A Caenorhabditis elegans model for ether lipid biosynthesis and function
2015; Elsevier BV; Volume: 57; Issue: 2 Linguagem: Inglês
10.1194/jlr.m064808
ISSN1539-7262
AutoresXun Shi, Pablo Tarazona, Trisha Brock, John Browse, Ivo Feußner, Jennifer L. Watts,
Tópico(s)Biochemical Acid Research Studies
ResumoEther lipids are widespread in nature, and they are structurally and functionally important components of membranes. The roundworm, Caenorhabditis elegans, synthesizes numerous lipid species containing alkyl and alkenyl ether bonds. We isolated C. elegans strains carrying loss-of-function mutations in three genes encoding the proteins required for the initial three steps in the ether lipid biosynthetic pathway, FARD-1/FAR1, ACL-7/GNPAT, and ADS-1/AGPS. Analysis of the mutant strains show that they lack ether lipids, but possess the ability to alter their lipid composition in response to lack of ether lipids. We found that increases in de novo fatty acid synthesis and reduction of stearoyl- and palmitoyl-CoA desaturase activity, processes that are at least partially regulated transcriptionally, mediate the altered lipid composition in ether lipid-deficient mutants. Phenotypic analysis demonstrated the importance of ether lipids for optimal fertility, lifespan, survival at cold temperatures, and resistance to oxidative stress.Caenorhabditis Ether lipids are widespread in nature, and they are structurally and functionally important components of membranes. The roundworm, Caenorhabditis elegans, synthesizes numerous lipid species containing alkyl and alkenyl ether bonds. We isolated C. elegans strains carrying loss-of-function mutations in three genes encoding the proteins required for the initial three steps in the ether lipid biosynthetic pathway, FARD-1/FAR1, ACL-7/GNPAT, and ADS-1/AGPS. Analysis of the mutant strains show that they lack ether lipids, but possess the ability to alter their lipid composition in response to lack of ether lipids. We found that increases in de novo fatty acid synthesis and reduction of stearoyl- and palmitoyl-CoA desaturase activity, processes that are at least partially regulated transcriptionally, mediate the altered lipid composition in ether lipid-deficient mutants. Phenotypic analysis demonstrated the importance of ether lipids for optimal fertility, lifespan, survival at cold temperatures, and resistance to oxidative stress.Caenorhabditis Cellular membranes are composed of a wide variety of lipid species, including phospholipids, cholesterol, and sphingolipids, which all play multiple roles in establishing a structural permeability barrier for cells and organelles, as well as provide an environment for proteins that participate in catalysis or function as channels and signaling molecules (1.Dowhan W. Molecular genetic approaches to defining lipid function.J. Lipid Res. 2009; 50: S305-S310Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 2.Shevchenko A. Simons K. Lipidomics: coming to grips with lipid diversity.Nat. Rev. Mol. Cell Biol. 2010; 11: 593-598Crossref PubMed Scopus (584) Google Scholar). Most phospholipids consist of hydrophobic fatty acids attached to a hydrophilic phosphoglycerol head group through an ester bond. In contrast, ether-linked phospholipids are characterized by an ether bond connecting long chain fatty alcohols to the phosphoglycerol backbone (3.Snyder F. Lee T.C. Wykle R.L. Ether-linked lipids and their bioactive species.in: Vance D.E. Vance J.E. In Biochemistry of Lipids, Lipoproteins and Membranes. Amsterdam, The Netherlands2002: 233-261Crossref Google Scholar, 4.Fahy E. Subramaniam S. Brown H.A. Glass C.K. Merrill Jr., A.H. Murphy R.C. Raetz C.R. Russell D.W. Seyama Y. Shaw W. et al.A comprehensive