Portal de Periódicos da CAPES

Glucosylated cholesterol in mammalian cells and tissues: formation and degradation by multiple cellular β-glucosidases

2016; Elsevier BV; Volume: 57; Issue: 3 Linguagem: Inglês

10.1194/jlr.m064923

1539-7262

André R. A. Marques, Mina Mirzaian, Hisako Akiyama, Patrick Wisse, Maria J. Ferraz, Paulo Gaspar, Karen Ghauharali‐van der Vlugt, Rianne Meijer, Pilar Giraldo, Pilar Alfonso, Pilar Irún, Maria Dahl, Stefan Karlsson, Elena Pavlova, Timothy M. Cox, Saskia Scheij, Marri Verhoek, Roelof Ottenhoff, CindyP.A.A. van Roomen, N.S. Pannu, Marco van Eijk, Nick Dekker, Rolf G. Boot, Herman S. Overkleeft, Edward F. C. Blommaart, Yoshio Hirabayashi, Johannes M. F. G. Aerts,

Sphingolipid Metabolism and Signaling

The membrane lipid glucosylceramide (GlcCer) is continuously formed and degraded. Cells express two GlcCer-degrading β-glucosidases, glucocerebrosidase (GBA) and GBA2, located in and outside the lysosome, respectively. Here we demonstrate that through transglucosylation both GBA and GBA2 are able to catalyze in vitro the transfer of glucosyl-moieties from GlcCer to cholesterol, and vice versa. Furthermore, the natural occurrence of 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mouse tissues and human plasma is demonstrated using LC-MS/MS and 13C6-labeled GlcChol as internal standard. In cells, the inhibition of GBA increases GlcChol, whereas inhibition of GBA2 decreases glucosylated sterol. Similarly, in GBA2-deficient mice, GlcChol is reduced. Depletion of GlcCer by inhibition of GlcCer synthase decreases GlcChol in cells and likewise in plasma of inhibitor-treated Gaucher disease patients. In tissues of mice with Niemann-Pick type C disease, a condition characterized by intralysosomal accumulation of cholesterol, marked elevations in GlcChol occur as well. When lysosomal accumulation of cholesterol is induced in cultured cells, GlcChol is formed via lysosomal GBA. This illustrates that reversible transglucosylation reactions are highly dependent on local availability of suitable acceptors. In conclusion, mammalian tissues contain GlcChol formed by transglucosylation through β-glucosidases using GlcCer as donor. Our findings reveal a novel metabolic function for GlcCer. The membrane lipid glucosylceramide (GlcCer) is continuously formed and degraded. Cells express two GlcCer-degrading β-glucosidases, glucocerebrosidase (GBA) and GBA2, located in and outside the lysosome, respectively. Here we demonstrate that through transglucosylation both GBA and GBA2 are able to catalyze in vitro the transfer of glucosyl-moieties from GlcCer to cholesterol, and vice versa. Furthermore, the natural occurrence of 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mouse tissues and human plasma is demonstrated using LC-MS/MS and 13C6-labeled GlcChol as internal standard. In cells, the inhibition of GBA increases GlcChol, whereas inhibition of GBA2 decreases glucosylated sterol. Similarly, in GBA2-deficient mice, GlcChol is reduced. Depletion of GlcCer by inhibition of GlcCer synthase decreases GlcChol in cells and likewise in plasma of inhibitor-treated Gaucher disease patients. In tissues of mice with Niemann-Pick type C disease, a condition characterized by intralysosomal accumulation of cholesterol, marked elevations in GlcChol occur as well. When lysosomal accumulation of cholesterol is induced in cultured cells, GlcChol is formed via lysosomal GBA. This illustrates that reversible transglucosylation reactions are highly dependent on local availability of suitable acceptors. In conclusion, mammalian tissues contain GlcChol formed by transglucosylation through β-glucosidases using GlcCer as donor. Our findings reveal a novel metabolic function for GlcCer. Membranes of higher eukaryotic cells