreas Neef 8, Natalia H Revelo2,9, Hanan Al-Moyed2,6, Sandra Meese2,10, Sonja M Wojcik11, Iliana Panou1,2, Haydar Bulut4, Peter Schu12, Ralf Ficner2,10, Ellen Reisinger2,13, Silvio O Rizzoli2,9,14, Jakob Neef1,2,3, Nicola Strenzke2,7, Volker Haucke 4,5 and Tobias Moser 1,2,3,14 1Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany 2Collaborative Research Center 889, University of Göttingen, Göttingen, Germany 3Synaptic Nanophysiology Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany 4Leibniz Institut für Molekulare Pharmakologie (FMP), Berlin, Germany 5NeuroCure Cluster of Excellence & Collaborative Research Center 958, Freie Universität Berlin, Berlin, Germany 6Molecular Architecture of Synapses Group, Institute for Auditory Neuroscience and InnerEarLab, University Medical Center Göttingen, Göttingen, Germany 7Auditory Systems Physiology Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany 8Bernstein Group Biophysics of Neural Computation, Max Planck Institute for Dynamics and Self-Organization, Göttingen, Germany 9Department of Neuro- and Sensory Physiology, University Medical Center Göttingen, Göttingen, Germany 10Department of Molecular Structural Biology, Institute for Microbiology and Genetics, University of Göttingen, Göttingen, Germany 11Department of Molecular Neurobiology, Max Planck Institute of Experimental Medicine, Göttingen, Germany 12Department of Cellular Biochemistry, University Medical Center Göttingen, Göttingen, Germany 13Molecular Biology of Cochlear Neurotransmission Group, InnerEarLab, Department of Otolaryngology, University Medical Center Göttingen, Göttingen, Germany 14Center for Nanoscale Microscopy and Molecular Physiology of the Brain, University of Göttingen, Göttingen, Germany ‡These authors contributed equally to this work *Corresponding author. Tel: +49 551 5176 424; E-mail: [email protected] *Corresponding author. Tel: +49 30 94793101; E-mail: [email protected] *Corresponding author. Tel: +49 551 3922803; E-mail: [email protected] The EMBO Journal (2015)34:2686-2702https://doi.org/10.15252/embj.201591885 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Abstract Active zones (AZs) of inner hair cells (IHCs) indefatigably release hundreds of vesicles per second, requiring each release site to reload vesicles at tens per second. Here, we report that the endocytic adaptor protein 2μ (AP-2μ) is required for release site replenishment and hearing. We show that hair cell-specific disruption of AP-2μ slows IHC exocytosis immediately after fusion of the readily releasable pool of vesicles, despite normal abundance of membrane-proximal vesicles and intact endocytic membrane retrieval. Sound-driven postsynaptic spiking was reduced in a use-dependent manner, and the altered interspike interval statistics suggested a slowed reloading of release sites. Sustained strong stimulation led to accumulation of endosome-like vacuoles, fewer clathrin-coated endocytic intermediates, and vesicle depletion of the membrane-distal synaptic ribbon in AP-2μ-deficient IHCs, indicating a further role of AP-2μ in clathrin-dependent vesicle reformation on a timescale of many seconds. Finally, we show that AP-2 sorts its IHC-cargo otoferlin. We propose that binding of AP-2 to otoferlin facilitates replenishment of release sites, for example, via speeding AZ clearance of exocytosed material, in addition to a role of AP-2 in synaptic vesicle reformation. Synopsis Active zones of sensory inner hair cells indefatigably release glutamate at very high rates. This study integrates experimental and theoretical approaches to indicate that the endocytic adaptor protein 2 (AP-2) promotes vesicle replenishment possibly via facilitating the clearance of vesicular release sites. The study also shows a role of AP-2 in synaptic vesicle reformation following bulk endocytosis. Hair cell-specific deletion of AP-2μ causes synaptic hearing impairment and hearing is rescued upon reinstating AP-2μ expression via viral gene transfer. AP-2μ is required for efficient vesicle replenishment at hair cell active zones. AP-2μ likely facilitates the clearance of vesicular release sites from previously exocytosed material e.g. via binding to its cargo otoferlin. Synaptic vesicle formation following bulk endocytosis requires AP-2μ. Introduction Hearing relies on sound encoding at ribbon synapses between IHCs and spiral ganglion neurons (SGNs). Even during continued stimulation, each SGN can fire at hundreds of Hz in response to release from a single IHC AZ (Matthews & Fuchs, 2010; Pangršič et al, 2012; Safieddine et al, 2012). Such vivid firing requires the AZ to indefatigably release vesicles at even higher