Portal de Periódicos da CAPES

Lymphogranuloma venereum caused by Chlamydia trachomatis serovar L3: a case report

2007; Lippincott Williams & Wilkins; Volume: 120; Issue: 7 Linguagem: Inglês

10.1097/00029330-200704010-00015

2542-5641

Er-xun Kang, Xing Gao, Yue-Ping Yin, Fu‐Sheng Wang, Weidong Yao, X Gong, Xiang‐Sheng Chen,

Cervical Cancer and HPV Research

Lymphogranuloma venereum (LGV) is a systemic sexually transmitted disease caused by Chlamydia trachomatis (C. trachomatis) L1, L2 and L3, the organism gains entrance through skin breaks and abrasions and travels via the lymphatics to multiply within mononuclear phagocytes in regional lymph nodes.1 The clinical presentation of LGV depends on the sex of the patient, mode of sexual contact (e.g. vaginal or anal sex) and the stage of the disease.1 LGV is diagnosed in men up to 6 times more frequently than in women, but the infected women are more likely developed to late stage.1 LGV is rare in China, however the incidence was increasing in recent years. In this paper we diagnosed a case of LGV, and confirmed this case was caused by L3 serovar of C. trachomatis by using genotype test. METHODS Clinical data The patient is a 41-year-old divorced female who has a history of multi-sex partners in the last half year and she had developed an genital ulcer 2 months ago, and had cured when presented to our hospital. She denied frequent micturition, urgency, odynuria, and bearing-down pain on inferior belly. Physical examination found no erythema, or other rash on the skin. No ulcer, abscess, neoplasm, purulent secretion was found on genital examination. Left inguinal lymphonode enlarged, light tenderness, biopsy found rare liquor puris in inguinal lymphonode. Vaginoscopy found 3.2 cm × 2.6 cm lump on cervix. Proctoscopy found no proctitis appearance, laboratory examination found these tests are positive including treponema pallidum particle agglutination test (+), rapid plasma reagin test (+, titre1:8), cervical canal’s secretion C. trachomatis (+). The other negative tests included anti-HIV-antibody (-), cervical canal’s secretion Mycoplasma urealytium (-), gonococcus (-), and samples taken from cervix lump and inguinal lymphonode showed treponema silver staining (-), cerebrospinal fluid venereal disease research laboratory test (-). Materials The materials used in our study were included as following: AluI incision enzyme (Fermentas Life Science Co., Lithuania), Taq enzyme (BioFlux Co., Japan), polymerase chain reaction (PCR) primer (synthesized by Shanghai Shengon Biological Engineering Technology and Service Co. Ltd, China), GeneRulerTM 50 bp DNA marker(MBI Co., India), UNIQ-10 Column DNA extraction kit (Merck Co., Germany), Proteinase K(Merck Co.), McCoy cell strain kept by the venereal disease laboratory of Institute of Dermatology, Chinese Academy of Medical Sciences & Peking Union Medical College, China, 1640 medium(GIBCO/BR, USA). Methods Lymphnode biopsy Left inguinal lymph nodes were excised, fixed with 10% formalin and embedded in paraffin. Routine H-E staining was carried out. C. trachomatis culture Pre-cultured McCoy cell monolayer in 1640 medium supplemented with 10% heat-inactivated fetal bovine serum with 6-well culture plate. To take liquor puris from lymphonode into a 5 ml centrifuge tube, added double distilled water to 4 ml, mixed completely, centrifugated at 8000 r/min for 5 minutes, discarded supernatant. Added 4 ml culture solution, mixed completely, clearaged by sonic oscillation for 30 seconds. Transfer sample mixture to 6-well culture plate (2 ml/well), centrifugated at 3000 r/min for 1 hour, cultured in a humidified atmosphere of 5% CO2 at 37°C for 72 hours, iodine solution staining to observe result.2 DNA extraction Lymphonode tissues were ground into plasm, transferred to a 2 ml centrifuge tube, added 1.2 ml xylene, vibrated