classification system for lipids.J. Lipid Res. 2005; 46: 839-861Abstract Full Text Full Text PDF PubMed Scopus (1127) Google Scholar). Two types of glycerol ether bonds exist in nature, alkyl and alkenyl, in which the alkenyl ethers contain a cis double bond adjacent to the oxygen atom, and this class of lipids are also known as plasmalogens. Ether phospholipids ensure optimal cellular functions because their unique structures maintain membrane physical properties, including membrane fluidity, promotion of membrane fusion and contributing to the structure of lipid microdomains, and ability to serve as antioxidants (5.Wallner S. Schmitz G. Plasmalogens the neglected regulatory and scavenging lipid species.Chem. Phys. Lipids. 2011; 164: 573-589Crossref PubMed Scopus (217) Google Scholar). Ether lipids are also required for the proper function of integral membrane proteins and serve as precursors for lipid signaling molecules (6.Braverman N.E. Moser A.B. Functions of plasmalogen lipids in health and disease.Biochim. Biophys. Acta. 2012; 1822: 1442-1452Crossref PubMed Scopus (644) Google Scholar). Ether lipids are widespread in nature; however, the precise mechanisms in which ether lipids contribute to optimal membrane functions are still not clear. The biosynthesis of ether lipids is vital to human health. Deficiencies in the peroxisomally localized ether lipid biosynthetic activities of glyceronephosphate O-acyltransferase (GNPAT) and alkylglycerone phosphate synthetase (AGPS) cause the human disease, rhizomelic chondrodysplasia punctata (RCDP). Babies born with these enzyme deficiencies have craniofacial abnormalities, shortened bones, cataracts, growth and mental deficiencies, and most do not survive beyond childhood (7.Wanders R.J. Waterham H.R. Peroxisomal disorders: the single peroxisomal enzyme deficiencies.Biochim. Biophys. Acta. 2006; 1763: 1707-1720Crossref PubMed Scopus (207) Google Scholar). Recently, families carrying mutations in fatty acyl-CoA reductase (FAR)1 were identified, and these patients exhibit intellectual disability, cataracts, and other deficiencies similar to patients with RCDP (8.Buchert R. Tawamie H. Smith C. Uebe S. Innes A.M. Al Hallak B. Ekici A.B. Sticht H. Schwarze B. Lamont R.E. et al.A peroxisomal disorder of severe intellectual disability, epilepsy, and cataracts due to fatty acyl-CoA reductase 1 deficiency.Am. J. Hum. Genet. 2014; 95: 602-610Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). In addition, there is cumulative evidence for ether lipid deficiency in several other common disease states, including respiratory disease in premature infants and neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, and Neimann-Pick type C disease (6.Braverman N.E. Moser A.B. Functions of plasmalogen lipids in health and disease.Biochim. Biophys. Acta. 2012; 1822: 1442-1452Crossref PubMed Scopus (644) Google Scholar). In contrast, ether lipids are often elevated in human tumors, and the presence of ether lipids in cancer cells makes the tumors more aggressive (9.Roos D.S. Choppin P.W. Tumorigenicity of cell lines with altered lipid composition.Proc. Natl. Acad. Sci. USA. 1984; 81: 7622-7626Crossref PubMed Scopus (46) Google Scholar). A recent study demonstrated the key role of the AGPS enzyme in promoting aggressive tumor growth (10.Benjamin D.I. Cozzo A. Ji X. Roberts L.S. Louie S.M. Mulvihill M.M. Luo K. Nomura D.K. Ether lipid generating enzyme AGPS alters the balance of structural and signaling lipids to fuel cancer pathogenicity.Proc. Natl. Acad. Sci. USA. 2013; 110: 14912-14917Crossref PubMed Scopus (133) Google Scholar). When AGPS was overexpressed, cellular ether lipids accumulated and tumor growth was