rates, because some release events fail to trigger a spike due to neural refractoriness. Indeed, sustained exocytosis of up to 70 Hz from each of the ~10–15 release sites of the AZ composing the readily releasable pool (RRP) was reported (Pangršič et al, 2010) requiring rapid reloading. Rapid vesicle turnover requires sufficient amounts of the hair cell C2-domain protein otoferlin (Roux et al, 2006; Pangršič et al, 2010) that when defective causes human hearing impairment (Yasunaga et al, 1999; Varga et al, 2006). However, a role of otoferlin in pre-fusion priming could so far not be distinguished from a post-fusion function in clearing previously exocytosed membrane from release sites (Pangršič et al, 2010; Pangršič et al, 2012; Duncker et al, 2013). Dissociation of vesicular proteins from the release site and/or diffusion of newly exocytosed material to the perisynaptic zone of endocytosis might be rate-limiting the rapid release site cycle in IHCs. Facilitated AZ clearance involving interactions between exocytic and endocytic proteins such as neuronal SNAREs, synaptotagmins, intersectins, dynamins, and AP-2 has been proposed at other synapses (Hosoi et al, 2009; Haucke et al, 2011; Sakaba et al, 2013; Xu et al, 2013), and an interaction of AP-2 with otoferlin has recently been reported (Duncker et al, 2013). Testing the AZ clearance hypothesis has remained challenging. The IHC synapse is an attractive model for addressing this hypothesis, given the massive vesicle turnover and the experimental access to the function of single AZs and release sites by in vivo recordings from single SGNs. The statistics of interspike intervals of SGNs for short intervals deviates from exponential (Li & Young, 1993; Heil et al, 2007) that would be expected for a stochastic, memory-less Poisson process. This deviation has been taken to indicate that some excitatory events expected from a Poissonian process are left out possibly due to presynaptic refractoriness, which was mathematically described as a contribution of a gamma process (Heil et al, 2007). In fact, if only a single release site was to drive postsynaptic spikes, the interspike intervals would be expected to follow a gamma distribution, as replenishment of a new release-ready vesicle will take a finite time. Exponentially distributed interspike intervals could only be observed if replenishment was infinitely fast. If several independent release sites contribute to the active zone output, rapid succession of release events becomes more likely and the interspike intervals are expected to follow a mixed exponential/gamma distribution. One possible interpretation of the experimentally observed mixed exponential/gamma distribution is the parallel action of only four release sites per IHC AZ, each modeled with only two states (Peterson et al, 2014). However, IHC AZs likely feature 10 or more release sites (Frank et al, 2010; Pangršič et al, 2010), each comprising more than 2 functional states (Andor-Ardo et al, 2010). Therefore, we reason that the gamma process may relate to clearance at each of the 10–15 release sites. Here, we tested the role of AP-2 and the AZ clearance hypothesis at the IHC synapse by combining mouse genetics, cellular and systems physiology, and super-resolution light and electron microscopy, as well as protein–protein interaction studies. We find that AP-2μ expression in IHCs is required for efficient replenishment of release sites. Using mathematical modeling, we interpret an increased contribution of the gamma process to interspike interval statistics in the absence of AP-2μ as indication for impaired vesicle replenishment, for example, due to defective AZ clearance. We characterize the binding of AP-2 to its cargo otoferlin and propose that their interaction is required for vesicle replenishment. In addition, we show that AP-2μ is dispensable for endocytic retrieval of exocytosed membrane but required for clathrin-dependent vesicle reformation from bulk-endocytosed membrane and vesicle recharging of the ribbon on a longer time scale. Results Expression of AP-2μ in IHCs is required for hearing To study the role of AP-2 in the presynaptic function of IHCs and hearing, we genetically deleted its non-redundant AP-2μ subunit in IHCs. We crossed mice carrying floxed alleles of the gene encoding the AP-2μ subunit (AP-2μfl/fl, Kononenko et al, 2014) with a transgenic Cre driver mouse expressing Cre under the Vglut3 promoter (Jung et al, 2015), which is active in IHCs (Ruel et al, 2008; Seal et al, 2008). Cre recombination was observed in > 99% of IHCs and in some outer hair cells using a floxed-(E)GFP reporter (Nakamura et al, 