contain glycerolipids, sterols, and sphingolipids. For each of these lipid classes, monoglucosylated structures have been reported. Glucosylceramide (GlcCer), the intermediate in biosynthesis and degradation of more complex glycosphingolipids (GSLs), is ubiquitous in mammalian cells, particularly located in the cell membrane (1Wennekes T. van den Berg R.J. Boot R.G. van der Marel G.A. Overkleeft H.S. Aerts J.M. Glycosphingolipids-nature, function, and pharmacological modulation.Angew. Chem. Int. Ed. Engl. 2009; 48: 8848-8869Crossref PubMed Scopus (237) Google Scholar). Its presence in plants and some fungi is also documented. Glucosyldiacylglycerol has been identified in various plants, but its presence in mammalian cells is comparatively poorly documented (2Pata M.O. Hannun Y.A. Ng C.K-Y. Plant sphingolipids: decoding the enigma of the Sphinx.New Phytol. 2010; 185: 611-630Crossref PubMed Scopus (156) Google Scholar, 3Wu W. Narasaki R. Maeda F. Hasumi K. Glucosyl­diacylglycerol enhances reciprocal activation of prourokinase and plasminogen.Biosci. Biotechnol. Biochem. 2004; 68: 1549-1556Crossref PubMed Scopus (10) Google Scholar). Likewise, sterol-glucosides are known to occur in plants and fungal species (4Grille S. Zaslawski A. Thiele S. Plat J. Warnecke D. The functions of steryl glycosides come to those who wait: Recent advances in plants, fungi, bacteria and animals.Prog. Lipid Res. 2010; 49: 262-288Crossref PubMed Scopus (125) Google Scholar), but their existence in mammalian cells has not been extensively studied. Indications of the existence of glucosyl-β-D-cholesterol or 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mammalian cells were first provided by Murofushi and coworkers (5Kunimoto S. Kobayashi T. Kobayashi S. Murakami-Murofushi K. Expression of cholesteryl glucoside by heat shock in human fibroblasts.Cell Stress Chaperones. 2000; 5: 3-7Crossref PubMed Scopus (49) Google Scholar, 6Kunimoto S. Murofushi W. Yamatsu I. Hasegawa Y. Sasaki N. Kobayashi S. Kobayashi T. Murofushi H. Murakami-Murofushi K. Cholesteryl glucoside-induced protection against gastric ulcer.Cell Struct. Funct. 2003; 28: 179-186Crossref PubMed Scopus (24) Google Scholar). They described its occurrence in cultured human fibroblasts and gastric mucosa (5Kunimoto S. Kobayashi T. Kobayashi S. Murakami-Murofushi K. Expression of cholesteryl glucoside by heat shock in human fibroblasts.Cell Stress Chaperones. 2000; 5: 3-7Crossref PubMed Scopus (49) Google Scholar, 6Kunimoto S. Murofushi W. Yamatsu I. Hasegawa Y. Sasaki N. Kobayashi S. Kobayashi T. Murofushi H. Murakami-Murofushi K. Cholesteryl glucoside-induced protection against gastric ulcer.Cell Struct. Funct. 2003; 28: 179-186Crossref PubMed Scopus (24) Google Scholar). Heat shock was found to increase biosynthesis of GlcChol and, subsequently, induce HSP70 (7Kunimoto S. Murofushi W. Kai H. Ishida Y. Uchiyama A. Kobayashi T. Kobayashi S. Murofushi H. Murakami-Murofushi K. Steryl glucoside is a lipid mediator in stress-responsive signal transduction.Cell Struct. Funct. 2002; 27: 157-162Crossref PubMed Scopus (66) Google Scholar). GlcCer is formed by the enzyme GlcCer synthase (GCS, EC2.4.1.80). This transferase, first cloned by Hirabayashi and colleagues (8Ichikawa S. Sakiyama H. Suzuki G. Hidari K.I. Hirabayashi Y. Expression cloning of a cDNA for human ceramide glucosyltransferase that catalyzes the first glycosylation step of glycosphingolipid synthesis.Proc. Natl. Acad. Sci. USA. 1996; 93: 12654Crossref PubMed Scopus (220) Google Scholar), is located at the cytosolic leaflet of the Golgi apparatus where it transfers the glucose-moiety from UDP-glucose to ceramide (9van Meer G. Wolthoorn J. Degroote S. The fate and function of glycosphingolipid glucosylceramide.Philos. Trans. R. Soc. Lond. B