for a moment, centrifugated at 12 000 r/min for 5 minutes, discarded supernatant containing dissolved paraffin. Added 1.2 ml dehydrated alcohol, vibrated for 1 minute to remove remaining xylene. DNA was suspended in 200 μl TE. Added 400 μl DCL buffer and 3 μl proteinase K, incubated at 55°C for 30 minutes. Polymerase chain reaction As advised in published literature,3 amplificated chlamydia plasmid DNA with primers CP24: 5’-GGGATTCCTGTAACAACAAGTCAGG-3’ and CP27: 5’-CCTCTTCCCCAGAACAATAAGAACAC-3’ (207 bp product); Amplificated standard chlamydia type E plasmid DNA with primers SERO1A: 5’-ATGAAAAAACTCTTGAAATCGG-3’ and SERO2A: 5’-TTTCTAGACTTCATCTTGTT-3’; A nested PCR was performed focused on the omp1 gene constant region CD4, CD5 of C. trachomatis major outer membrane protein1 (momp1) gene with primers NLI: 5’-TTTGCCGCTTTGAGTTCTGCT-3’ and NRI: 5’-CCGCAAGATTTTCTAGATTTC-3’. PCR reaction mixture containing sample 10 μl DNA, 50 pmol each primer, 200 μmol/L each dNTP, 5 μl 10× Taq buffer, 3 mmol/L MgCl2, 2 U Taq DNA polymerase, double distilled, deionized water added to 50 μl. The reaction mixture was initially heated to 94°C for 6 minutes and then amplified for 30 cycles: 30 seconds at 94°C, 30 seconds at 53°C and 2 minutes at 72°C. A final extension was performed at 65°C for 5 minutes. PCR products amplified were loaded onto the 2.0% agarose gel for electrophoresis. Restriction fragment length polymorphism analysis(RFLP) PCR products were submitted to restriction endonuclease AluI digestion of omp1 gene at 37°C for 6 hours, 20 μl reaction mixture contained 2 U restriction endonuclease AluI, 5 μl PCR products, 2 μl restriction endonuclease buffer. Restriction profiles were analyzed by using 10% polyacrylamide gel electrophoresis at 8 V/cm for 2 hours. Nucleotide sequencing According to literature, sequencing primers OMP6S: 5’-TCTTTCCAATACGCTCAATC-3’ and OMP2: 5’-AC TGTAACTGCGTATTTGTCTG-3’ were used to sequence sample DNA omp1 gene constant region (CD3, CD5) and variable region(VD4).3,4 RESULTS Clinical data and lymphonode biopsy Clinical data pointed to infection with C. trachomatis. Vaginoscopy found a 3.2 cm × 2.6 cm lump on cervix. Biopsy found white rare liquor puris in the left inguinal lymph node. Microscopic examination found some abscesses and macrophage granulomas within the lymph node tissue (Figs. 1, 2).Fig. 1.: Vaginoscopy found 3.2 cm × 2.6 cm lump on cervix.Fig. 2. Lymphonode tissue necrosis to form stellate abscesses. Histiocytes, epithelioid cells and macrophagus form granuloma (HE, original magnification ×10).C. trachomatisculture Normal McCoy cells were fusiform or astro-shape, plasm well-distributed, nucleus in undertint colour, outline not clear. C. trachomatis infected McCoy cells were larger than normal, nucleus were pushed to side, inclusion body appeared round, in dark colour after iodine staining (Figs. 3, 4).Fig. 3.: Inclusion body clearly observed under micro (Iodine staining, original magnification ×25).Fig. 4. C. trachomatis infected McCoy cells were larger than normal, nucleolus were pushed to side, inclusion body appeared round, in dark colour (Iodine staining, original magnification ×400).PCR amplification Omp1 gene nest PCR amplification generated a 1043 bp fragment. Compared the sample DNA fingerprint with type strain-E C. trachomatis plasmid PCR amplification product, we roughly identified the patient infected with C. trachomatis (Fig. 5).Fig. 5.: The result of omp1 gene nest PCR amplification 1: Sample plasmid PCR amplification product 1—1: Sample omp1 nest PCR product 2: type strain-E plasmid PCR amplification product 2—1: Sample omp1 nest PCR product M: GeneRulerTM 50bp DNA Ladder (MBI).RFLP result Compared restriction endonuclease AluI digestion products of omp1 gene which PCR amplificated with standard strain-E and standard strain-L3, RFLP profile identified the