Portal de Periódicos da CAPES

Sambucus nigra subsp. caerulea and Malva spp.: Newly Identified Hosts of Cherry rasp leaf virus

2015; American Phytopathological Society; Volume: 100; Issue: 4 Linguagem: Inglês

10.1094/pdis-10-15-1197-pdn

1943-7692

D. E. V. Villamor, Kenneth C. Eastwell,

Plant Disease Resistance and Genetics

HomePlant DiseaseVol. 100, No. 4Sambucus nigra subsp. caerulea and Malva spp.: Newly Identified Hosts of Cherry rasp leaf virus PreviousNext DISEASE NOTES OPENOpen Access licenseSambucus nigra subsp. caerulea and Malva spp.: Newly Identified Hosts of Cherry rasp leaf virusD. E. V. Villamor and K. C. EastwellD. E. V. Villamor and K. C. EastwellAffiliationsAuthors and Affiliations D. E. V. Villamor K. C. Eastwell , Department of Plant Pathology, Washington State University, Prosser, WA 99350. Published Online:10 Feb 2016https://doi.org/10.1094/PDIS-10-15-1197-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Within the perimeter of a sweet cherry orchard in Chelan County, Washington State, elderberry (Sambucus nigra L. subsp. caerulea (Raf.) R. Bolli) exhibiting chlorotic ring patterns, leaf blotch, and leaf deformations were observed. The orchard has a large proportion of trees affected by cherry rasp leaf disease; a visual estimate suggested an incidence as high as 30%. Cherry rasp leaf disease in North America is caused by the nematode-transmitted Cherry rasp leaf virus (CRLV), genus Cheravirus. Since CRLV has a wide host range, three symptomatic elderberry plants (designated 9234-1 to 9234-3) were tested for this virus. In addition, leaf samples from five weed samples, all belonging to Malva spp., were randomly sampled and five symptomatic trees within the orchard were collected: two samples (9656-1 and 9656-4) had enations typical of CRLV infection; two samples had a combination of enations and chlorotic flame patterns and ringspots (9656-5 and 9656-6), and one sample had chlorotic flame patterns and ringspots (sample 9656-7) only. Results of RT-PCR using primers CRLV JQ3D3FF (James et al. 2001) and CRLV 3185c (CACTAGGAAAGCTAAAACGA; Eastwell, unpublished) revealed a 546-nt CRLV-specific amplicon in all elderberry and sweet cherry samples but only in three Malva spp. samples. CRLV amplicons derived from two elderberries (9234-2 and 9234-3), three sweet cherries (samples 9656-3, -4, and -5), one Malva. sp. sample shared >99% nt identities to each other but only 91 and 83% nt identities to the flat apple (CRLV-FA, GenBank Accession No. AY764390) and potato (CRLV-pot, GenBank Accession No. NC_006271) isolates of CRLV, respectively. These results suggest that the symptomatic elderberries, sweet cherries, and Malva sp. are infected by the same variants of CRLV. To obtain additional sequence information of CRLV from elderberry, total RNA from elderberry 9234-3 was subjected to high-throughput sequencing (HTS) using Illumina HiSEquation 2000, and contigs were assembled without host subtraction and analyzed as described previously (Villamor et al. 2015). BLASTn and BLASTx analyses revealed contigs of 6,872 nts (Accession No. KT944021) and 3,196 nts (KT944022) that shared highest identities of 91% to RNA1 and 90% to RNA2 of CRLV-FA, respectively. Symptomatic elderberry 9234-3 and one CRLV RT-PCR positive Malva sample were tested by enzyme-linked immunosorbent assays (ELISA) with CRLV-specific antibodies (AC Diagnostics, Fayetteville, AR, respectively); all samples were positive. This is the first report of CRLV infection in elderberry and Malva spp. Elderberries are part of the native vegetation in higher elevations of eastern Washington State, and are frequently found in the perimeters of many cherry orchards. Malva spp. are found within many cherry orchards. Taken together, these species could act as potential reservoirs of CRLV and play an essential component in the management of the virus in cherry production areas. Additional analysis of the high-throughput sequencing results from elderberry 9234-3 also revealed 33 contigs with significant matches to the recently reported Elderberry carlavirus C (KJ572562.1; Ho and Tzanetakis 2014) whereas 1 contig (3,844 nts) matched Elderberry latent virus (NC_026239), an unassigned member of the Tombusviridae.References:Ho, T., and Tzanetakis, I. E. 2014. Virology 471:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarJames, D., et al. 2001. Plant Dis. 85:47. https://doi.org/10.1094/PDIS.2001.85.1.47 Link, ISI, Google ScholarVillamor, D. E. V., et al. 2015. Phytopathology 105:399. https://doi.org/10.1094/PHYTO-03-14-0066-R Link, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 4 April 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 23 Mar 2016Published: 10 Feb 2016First Look: 17 Nov 2015Accepted: 10 Nov 2015 Pages: 867-867 Information© 2016 The American Phytopathological SocietyCited byCherry rasp leaf virus (cherry rasp leaf)CABI Compendium, Vol. CABI CompendiumTowards the Forest Virome: High-Throughput Sequencing Drastically Expands Our Understanding on Virosphere in Temperate Forest Ecosystems14 August 2021 | Microorganisms, Vol. 9, No. 8Biological properties and genomic sequence of an isolate of cherry rasp leaf virus from tomato24 February 2020 | Journal of Plant Pathology, Vol. 102, No. 3Malva parviflora (Cheese weed mallow)6 June 2020Malva sylvestris (Common mallow)6 June 2020Sambucus spp. (Elderberry)6 June 2020Molecular characterization of a novel Aureusvirus infecting elderberry (Sambucus nigra L.)16 August 2018 | PLOS ONE, Vol. 13, No. 8DETECTION OF THE PATHOGEN OF VIRAL DISEASE IN SAMBUCUS NIGRA PLANTS1 January 2016 | Bulletin of Taras Shevchenko National University of Kyiv. Series: Biology, Vol. 72, No. 2