Biol. Sci. 2003; 358: 869-873Crossref PubMed Scopus (52) Google Scholar). In a recent study, Akiyama et al. (10Akiyama H. Sasaki N. Hanazawa S. Gotoh M. Kobayashi S. Hirabayashi Y. Murakami-Murofushi K. Novel sterol glucosyltransferase in the animal tissue and cultured cells: evidence that glucosylceramide as glucose donor.Biochim. Biophys. Acta. 2011; 1811: 314-322Crossref PubMed Scopus (20) Google Scholar) showed that GCS does not synthesize GlcChol. They noticed that GM-95 cells deficient in GCS are unable to synthesize GlcChol without the addition of exogenous GlcCer. Furthermore, the same researchers demonstrated that, at least in vitro, the lysosomal enzyme glucocerebrosidase (GBA; E.C.3.2.1.45) generates, through transglucosylation, 25-[N-[(7-nitro-2-1,3-benzoxadiazol-4-yl) methyl] amino]-27-norcholesterol (25-NBD-cholesterol)-glucoside from GlcCer and artificial 25-NBD-cholesterol (11Akiyama H. Kobayashi S. Hirabayashi Y. Murakami-Murofushi K. Cholesterol glucosylation is catalyzed by transglucosylation reaction of β-glucosidase 1.Biochem. Biophys. Res. Commun. 2013; 441: 838-843Crossref PubMed Scopus (50) Google Scholar). Such ability of GBA to perform transglucosylation was earlier demonstrated by Glew and coworkers, showing catalyzed transfer of the glucose moiety from 4-methylumbelliferyl-β-glucoside to retinol and other alcohols (12Vanderjagt D.J. Fry D.E. Glew R.H. Human glucocerebrosidase catalyses transglucosylation between glucocerebroside and retinol.Biochem. J. 1994; 300: 309-315Crossref PubMed Scopus (21) Google Scholar). The enzyme GBA is well-studied because its deficiency underlies Gaucher disease (GD), a relatively common lysosomal storage disease (13Beutler E. Grabowski G.A. et al.Gaucher Disease.in: Scriver C.R. Beadet A.L. Sly W.S. In The Metabolic and Molecular Bases of Inherited Disease. 7th edition. McGraw-Hill, New York1995: 2641-2670Google Scholar). Assisted by the small activator protein, saposin C, GBA degrades GlcCer to ceramide and glucose in lysosomes, the penultimate step in GSL catabolism (13Beutler E. Grabowski G.A. et al.Gaucher Disease.in: Scriver C.R. Beadet A.L. Sly W.S. In The Metabolic and Molecular Bases of Inherited Disease. 7th edition. McGraw-Hill, New York1995: 2641-2670Google Scholar). Deficient GBA activity in GD patients consequently results in accumulation of GlcCer in lysosomes, most prominently in macrophages. These "Gaucher cells" secrete specific proteins, as well as glucosylsphingosine (GlcSph), the deacylated form of GlcCer (14Ferraz M.J. Kallemeijn W.W. Mirzaian M. Herrera Moro D. Marques A. Wisse P. Boot R.G. Willems L.I. Overkleeft H.S. Aerts J.M. Gaucher disease and Fabry disease: new markers and insights in pathophysiology for two distinct glycosphingolipidoses.Biochim. Biophys. Acta. 2014; 1841: 811-825Crossref PubMed Scopus (82) Google Scholar, 15Dekker N. van Dussen L. Hollak C.E.M. Overkleeft H. Scheij S. Ghauharali K. van Breemen M.J. Ferraz M.J. Groener J.E.M. Maas M. et al.Elevated plasma glucosylsphingosine in Gaucher disease: relation to phenotype, storage cell markers, and therapeutic response.Blood. 2011; 118: e118-e127Crossref PubMed Scopus (184) Google Scholar, 16Rolfs A. Giese A-K. Grittner U. Mascher D. Elstein D. Zimran A. Böttcher T. Lukas J. Hübner R. Gölnitz U. et al.Glucosylsphingosine is a highly sensitive and specific biomarker for primary diagnostic and follow-up monitoring in Gaucher disease in a non-Jewish, Caucasian cohort of Gaucher disease patients.PLoS One. 2013; 8: e79732Crossref PubMed Scopus (122) Google Scholar). The non-neuronopathic (type 1) variant of GD is presently treated by enzyme replacement therapy (ERT), implying chronic twice-weekly intravenous infusion of macrophage-targeted recombinant enzyme (17Barton