C. trachomatis which the patient infected was L3 serotype (Fig. 6).Fig. 6.: The result of RFLP Type strain-E endonuclease AluI digestion products Type strain-L3 endonuclease AluI digestion products Sample endonuclease AluI digestion products pUC19 DNA/MspI Marker (MBI).Nucleotide sequencing For typing the C. trachomatis determined above, the omp1 gene constant region CD3, CD5 and variable region VD4 of the target DNA was sequenced. The sequencing result was as follow: 5’ATTTTG AGAGTTGAATGTTCTTTGTGATGCATCCGAATTTA CTATTAATAAGCCGAAAGGATATGTTGCGGGCGG AATTTCCACTTGATATTACCGCAGGAACAGAAGC TGCGACAGGGACTAAGGATGCCTCTATTGACTAC CATGAGTGGCAAGCAAGTTTAGCCCTTTCTTACA GATTAAATATGTTCACTCCTTACATTGGAGTTAAA TGGTCTAGAGTAAGTTTTGATGCCGACACGATCC GTATCGCTCAGCCTAAATTGGCTGAAGCAGTCTT GGATGTCACTACTCTAAACCCGACCATCGCTGGT AAAGGAAGTGTGGTCGCTTCCGGCAGCGACAACG AACTGGCTGATACAATGCAAATCGTTTCCTTGCA GTTGAACAAGATGAAATCTAGAAAATCTTGCGGT ATTGCAGTAGGAACGACTATTGTAGATGCAGACA AATACGCAGCTTACAGTATA 3’. Compared the sequence with gene BLAST L3/404 (gi|78714060|gb|DQ064296.1|[78714060]), the alignment coincidence was 99.35% with C. trachomatis L3 serotype with only one nucleotide base being discrepant. Combined with the sequencing result and the results of PCR fingerprint as well as RFLP profiles, we ultimately determined this patient was infected by C. trachomatis serovar L3. Diagnosis The patient was diagnosed as lymphogranuloma venereum caused by C. trachomatis serovar L3 as well as early latent syphilis. DISCUSSION LGV is a sexually transmitted disease caused by serovars L1, L2, and L3 of C. trachomatis. Serovar L2 is the most common cause in Europe.1,5 LGV is endemic in Africa, India, Southeast Asia, South America, and the Caribbean, sporadic cases of LGV have occurred in China.6 LGV occurs in 3 stages. The majority of LGV infections in the primary and secondary stages may go undetected. The primary stage is marked by the formation of a painless herpetiform ulceration on the genitalia. The secondary stage is classically described as the inguinal syndrome, which is characterized by painful unilateral inguinal lymphadenitis and associated constitutional symptoms, such as fever, headache, malaise, nausea and arthralgias. Perirectal and pelvic lymph node may also become involved as a result of lymphatic spread from the cervix and posterior vaginal wall. The clinical appearance in this stage may be similar to other infections, including cat scratch disease and mycobacterial granuloma. The tertiary stage of LGV occurs years after the initial infection. During this stage, an anogenitorectal syndrome may occur, this syndrome is found predominantly in women and homosexual men, forms perirectal abscesses, ischiorectal abscesses, rectovaginal fistulas, anal fistulas, and rectal stricture or elephantiasis of the genitalia.7-9 C. trachomatis culture is certainly the gold standard for LGV diagnosis. Other diagnostic test such as the microimmun of luorescence test, complement fixation test and enzyme linked immunosorbent assay for C. trachomatis are sensitive and specific. However PCR-RFLP assay have been shown to be the far superior test if available.10 According to the data released by the National Center for Sex Transmitted Disease (STD) Control and Prevention (CDC, China), in the last few years, approximately 400 cases of LGV have been reported in China annually. Most of these cases reported were diagnosed clinically. Biopsy examinations were performed in few cases. Moreover, pathology examination was not carried out to confirm the suspected diagnosis of LGV. In this patient, C. trachomatis culture, PCR-RFLP assay as well as gene sequencing were used to type C. trachomatis, and confirmed the first case infected by C. trachomatis serovar L3 in China. This has reminded us that we should pay more attention to the LGV caused by C. trachomatis serovar L3 in China.