promoted, while knockdown of AGPS impaired cancer cell survival, migration, and invasion (10.Benjamin D.I. Cozzo A. Ji X. Roberts L.S. Louie S.M. Mulvihill M.M. Luo K. Nomura D.K. Ether lipid generating enzyme AGPS alters the balance of structural and signaling lipids to fuel cancer pathogenicity.Proc. Natl. Acad. Sci. USA. 2013; 110: 14912-14917Crossref PubMed Scopus (133) Google Scholar). Unlike the synthesis of conventional phospholipids, which occurs in the cytoplasm, the first steps of the synthesis of ether lipids occur in peroxisomes. Peroxisomes are vital organelles present in all eukaryotic cells that adjust their number in response to physiological conditions and metabolic needs (11.Waterham H.R. Ebberink M.S. Genetics and molecular basis of human peroxisome biogenesis disorders.Biochim. Biophys. Acta. 2012; 1822: 1430-1441Crossref PubMed Scopus (196) Google Scholar). Peroxisomes play important roles in human physiology, as evidenced by the devastating diseases that result from peroxisomal biogenesis defects, as well as single enzyme peroxisomal deficiencies (7.Wanders R.J. Waterham H.R. Peroxisomal disorders: the single peroxisomal enzyme deficiencies.Biochim. Biophys. Acta. 2006; 1763: 1707-1720Crossref PubMed Scopus (207) Google Scholar). Enzymes localized in peroxisomes perform both biosynthetic roles, such as ether lipid synthesis and bile acid synthesis, as well as essential catabolic functions, such as α- and β-oxidation of fatty acids, glyoxylate detoxification, and hydrogen peroxide metabolism (12.Vamecq J. Cherkaoui-Malki M. Andreoletti P. Latruffe N. The human peroxisome in health and disease: the story of an oddity becoming a vital organelle.Biochimie. 2014; 98: 4-15Crossref PubMed Scopus (34) Google Scholar). The association of peroxisomes with mitochondria and lipid droplets, along with their dual roles in carrying out anabolic and catabolic reactions, point to their importance in generating cellular signals required for normal physiological functions (13.Lodhi I.J. Semenkovich C.F. Peroxisomes: a nexus for lipid metabolism and cellular signaling.Cell Metab. 2014; 19: 380-392Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar). In a screen for Caenorhabditis elegans mutants with altered fatty acid composition, we identified strains carrying loss-of-function mutations in three genes encoding the proteins required for the initial three steps in the ether lipid biosynthetic pathway, FAR1, GNPAT, and AGPS. Our lipidomic study revealed many lipid species containing alkyl and alkenyl ether bonds in C. elegans. Analysis of these mutant strains shows that remarkable compensatory lipid composition changes occur in the absence of ether lipids. We found that increases in de novo fatty acid synthesis and reduction of stearoyl- and palmitoyl-CoA desaturase activity, processes that are at least partially regulated transcriptionally, mediate the altered lipid composition in ether lipid-deficient mutants. Phenotypic analysis demonstrated the importance of ether-linked lipids for optimal fertility, lifespan, survival at cold temperatures, and resistance to oxidative stress. These discoveries indicate that investigation of ether lipid synthesis and function in C. elegans will make important contributions to understanding the roles of ether lipids in human health and disease. The wild-type C. elegans strain was N2, strains BX11 fard-1(wa2), BX275 fard-1(wa28), BX10 ads-1(wa3), and BX259 acl-7(wa20) were isolated in a genetic screen carried out in the Browse laboratory (14.Watts J.L. Browse J. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans.Proc. Natl. Acad. Sci. USA. 2002; 99: 5854-5859Crossref PubMed Scopus (301) Google Scholar) and outcrossed four times against wild-type before analysis. Unless otherwise stated, the fard-1 strain used was BX275 fard-1(wa28). The ire-1(v33) strain and the "million mutant" strains (VC) were obtained from the Center for Caenorhabditis Genetics Stock Center (St. Paul, MN). Nematodes were maintained on nematode growth media at 20°C seeded with Escherichia coli (OP50), unless otherwise stated (15.Stiernagle T. Maintenance of C. elegans. In WormBook. Cold Spring Harbor Lab Press, Cold Spring Harbor2006http://www.ncbi.nlm.nih.gov/books/NBK19649/Version: IIDate: 2006Date accessed: December 29, 2015Google Scholar). For RNAi experiments, nematode growth media was supplemented with 100 ¼g/ml ampicillin and 2 mM isopropyl β-D-1-thiogalactopyranoside, and seeded with the appropriate HT115 RNAi bacteria (16.Fraser A.G. Kamath R.S. Zipperlen P. Martinez-Campos M. Sohrmann M. Ahringer J. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference.Nature. 2000; 408: 325-330Crossref PubMed Scopus (1373) Google Scholar). The plasmid for fard-1 feeding RNAi was obtained from the Ahringer RNAi library (16.Fraser A.G. Kamath R.S. Zipperlen P. Martinez-Campos M. Sohrmann M. Ahringer J. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference.Nature. 2000; 408: 325-330Crossref PubMed Scopus (1373) Google Scholar) and was sequenced before use. For acl-7 RNAi and ads-1 RNAi, feeding RNAi plasmids were constructed by cloning of acl-7 and ads-1 genomic sequences into the L4440 vector. Primers for ads-1 RNAi cloning were (forward) GAAGATGTTCGCCGGATCCAGCTC and (reverse) GGTCAAGAGATTCGGAAGCTTCGTG; for acl-7 cloning (forward) GAGTCAACTGGAGCTCTACTGAAAGC and (reverse) GAGCACAAGCTTGCTCAACACTTCTG. The PCR products and L4440 plasmid were digested with restriction enzymes BamHI and HindIII (for ads-1) and SacI and HindIII (for acl-7) before ligation and transformation into E. coli HT115. DNA was extracted from approximately 1,000 nematodes using a Qiagen DNeasy kit. Samples were sequenced using a MiSeq PE250 run with an expected coverage of ∼10× per sample. Reads were then cleaned with SeqyClean, mapped against the WBcel215.70 (http://jan2013.archive.ensembl.org/Caenorhabditis_elegans/Info/Index) using Bowtie 2 v2.1.0, and variants were called with the SAMtools package v0.1.19-44428cd. Variants were then filtered and annotated using an R program developed in-house. Fatty acid composition of young adult nematodes was determined by GC-MS, as previously described (14.Watts J.L. Browse J. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans.Proc. Natl. Acad. Sci. USA. 2002; 99: 5854-5859Crossref PubMed Scopus (301) Google Scholar, 17.Brock T.J. Browse J. Watts J.L. Genetic regulation of unsaturated fatty acid composition in C. elegans.PLoS Genet. 2006; 2: e108Crossref PubMed Scopus (174) Google Scholar). For lipid composition studies, lipids were extracted from three biological replicates, each containing approximately 10,000 young adult nematodes. Lipid extraction and separation of the triacylglycerol (TAG) and phospholipid fractions used a two solvent TLC protocol, as described previously (18.Shi X. Li J. Zou X. Greggain J. Rodkaer S.V. Faergeman N.J. Liang B. Watts J.L. Regulation of lipid droplet size and phospholipid composition by stearoyl-CoA desaturase.J. Lipid Res. 2013; 54: 2504-2514Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Stable isotope labeling of fatty acids was performed essentially as described (19.Perez C.L. Van Gilst M.R. A 13C isotope labeling strategy reveals the influence of insulin signaling on lipogenesis in C. elegans.Cell Metab. 