N.W. Brady R.O. Dambrosia J.M. Di Bisceglie A.M. Doppelt S.H. Hill S.C. Mankin H.J. Murray G.J. Parker R.I. Argoff C.E. Replacement therapy for inherited enzyme deficiency–macrophage-targeted glucocerebrosidase for Gaucher's disease.N. Engl. J. Med. 1991; 324: 1464-1470Crossref PubMed Scopus (1115) Google Scholar). An alternative treatment of type 1 GD, named substrate reduction, is based on oral administration of an inhibitor of GCS (18Cox T. Lachmann R. Hollak C. Aerts J. van Weely S. Hrebícek M. Platt F. Butters T. Dwek R. Moyses C. et al.Novel oral treatment of Gaucher's disease with N-butyldeoxynojirimycin (OGT 918) to decrease substrate biosynthesis.Lancet. 2000; 355: 1481-1485Abstract Full Text Full Text PDF PubMed Scopus (676) Google Scholar, 19Cox T.M. Drelichman G. Cravo R. Balwani M. Burrow T.A. Martins A.M. Lukina E. Rosenbloom B. Ross L. Angell J. et al.Eliglustat compared with imiglucerase in patients with Gaucher's disease type 1 stabilised on enzyme replacement therapy: a phase 3, randomised, open-label, non-inferiority trial.Lancet. 2015; 385: 2355-2362Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 20Hughes D.A. Pastores G.M. Eliglustat for Gaucher's disease: trippingly on the tongue.Lancet. 2015; 385: 2328-2330Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar). Mammalian cells and tissues contain other β-glucosidases besides GBA that degrade GlcCer. All cells express the membrane-associated nonlysosomal glucosylceramidase, named GBA2 (21van Weely S. Brandsma M. Strijland A. Tager J.M. Aerts J.M. Demonstration of the existence of a second, non-lysosomal glucocerebrosidase that is not deficient in Gaucher disease.Biochim. Biophys. Acta. 1993; 1181: 55-62Crossref PubMed Scopus (108) Google Scholar, 22Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. Mutation of beta-glucosidase 2 causes glycolipid storage disease and impaired male fertility.J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar, 23Boot R.G. Verhoek M. Donker-Koopman W. Strijland A. van Marle J. Overkleeft H.S. Wennekes T. Aerts J.M.F.G. Identification of the non-lysosomal glucosylceramidase as beta-glucosidase 2.J. Biol. Chem. 2007; 282: 1305-1312Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). This enzyme is not deficient in GD patients. In fact, a compensatory overexpression of GBA2 in materials of GD has been reported (24Burke D.G. Rahim A.A. Waddington S.N. Karlsson S. Enquist I. Bhatia K. Mehta A. Vellodi A. Heales S. Increased glucocerebrosidase (GBA) 2 activity in GBA1 deficient mice brains and in Gaucher leucocytes.J. Inherit. Metab. Dis. 2013; 36: 869-872Crossref PubMed Scopus (22) Google Scholar). GBA2 has been found to be located outside lysosomes, being noted at the endoplasmic reticulum in hepatocytes (22Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. Mutation of beta-glucosidase 2 causes glycolipid storage disease and impaired male fertility.J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar), at the endoplasmic reticulum and Golgi apparatus in HEK293 cells overexpressing enzyme (25Körschen H.G. Yildiz Y. Raju D.N. Schonauer S. Bönigk W. Jansen V. Kremmer E. Kaupp U.B. Wachten D. The non-lysosomal beta-glucosidase GBA2 is a non-integral membrane-associated protein at the ER and Golgi.J. Biol. Chem. 2013; 288: 3381-3393Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), and at the endosomes in fibroblasts and COS-7 cells (23Boot R.G. Verhoek M. Donker-Koopman W. Strijland A. van Marle J. Overkleeft H.S. Wennekes T. Aerts J.M.F.G. Identification of the non-lysosomal glucosylceramidase as beta-glucosidase 2.J. Biol. Chem. 2007; 282: 1305-1312Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). GBA2 degrades GlcCer without need for an activator protein, and further differs from GBA in