2006; AP-2μfl/fl:Cre:GFP; Figs 1A and EV1A). GFP signal was not observed in SGNs (Figs 1A and EV1A) but seemed to be present in some capillaries. We never detected GFP-positive IHCs in AP-2μfl/fl:GFP mice that served as one control mouse line (AP-2μ control, see Materials and Methods). Cre recombination in the AP-2μfl/fl:Cre:GFP organ of Corti was further demonstrated by PCR (Fig EV1B). AP-2μ deletion and transgenic expression of Cre and GFP did not cause any overt change in the morphology of the hair bundle or base of the IHCs (Figs 1B and EV1C). Immunolabeling demonstrated the expression of AP-2μ in wild-type IHCs (Fig 1C) and confirmed the absence of AP-2μ in AP-2μfl/fl:Cre:GFP IHCs (Fig 1D). Immunohistochemical analysis of the expression of other AP-2 subunits in IHCs did not work reproducibly with various antibodies at our disposal, but we assume that AP-2μ disruption results in substantial depletion of the entire AP-2 complex [by about 80% in hippocampal neurons (Kononenko et al, 2014)]. Figure 1. Hair cell-specific disruption of AP-2μ A. Cre recombination in IHCs and outer hair cells (OHCs) by transgenic Cre expression was demonstrated by a GFP reporter and used for inactivation of the AP-2μ gene. Most if not all IHCs (identified by vGlut3 immunofluorescence, magenta) in an AP-2μfl/fl:Cre:GFP p14 organ of Corti are GFP positive (green). GFP fluorescence is weak in OHCs peripheral to IHCs and absent from SGNs (see also Fig EV1). Scale bar, 200 μm. B. Differential interference contrast images indicate normal gross morphology of the p14 IHC hair bundle and basolateral pole. The dashed line indicates the approximate outline of an IHC. Scale bar, 20 μm. C, D. Maximum intensity projections of representative confocal sections of AP-2μ+/+:Cre:GFP (C) and AP-2μfl/fl:Cre:GFP (D) IHCs immunolabeled for AP-2μ (magenta, left) and GFP (green, right). Scale bars, 10 μm. Download figure Download PowerPoint Click here to expand this figure. Figure EV1. Generation of hair cell-specific AP-2μ knockout mice (AP-2μfl/fl:Cre) Cryosectioned cochlea of a p7 AP-2μfl/fl:Cre mouse demonstrates VGLUT3-driven Cre recombination in IHCs and OHCs (Jung et al, 2015) but not in SGNs, as reported by a floxed EGFP reporter (Nakamura et al, 2006). Immunohistochemical staining for calretinin (magenta), marking IHCs, OHCs, and SGNs and native EGFP fluorescence (green), indicating Cre recombination. In addition to EGFP signal in hair cells, some EGFP expression was found in capillaries and supporting cells. Scale bar, 50 μm. PCR of genomic DNA extracted from microdissected cochlea of p21 mice shows amplification of the Cre-recombined region in Cre-expressing AP-2μfl/fl mice ((Kononenko et al, 2014), middle column), but not in AP-2μ control: C57Bl/6 expressing Cre (left column) or AP-2μfl/fl mice lacking Cre (right column). Genomic DNA was isolated from whole cochleae of AP-2μfl/fl:Cre:GFP, AP-2μfl/fl, and AP-2μ+/+:Cre mice with the nexttec™ kit (nexttec Biotechnologie GmbH, Germany). PCR was performed using DreamTaq DNA polymerase (Fermentas). The Cre-recombinated excision of exon 2–3 in the Ap-2μ gene was confirmed by using the forward primer TM330 GCTCTAAAGGTTATGCCTGGTGG and the reverse primer TM191 CCAAGGGACCTACAGGACTTC that detected a fragment of 404 bp (PCR at 58°C, 25 cycles) in cochlear DNA. Phalloidin immunofluorescence shows apparently intact stereociliar bundles (magenta) of IHCs (1 row) and OHCs (three rows) in acutely dissected apical coils of the cochlea from AP-2μfl/fl control and AP-2μfl/fl:Cre mice at p7. Scale bar, 10 μm. Download figure Download PowerPoint Recordings of auditory brainstem responses (ABR) revealed a profound hearing impairment in AP-2μfl/fl:Cre:GFP mice (Fig 2A and B; 3- to 6-week-old mice, normal ABR in AP-2μfl/+:Cre:GFP mice, n = 9, Appendix Fig S1A). The presence of normal otoacoustic emissions indicated normal mechanoelectrical transduction and cochlear amplification by outer hair cells (Fig EV2D–F), suggesting that hearing is impaired due to defective sound coding at the IHC synapse (auditory synaptopathy, recent review in Moser et al, 2013). In order to further test whether the hearing impairment in AP-2μfl/fl:Cre:GFP mice can be specifically attributed to the loss of AP-2μ from IHCs, we analyzed if hearing was rescued by transgenic expression of AP-2μ in IHCs. We employed injection of adeno-associated virus (AAV) 2/1 (serotype 2 with chimeric capsid proteins of serotypes 1 and 2/1–2, Fig EV2A) carrying AP-2μ-IRES-mRFP under the control of the CMV-enhanced human β-actin promoter via the round window into scala tympani at postnatal day 10 [Fig EV2B, similar to Akil et al (2012)]. We achieved