2008; 8: 266-274Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Briefly, equal amounts of bacteria grown in either Luria broth (12C media) or ISOGROW (98.5% 13C-enriched, Sigma) were mixed and plated onto agarose plates. For each sample, approximately 30,000 synchronized L1 nematodes prepared from hypochlorite treatment of gravid adults were added to the plates and grown for 48 h at 20°C. Lipids were extracted and fatty acids were analyzed as described (19.Perez C.L. Van Gilst M.R. A 13C isotope labeling strategy reveals the influence of insulin signaling on lipogenesis in C. elegans.Cell Metab. 2008; 8: 266-274Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Ultra-performance LC molecular species separation and chip-based nanoelectrospray ionization (TriVersa Nanomate®; Advion, Ithaca, NY) were achieved as described in Tarazona, Feussner, and Feussner (20.Tarazona P. Feussner K. Feussner I. An enhanced plant lipidomics method based on multiplexed liquid chromatography-mass spectrometry reveals additional insights into cold- and drought-induced membrane remodeling.Plant J. 2015; 84: 621-633Crossref PubMed Scopus (98) Google Scholar), including only the use of the ultra-performance LC gradient "B" combined with the negative ion mode. Phosphatidylethanolamine (PE) molecular species were detected with a 4000 QTRAP® tandem mass spectrometer (AB Sciex, Framingham, MA) by monitoring: i) single reaction monitoring (SRM) transitions from [M-H]− molecular ions to acyl chain-derived carboxylate fragments (supplementary Table 1); and ii) plasmalogen-specific SRM transitions as in (21.Zemski Berry K.A. Murphy R.C. Electrospray ionization tandem mass spectrometry of glycerophosphoethanolamine plasmalogen phospholipids.J. Am. Soc. Mass Spectrom. 2004; 15: 1499-1508Crossref PubMed Scopus (219) Google Scholar), which targeted sn-1- and sn-2-related fragments in positive ion mode (supplementary Table 2). As an additional control, the identities of 17 ether lipids were confirmed by their accurate mass (supplementary Table 3). For this purpose, the post column flow was directed to an orthogonal time-of-flight mass spectrometer (LCT Premier; Waters Corp., Milford, MA) and analyzed as in (20.Tarazona P. Feussner K. Feussner I. An enhanced plant lipidomics method based on multiplexed liquid chromatography-mass spectrometry reveals additional insights into cold- and drought-induced membrane remodeling.Plant J. 2015; 84: 621-633Crossref PubMed Scopus (98) Google Scholar). The identification criteria included: i) two complementary SRM transitions for diacyl-PE and 1-O-alk-1′-enyl-2-acyl-PE species, and one SRM transition for 1-O-alkyl-2-acyl-PE species; ii) retention time for all analyzed PE species; and iii) accurate mass analysis for 17 ether lipid molecular species. The chromatographic resolution of isobaric PE species was required for analyte identification. Due to the unavailability of primary standards and isotopically labeled internal standards for each of the targeted analytes, no absolute quantification was intended in this broad ranging LC-MS approach. Nematodes were synchronized and harvested at L4 stage. RNA and cDNA were prepared as described (22.Brock T.J. Browse J. Watts J.L. Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans.Genetics. 2007; 176: 865-875Crossref PubMed Scopus (161) Google Scholar). For semi-quantitative RT-PCR, the PCR cycles were as follows: fat-6, 22 cycles; pod-2 and cdc-42, 25 cycles; fat-5 and fat-7, 28 cycles; elo-2, 30 cycles. Real-time PCR assays were run and monitored with an ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA). The real-time PCR was conducted on at least three treatment groups with each individual treatment group at least in triplicate. Threshold values (Ct) for the gene of interest and a reference gene, cdc-2, were determined using ABI Prism SDS software version 1.1 (Applied Biosystems). The expression level of the gene of interest was evaluated using the 2−(ΔΔCt) method (23.Wong M.L. Medrano J.F. Real-time PCR for mRNA quantitation.Biotechniques. 