noted artificial substrate and inhibitor specificity (21van Weely S. Brandsma M. Strijland A. Tager J.M. Aerts J.M. Demonstration of the existence of a second, non-lysosomal glucocerebrosidase that is not deficient in Gaucher disease.Biochim. Biophys. Acta. 1993; 1181: 55-62Crossref PubMed Scopus (108) Google Scholar). Finally, some tissues express the enzyme GBA3, also referred to as broad-specific cytosolic β-glucosidase (26Dekker N. Voorn-Brouwer T. Verhoek M. Wennekes T. Narayan R.S. Speijer D. Hollak C.E.M. Overkleeft H.S. Boot R.G. Aerts J.M.F.G. The cytosolic β-glucosidase GBA3 does not influence type 1 Gaucher disease manifestation.Blood Cells Mol. Dis. 2011; 46: 19-26Crossref PubMed Scopus (46) Google Scholar). This enzyme shows relatively poor in vitro hydrolytic activity toward GlcCer and is thought to be primarily involved in detoxification of glucosylated xenobiotics (26Dekker N. Voorn-Brouwer T. Verhoek M. Wennekes T. Narayan R.S. Speijer D. Hollak C.E.M. Overkleeft H.S. Boot R.G. Aerts J.M.F.G. The cytosolic β-glucosidase GBA3 does not influence type 1 Gaucher disease manifestation.Blood Cells Mol. Dis. 2011; 46: 19-26Crossref PubMed Scopus (46) Google Scholar). All three human retaining β-glucosidases employ the double displacement mechanism in catalysis. There are many documented examples of transglucosylation mediated by retaining glycosidases (27Kittl R. Withers S.G. New approaches to enzymatic glycoside synthesis through directed evolution.Carbohydr. Res. 2010; 345: 1272-1279Crossref PubMed Scopus (49) Google Scholar). Therefore, theoretically, in addition to GBA, GBA2 and GBA3 might also generate GlcChol. Modification of cholesterol by glucosylation changes the physicochemical properties of the sterol, rendering it far more water soluble. Given the potential physiological relevance, the natural occurrence of GlcChol and its metabolism in cells and tissues are of interest. We therefore studied the existence of the glucosylated sterol in mammalian tissues. For this purpose 13C6-isotope-labeled GlcChol was synthesized to be used as internal standard in sensitive quantitative detection of GlcChol by LC-MS/MS. Here we demonstrate the natural occurrence of GlcChol in mammalian cells and tissues. Moreover, we document the ability of both GBA and GBA2 to degrade, as well as synthesize, GlcChol. The importance of substrate and acceptor concentrations regarding the action of GBA and GBA2 in GlcChol metabolism is experimentally demonstrated. Our investigation demonstrates the surprising versatility of β-glucosidases, a finding discussed in relation to metabolism of sphingolipids and sterols in health and disease. The 25-NBD-cholesterol, N-[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]D-glucosyl-β1-1′-sphingosine (C6-NBD-GlcCer), N-[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]D-erythro-sphingosine (C6-NBD-Cer), D-glucosyl-β-1,1′ N-palmitoyl-D-erythro-sphingosine (C16:0-GlcCer), and D-glucosyl-β-1,1′N-oleoyl-D-erythro-sphingosine (C18:1-GlcCer) were purchased from Avanti Polar Lipids (Alabaster, AL). The 4-methylumbelliferyl β-D-glucopyranoside (4MU-Glc) was purchased from Glycosynth™ (Winwick Quay Warrington, Cheshire, UK). Conduritol B epoxide (CBE; D,L-1,2-anhydro-myo-inositol;) was from Enzo Life Sciences Inc. (Farmingdale, NY), GlcChol (β-cholesteryl glucoside, β-GlcChol) and ammonium formate (LC-MS quality) were from Sigma-Aldrich (St. Louis, MO). N-(n-butyl)deoxygalactonojirimycin (NB-DGJ) was purchased from Toronto Research Chemicals (Toronto, Canada). GBA2 inhibitor, N-(5-adamantane-1-yl-methoxy-pentyl)-deoxynojirimycin (AMP-DNM), and GBA3 inhi­bitor, α-1-C-nonyl-DIX (anDIX), were chemically synthesized in the department of Bio-organic Synthesis at the Faculty of Science, Leiden Institute