near complete transduction of AP-2μfl/fl:Cre:GFP IHCs in the injected left ear as indicated by mRFP expression (Fig 2C) but did not find mRFP signal in the non-injected right ear (Fig EV2C). Transgenic expression of AP-2μ substantially increased ABR amplitudes (Fig 2D, n = 4) and largely restored the ABR thresholds (Fig 2E, n = 4). Thresholds for stimulation with 12 kHz tone burst and click were indistinguishable from AP-2μ control (P > 0.05, Wilcoxon rank-sum test, followed by Dunn's multiple comparisons for thresholds) and significantly improved over non-rescued ears AP-2μfl/fl:Cre:GFP (P < 0.05, Wilcoxon rank-sum test, followed by Dunn's multiple comparisons) confirming the specific requirement of AP-2μ in IHCs for hearing. The hearing impairment of the non-injected ear of the same animals was assessed after plugging the injected ear (Pauli-Magnus et al, 2007) and was comparable to that of the non-injected AP-2μfl/fl:Cre:GFP mice (Fig 2A and B; P > 0.05, Wilcoxon rank-sum test). In contrast to the auditory synaptopathy caused by AP-2μ disruption, no hearing impairment was found in mice lacking the σ1B subunit of clathrin adaptor protein AP-1 (Appendix Fig S1B), whereas pleiotropic changes of the inner ear have been reported for AP-3 mutant mice (Rolfsen & Erway, 1984; Glyvuk et al, 2010). Figure 2. Disruption of AP-2μ in IHCs causes synaptopathic hearing impairment Average ABR waveforms in response to 90-dB clicks. ABR waves in AP-2μfl/fl:Cre:GFP mice (abbreviated AP-2μfl/fl:Cre on Figures throughout hereafter, 3- to 6-week-old, red: mean, pink: SEM, n = 9) were barely discernible even at such high stimulus intensities, mean ABR of AP-2 control mice (black, grey: SEM, n = 8) are shown for comparison. ABR thresholds were highly elevated in AP-2μfl/fl:Cre:GFP mice (red, mean ± SEM, n = 9) compared to AP-2μ control mice (black, mean ± SEM, n = 8), often exceeding the maximal loudspeaker output of 100 dB (numbers on top indicate the fraction of mutant animals in which thresholds exceeded this value and were set to 110 for calculation of the average and SEM). Transduction of AP-2μfl/fl:Cre:GFP IHCs via postnatal injection of AAV-AP-2μ-mRFP (see Fig EV2) into the cochlear perilymph on postnatal day 10 as indicated by mRFP fluorescence (magenta) in otoferlin(green)-immunolabeled IHCs. Scale bar, 20 μm. Average ABR waveforms in response to 80-dB clicks of the AAV-AP-2μ-mRFP-injected left ears of AP-2μfl/fl:Cre:GFP mice (n = 4, blue, mean ± SEM “rescued”). Hearing was largely rescued when compared to control recordings from the non-injected ear of the same mice (red, mean ± SEM, n = 4 “non-rescued”). ABR thresholds of injected (blue) and non-injected (red) ears of the same AP-2μfl/fl:Cre:GFP mice (numbers on top indicate the fraction of ears in which tone burst thresholds exceeded 80 dB and were set to 90 for calculation of the average and SEM). Download figure Download PowerPoint Click here to expand this figure. Figure EV2. Viral rescue of AP-2μ expression in AP-2μfl/fl:Cre:GFP mice and intact cochlear amplification by OHCs in AP-2μfl/fl:Cre:GFP mice A. Illustration of the vector for AAV2/1-mediated rescue of hearing in AP-2μfl/fl:Cre:GFP mice. AP-2μ is expressed under the CMV-enhanced human β-actin promoter, and mRFP was used as a reporter gene under the control of the internal ribosome entry site (IRES). B. Surgical situs for AAV injection into the scala tympani of the left ear. In brief, a retroauricular incision was made, skin, connective tissue, and musculature retracted by a custom stainless steel retractor, and the bulla opened carefully with fine forceps to just expose the round window niche. A 10- to 20-μm tip glass pipette was filled with AAV suspension and fast green dye and used to inject 2–3 shots of virus suspension (0.2–0.5 μl of 4.32E12 genome copies/ml, packaged at Penn Vector Core) at 0.13–0.34 bar using a pico-injector (PL1–100, Harvard Apparatus). The wound was closed with adipose tissue and mice recovered and finally returned to the dam. This procedure led to no or minimal ABR threshold increases when injecting wild-type ears with AAV carrying either fluorescent protein or AP-2μ along with the fluorescent protein (data not shown). C. Transduction of AP-2μfl/fl:Cre:GFP IHCs via postnatal injection of AAV-AP-2μ-mRFP into the cochlear perilymph of the left ear on postnatal day 10 as indicated by native mRFP fluorescence (magenta) in otoferlin (green)-immunolabeled IHCs. In contrast, there was no mRFP signal and much less otoferlin immunofluorescence in the non-injected right ear of the same mouse. Scale bar, 10 μm. D, E. Average DPOAE growth functions in response
Referência(s)