2005; 39: 75-85Crossref PubMed Scopus (1267) Google Scholar). Supplementary Table 4 shows primer sequences used for the quantitative real-time RT-PCR. For each strain, approximately 100 synchronized L1 larvae were plated onto 12 6 mm NGM plates. Four plates of each strain were transferred to incubators set to 20°C, 15°C, and 10°C. The number of L4 and young adult worms were counted after 3 days of growth for the 20°C plates, 5 days of growth at 15°C, and 9 days of growth at 10°C. To ensure that the 10°C worms were large enough to visualize, after 9 days of growth at 10°C, the plates were transferred to 20°C before counting viable worms. The number of viable worms at 15°C and 10°C were normalized to the number at 20°C to calculate survival. For analysis of total progeny produced per worm, eight to ten L4 larvae were transferred individually to fresh NGM plates seeded with E. coli strain OP50. Worms were transferred daily until they did not produce any more progeny. Two days after removal of the adult, the live progeny of each individual were counted. Lifespan assays were conducted at 20°C on solid NGM media seeded with E. coli (OP50) using standard protocols and were replicated in at least three independent experiments. For lifespan assays, worms were moved to new assay plates every 1–2 days to prevent contamination of plates with their offspring. To assess the survival of the worms, the animals were prodded with a platinum wire every 1–2 days, and those that failed to respond were scored as dead. All lifespan data are available in supplementary Table 5, including sample sizes. Animals were assigned randomly to the experimental groups. Worms that ruptured, bagged (that is, exhibited internal progeny hatching), or crawled off the plates were censored. P values were calculated using the log-rank (Cox-Mantel) test. Lifespan data were analyzed using GraphPad Prism 6 and OASIS (online application for the survival analysis of lifespan assays performed in aging research) (24.Yang J.S. Nam H.J. Seo M. Han S.K. Choi Y. Nam H.G. Lee S.J. Kim S. OASIS: online application for the survival analysis of lifespan assays performed in aging research.PLoS One. 2011; 6: e23525Crossref PubMed Scopus (226) Google Scholar). To assess sensitivity to acute oxidative stress, at least 100 young adult worms that were grown on NGM plates were transferred to freshly prepared plates containing 200 mM paraquat or 14.6 mM tert-butyl peroxide (tBOOH) (25.Goh G.Y. Martelli K.L. Parhar K.S. Kwong A.W. Wong M.A. Mah A. Hou N.S. Taubert S. The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans.Aging Cell. 2014; 13: 70-79Crossref PubMed Scopus (38) Google Scholar, 26.Schaar C.E. Dues D.J. Spielbauer K.K. Machiela E. Cooper J.F. Senchuk M. Hekimi S. Van Raamsdonk J.M. Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.PLoS Genet. 2015; 11: e1004972Crossref PubMed Scopus (134) Google Scholar). Worms were scored every 2 h as alive or dead. For endoplasmic reticulum (ER) stress assays, at least 100 L4 worms that were grown on NGM plates were transferred to 30 mg/ml tunicamycin plates and were scored as alive or dead every 24 h (27.Hou N.S. Gutschmidt A. Choi D.Y. Pather K. Shi X. Watts J.L. Hoppe T. Taubert S. Activation of the endoplasmic reticulum unfolded protein response by lipid disequilibrium without disturbed proteostasis in vivo.Proc. Natl. Acad. Sci. USA. 2014; 111: E2271-E2280Crossref PubMed Scopus (114) Google Scholar). For stress assays, growth of worms and assays were performed at 20°C. Survival on paraquat, tBOOH, and tunicamycin was plotted in GraphPad Prism and curves were compared using a log-rank (Cox-Mantel) test. To study the relationships between specific lipid species and biological functions, we performed a genetic screen for C. elegans mutants with altered fatty acid composition. We successfully identified mutants in the fatty acid desaturation and elongation pathway required for the biosynthesis of PUFAs (14.Watts J.L. Browse J. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans.Proc. Natl. Acad. Sci. USA. 2002; 99: 5854-5859Crossref PubMed Scopus (301) Google Scholar). Several mutant lines isolated in this screen (wa2, wa3, wa20, wa28) contained 3- to 4-fold higher saturated fat than wild-type, mostly in the form of high levels of stearic acid (18:0). After we ruled out that these strains did not carry mutations in the delta-9 desaturase genes (fat-5, fat-6, or fat-7) (17.Brock T.J. Browse J. Watts J.L. Genetic regulation of unsaturated fatty acid composition in C. elegans.PLoS Genet. 2006; 2: e108Crossref PubMed Scopus (174) Google Scholar, 22.Brock T.J. Browse J. Watts J.L. Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans.Genetics. 2007; 176: 865-875Crossref PubMed Scopus (161) Google Scholar), or in known transcriptional regulators of these genes (sbp-1, nhr-80, nhr-49, mdt-15) (17.Brock T.J. Browse J. Watts J.L. Genetic regulation of unsaturated fatty acid composition in C. elegans.PLoS Genet. 2006; 2: e108Crossref PubMed Scopus (174) Google Scholar, 28.Van Gilst M.R. Hadjivassiliou H. Jolly A. Yamamoto K.R. Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans.PLoS Biol. 2005; 3: e53Crossref PubMed Scopus (292) Google Scholar, 29.Walker A.K. Jacobs R.L. Watts J.L. Rottiers V. Jiang K. Finnegan D.M. Shioda T. Hansen M. Yang F. Niebergall L.J. et al.A conserved SREBP-1/phosphatidylcholine feedback circuit regulates lipogenesis in metazoans.Cell. 2011; 147: 840-852Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 30.Yang F. Vought B.W. Satterlee J.S. Walker A.K. Jim Sun Z.Y. Watts J.L. DeBeaumont R. Saito R.M. Hyberts S.G. Yang S. et al.An ARC/Mediator subunit required for SREBP control of cholesterol and lipid homeostasis.Nature. 2006; 442: 700-704Crossref PubMed Scopus (289) Google Scholar), we mapped two of the mutants to determine their chromosomal location and used whole genome sequencing to sequence all four of the mutants. We found that the four mutations were in three genes that encode proteins necessary for the first steps of ether lipid synthesis. These genes are fard-1, FAR, acl-7, the peroxisomal DHA acyltransferase (GNPAT), and ads-1, the peroxisomal alkyl-DHAP synthase (AGPS) (Fig. 1A). Loss-of-function mutations in the human homologs of ads-1 (AGPS) and acl-7 (GNPAT) are associated with the diseases RCDP types 2 and 3 (7.Wanders R.J. Waterham H.R. Peroxisomal disorders: the single peroxisomal enzyme deficiencies.Biochim. Biophys. Acta. 2006; 1763: 1707-1720Crossref PubMed Scopus (207) Google Scholar). After further analysis of the fatty acid composition of these mutants, we noticed that the putative ether lipid biosynthetic mutants not only contained relatively high amounts of stearic acid (18:0), but also lacked a fatty acid derivative that we identified by MS as 18:0 dimethylacetal (DMA) (Fig. 1B, supplementary Table 6). This fatty acid derivative corresponds to the 18:0 fatty acyl component of PE-plasmalogen, the ether lipid containing a delta-1 cis double bond. This mass spectrum of this fatty acid derivative is distinct among the fatty acid methyl esters that are derived from conventional diacyl phospholipids (31.Christi W.W. Mass spectra of some miscellaneous lipophylic components.In AOCS Lipid Library. 