of Chemistry at the University of Leiden (Leiden, The Netherlands). Cerezyme®, a recombinant human GBA (rGBA), was obtained from Genzyme (Genzyme Nederland, Naarden, The Netherlands). Cholesterol trafficking inhibitor, U18666A, and methyl-β-cyclodextrin were from Sigma-Aldrich Chemie GmbH. LC-MS-grade methanol, 2-propanol, water, and HPLC-grade chloroform were purchased from Biosolve, and ammonium formate (LC-MS grade) from Sigma-Aldrich Chemie GmbH. The synthesis of 13C-labeled glucosyl donor 4 (see Scheme 1) commences with protecting the five hydroxyls in glucose 1 as the benzoyl esters using pyridine and benzoyl chloride to give 1,2,3,4,6-penta-O-benzoyl-β-D-13C6-glucopyranoside 2 quantitatively. In the next step the anomeric benzoate was selectively removed using hydrazine acetate providing 2,3,4,6-tetra-O-benzoyl-α/β-D-13C6-glucopyranoside 3 in 82% yield. The anomeric hydroxyl in 3 was transformed into the corresponding trichloroacetimidate using trichloroacetonitrile and 1,8-diazabicyclo[5.4.0]undec-7-ene as base, giving 2,3,4,6-tetra-O-benzoyl-1-(2,2,2-trichloroethanimidate)-α-D-13C6-glucopyranoside 4. In the penultimate step, cholesterol was reacted with 4 under the agency of a catalytic amount of trimethylsilylmethanesulphonate in dichloromethane at room temperature. After 1 h, the reaction was quenched with triethylamine and the mixture purified by silica gel column chromatography giving cholesteryl 2,3,4,6-tetra-O-benzoyl-β-D-13C6-glucopyranoside 5 in 83%. Compound 5 was deprotected using sodium methoxide in methanol/dichloromethane giving, after silica gel column chromatography, the title compound, cholesteryl-β-D-13C6-glucopyranoside (13C6-GlcChol) 6 as a white solid in 94%. Scheme 1. Synthesis of 13C6-GlcChol 6 (28). Npc1−/− mice (Npc1nih and Npc1spm), along with WT littermates (Npc1+/+), were generated by crossing Npc1+/− males and females in-house. The heterozygous BALB/c Nctr-Npc1m1N/J mice (stock number 003092) and heterozygous C57BLKS/J-Npc1spm/J (stock number 002760) were obtained from the Jackson Laboratory (Bar Harbor, ME). Mouse pups were genotyped according to published protocols (29Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. et al.Murine model of Niemann-Pick C disease: mutation in a cholesterol homeostasis gene.Science. 1997; 277: 232-235Crossref PubMed Scopus (698) Google Scholar, 30Miyawaki S. Yoshida H. Mitsuoka S. Enomoto H. Ikehara S. A mouse model for Niemann-Pick disease. Influence of genetic background on disease expression in spm/spm mice.J. Hered. 1986; 77: 379-384Crossref PubMed Scopus (41) Google Scholar). The Gba2−/− mice (C57Bl/6-129S6/SvEv mixed background) were generated as previously described (22Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. Mutation of beta-glucosidase 2 causes glycolipid storage disease and impaired male fertility.J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar). Breeding pairs of LIMP-2 were kindly provided by Prof. Paul Saftig (Kiel, Germany) (31Gamp A-C. Tanaka Y. Lüllmann-Rauch R. Wittke D. D'Hooge R. De Deyn P.P. Moser T. Maier H. Hartmann D. Reiss K. et al.LIMP-2/LGP85 deficiency causes ureteric pelvic junction obstruction, deafness and peripheral neuropathy in mice.Hum. Mol. Genet. 2003; 12: 631-646Crossref PubMed Scopus (98) Google Scholar). Homozygous WT animals (LIMP2+/+) and homozygous animals (LIMP2−/−) were generated by crossing heterozygous (LIMP2+/−) mice. Genotyping was determined by PCR using genomic DNA (31Gamp A-C. Tanaka Y. Lüllmann-Rauch R. Wittke D. D'Hooge R. De Deyn P.P. Moser T. Maier H. Hartmann D. Reiss K. et al.LIMP-2/LGP85 deficiency causes ureteric pelvic junction obstruction, deafness and peripheral neuropathy in mice.Hum. Mol. Genet. 2003; 12: 631-646Crossref PubMed Scopus (98) Google Scholar). Mice (±3 weeks old) received the rodent AM-II diet (Arie Blok Diervoeders, Woerden, The Netherlands). The mice were housed at the Institute Animal Core Facility in a temperature- and humidity-controlled room with a 12 h light/dark cycle and given access to food and water ad libitum. All animal protocols were approved by the Institutional Animal Welfare Committee of the Academic Medical Centre Amsterdam in the Netherlands (DBC101698, DBC100757-115, DBC100757-125, and DBC17AC) The generation of the GD1 mouse model has been described previously (32Dahl M. Doyle A. Olsson K. Månsson J-E. Marques A.R.A. Mirzaian M. Aerts J.M. Ehinger M. Rothe M. Modlich U. et al.Lentiviral gene therapy using cellular promoters cures type 1 Gaucher disease in mice.Mol. Ther. 2015; 23: 835-844Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 33Enquist I.B. Nilsson E. Ooka A. Månsson J-E. Olsson K. Ehinger M. Brady R.O. Richter J. Karlsson S. Effective cell and gene therapy in a murine model of Gaucher disease.Proc. Natl. Acad. Sci. USA. 2006; 103: 13819-13824Crossref PubMed Scopus (97) Google Scholar). Mice were maintained in individually ventilated cages with ad libitum food and water in the animal facility at Lund University Biomedical Center. Breeding and experimental procedures were approved by the Committee for Animal Ethics in Malmö/Lund, Sweden. Animals were first anesthetized with a dose of Hypnorm (0.315 mg/ml phenyl citrate and 10 mg/ml fluanisone) and Dormicum (5 mg/ml midazolam) according to their weight. The given dose was 80 μl/10 g bodyweight. Animals were euthanized by cervical dislocation. Organs were collected by surgery, rinsed with PBS, directly snap-frozen in liquid nitrogen, and stored at −80°C. Later, homogenates were made from the frozen material in 25 mM potassium phosphate buffer (pH 6.5), supplemented with 0.1% (v/v) Triton X-100 and protease inhibitors (4 μl of buffer per 1 mg of tissue). The design of cloning primers was based on NCBI reference sequences NM_172692.3 for murine GBA2, NM_020973.3 for human hGBA3, and NM_003358.2 for human UGCG (GCS). Using the primers listed below, the full-length coding sequences were cloned into pcDNA3.1/Myc-His (Invitrogen, Life Technologies, Carlsbad, CA), using primers: RB143, GAATTCGCCGCCACC­ATGGTAACCTGCGTCCCGG and RB144, GCGGCCGCTCTG­AATTGAGGTTTGCCAG for mGBA2; RB252, GAATTCGCCGCCACCATGGCTTTCCCTGCAGGATTTG and RB253, GCGGCCGCTACAGATGTGCTTCAAGGCC for hGBA3; RB111, TCCTGCGGGAGCGTTGTC and RB114, GGTACCTACATCTAGGA­TTTCCTCTGC for hUCGC. These constructs were used to transfect COS-7 cells. For the transfection of Chinese hamster ovary cells (CHO-K1 cells), the full-length coding sequence for transcript variant 1 of human GBA3 (NM_020973.3) was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) as described previously (11Akiyama H. Kobayashi S. Hirabayashi Y. Murakami-Murofushi K. Cholesterol glucosylation is catalyzed by transglucosylation reaction of β-glucosidase 1.Biochem. Biophys. Res. Commun. 2013; 441: 838-843Crossref PubMed Scopus (50) Google Scholar). RAW264.7 cells were obtained from the American Type Culture Collection and were cultured in DMEM (Life Technologies, Carlsbad, CA) supplemented with 10% FBS (Bodinco, Alkmaar, The Netherlands) with penicillin/streptomycin (Life Technologies). COS-7 cells were cultured in Iscove's modified Dulbecco's medium with 5% FBS and penicillin/streptomycin under 5% CO2 at 37°C. Cells were seeded at 75% confluence in 6-well plates and transfected using FuGENE® 6 transfection reagent (Promega Benelux, Leiden, The Netherlands) according to the manufacturer's instructions, at a FuGENE:DNA ratio of 3:1. After 24 h, inhibitors of GBA (CBE, 300 μM) or GBA2 (AMP-DNM, 20 nM) were added and 48 h later, the medium was removed, cells were washed three