2013http://lipidlibrary.aocs.org/content.cfm?ItemNumber=39508Version: IIDate: 2012Date accessed: December 29, 2015Google Scholar). Even though the alkyl fatty acids were not cleaved from the ether lipids during our GC-MS derivatization protocol, the alkenyl ether lipids were cleaved and converted to 18:0 DMA, indicating the presence of alkenyl or plasmalogen ether lipids. To confirm the identities of our mutant lines, we fed wild-type C. elegans RNAi constructs corresponding to the fard-1, acl-7, and ads-1 genes. This resulted in the accumulation of 18:0 and depletion of 18:0 DMA, confirming the identification of these genes as being causative for the fatty acid phenotype (supplementary Fig. 1, supplementary Table 6). In addition, we analyzed the fatty acid composition of putative ether lipid biosynthesis mutants from the C. elegans million mutant project (32.Thompson O. Edgley M. Strasbourger P. Flibotte S. Ewing B. Adair R. Au V. Chaudhry I. Fernando L. Hutter H. et al.The million mutation project: a new approach to genetics in Caenorhabditis elegans.Genome Res. 2013; 23: 1749-1762Crossref PubMed Scopus (249) Google Scholar). Several of these lines, including two putative null alleles (deletion or premature stop codons) showed high saturated fat and lack of 18:0 DMA, indicating lack of ether lipid biosynthetic capability. The specific mutations are summarized in Fig. 1C and Table 1. All of the strains that showed the high 18:0 and low 18:0 DMA phenotypes contained point mutations in conserved functional domains, although not all mutations in the conserved domains manifested the altered fatty acid phenotype. We did not identify any mutants that showed only low 18:0 DMA without high 18:0. Therefore, in this set of mutants, increases in 18:0 are always associated with mutant strains that are unable to synthesize ether-linked lipids.TABLE 1C. elegans strains containing mutations in ether lipid biosynthesis genesGeneStrain NameAlleleAA changeConserved DomainGC/MS PhenotypeMutagenacl-7VC20564gk158076G315R—Wild-typeEMSacl-7VC30016gk158078P287S—Wild-typeENUacl-7VC30097gk158077E301K—Wild-typeENUacl-7VC40074gk158071, gk158074T642I, D338N—Wild-typeENU + EMSacl-7VC20381gk158075N365K—Wild-typeEMSacl-7BX259wa20R234CAcyl transfer domainHigh 18:0, slight 18:0 DMAEMSacl-7VC40979gk910077R86 OpalAcyl transfer domainHigh 18:0, no 18:0 DMAENU + EMSacl-7VC20532gk341012P241SAcyl transfer domainWild-typeEMSacl-7VC40643gk961438Deletion AA68-92—High 18:0, no 18:0 DMAENU + EMSads-1VC20023gk341012R182QFAD binding 4Wild-typeEMSads-1VC20752gk391946S246FFAD oxidase CHigh 18:0, no 18:0 DMAEMSads-1VC20757gk393652G539DFAD oxidase CWild-typeEMSads-1VC40662gk751286P489SFAD oxidase CWild-typeENU + EMSads-1BX10wa3G454DFAD oxidase CHigh 18:0, no 18:0 DMAEMSfard-1VC20061gk164361G132EReductase/NAD bindingHigh 18:0, no 18:0 DMAEMSfard-1BX11wa2G253EReductase/NAD bindingHigh 18:0, slight 18:0 DMAEMSfard-1BX275wa28G261DReductase/NAD bindingHigh 18:0, no 18:0 DMAEMSfard-1VC20611gk354624A235TReductase/NAD bindingWild-typeEMSfard-1VC30262gk450456D98GReductase/NAD bindingWild-typeENUfard-1VC40103gk463717R513W—Wild-typeEMS + ENUBold rows indicate mutations that affect ether lipid synthesis. EMS, ethyl methanesulfanate; ENU, N-ethyl-N-nitrosourea. Open table in a new tab While the loss of 18:0 DMA is predictive for ether lipid biosynthetic defects, this fatty acid only represents one of the alkenyl fatty acids that are the plasmalogen components of ether lipids. Therefore, we used a more sensitive LC-MS/MS technique to characterize ether-linked lipids in C. elegans wild-type and mutants. We identified the diacyl, alkyl, and alkenyl derivatives of phosphatidylcholi
Referência(s)