times with ice-cold PBS and harvested by scraping in 25 mM potassium-phosphate buffer (pH 6.5). CHO-K1 cells (RCB0285, established by T. T. Puck) were purchased from RIKEN BioResource Center (Ibaraki, Japan) and cultured in Ham's F-12 medium (Nissui) supplemented with 10% FBS under 5% CO2 at 37°C. cDNA transfection for CHO-K1 cells was carried out using Lipofectamine® 2000 transfection reagent (Life Technologies) according to the manufacturer's instructions. After 24 h, medium containing transfection reagents was removed and cells were incubated with lysis buffer [50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 tablet/10 ml Complete Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland) (pH 7.4)] for 15–30 min at 4°C after washing with PBS. The cells were harvested and centrifuged at 12,000 g for 10 min at 4°C. The obtained supernatants were collected for in vitro enzyme assays. Lysates of COS-7 cells overexpressing GBA2, GBA3, GCS, and rGBA were used to determine transglucosylase activity of each enzyme. The assay was performed as described earlier (11Akiyama H. Kobayashi S. Hirabayashi Y. Murakami-Murofushi K. Cholesterol glucosylation is catalyzed by transglucosylation reaction of β-glucosidase 1.Biochem. Biophys. Res. Commun. 2013; 441: 838-843Crossref PubMed Scopus (50) Google Scholar) with a few modifications. First, 40 μl of homogenate of cells overexpressing GBA2, GBA3, or GCS was preincubated with 10 μl of 25 mM CBE in water for 20 min (samples containing diluted rGBA were preincubated in the absence of CBE). To each of the samples, 200 μl of the appropriate buffer containing 100 μM of donor (either C18:1-GlcCer or GlcChol) and 40 μM of acceptor (either 25-NBD-cholesterol or C6-NBD-Cer) were added. Transglucosylase activity of GBA2-overexpressing cells was measured in a 150 mM McIlvaine buffer (pH 5.8) and the assay for rGBA was done in a 150 mM McIlvaine buffer (pH 5.2) containing 0.1% BSA, 0.1% Triton X-100, and 0.2% sodium taurocholate. For GBA3, the assay contained 100 mM HEPES buffer (pH 7.0). The transglucosylase assay for GCS was performed in a 125 mM potassium-phosphate buffer (pH 7.5) with 12.5 mM UDP-glucose, 6.25 mM MgCl2, 0.125% BSA, and 0.625% CHAPS. After 1 h of incubation at 37°C, the reaction was terminated by addition of chloroform/methanol (1:1, v/v) and lipids were extracted according to Bligh and Dyer (34Bligh E.G. Dyer W.J. A rapid method of total lipid extraction and purification.Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (42799) Google Scholar). Thereafter, lipids were separated by TLC on HPTLC silica gel 60 plates (Merck, Darmstadt, Germany) using chloroform/methanol (85:15, v/v) as eluent followed by detection of NBD-labeled lipids using a Typhoon variable mode imager (GE Healthcare Bio-Science Corp., Piscataway, NJ) (35Van Weely S. Van Leeuwen M.B. Jansen I.D. De Bruijn M.A. Brouwer-Kelder E.M. Schram A.W. Sa Miranda M.C. Barranger J.A. Petersen E.M. Goldblatt J. et al.Clinical phenotype of Gaucher disease in relation to properties of mutant glucocerebrosidase in cultured fibroblasts.Biochim. Biophys. Acta. 1991; 1096: 301-311Crossref PubMed Scopus (44) Google Scholar). Identification of newly formed fluorescent lipid in transglucosylation assays with 25-NBD-cholesterol as acceptor was performed following its isolation by scraping from plates by demonstration of complete digestion to NBD-cholesterol using excess rGBA at pH 5.2 (McIlvaine buffer) in the presence of 0.2% (w/v) sodium taurocholate and 0.1% (v/v) Triton X-100. Lysates of CHO-K1 cells were used to access the transglucosylase activity and the β-glucosidase activity of GBA3. The assay for transglucosylase activity was performed according to the method we established previously (11Akiyama H. Kobayashi S. Hir