An Impaired Respiratory Electron Chain Triggers Down-regulation of the Energy Metabolism and De-ubiquitination of Solute Carrier Amino Acid Transporters
2016; Elsevier BV; Volume: 15; Issue: 5 Linguagem: Inglês
10.1074/mcp.m115.053181
ISSN1535-9484
AutoresIna Aretz, Christopher Hardt, Ilka Wittig, David Meierhofer,
Tópico(s)Metabolism and Genetic Disorders
ResumoHundreds of genes have been associated with respiratory chain disease (RCD), the most common inborn error of metabolism so far. Elimination of the respiratory electron chain by depleting the entire mitochondrial DNA (mtDNA, ρ0 cells) has therefore one of the most severe impacts on the energy metabolism in eukaryotic cells. In this study, proteomic data sets including the post-translational modifications (PTMs) phosphorylation and ubiquitination were integrated with metabolomic data sets and selected enzyme activities in the osteosarcoma cell line 143B.TK−. A shotgun based SILAC LC-MS proteomics and a targeted metabolomics approach was applied to elucidate the consequences of the ρ0 state. Pathway and protein–protein interaction (PPI) network analyses revealed a nonuniform down-regulation of the respiratory electron chain, the tricarboxylic acid (TCA) cycle, and the pyruvate metabolism in ρ0 cells. Metabolites of the TCA cycle were dysregulated, such as a reduction of citric acid and cis-aconitic acid (six and 2.5-fold), and an increase of lactic acid, oxalacetic acid (both twofold), and succinic acid (fivefold) in ρ0 cells. Signaling pathways such as GPCR, EGFR, G12/13 alpha, and Rho GTPases were up-regulated in ρ0 cells, which could be indicative for the mitochondrial retrograde response, a pathway of communication from mitochondria to the nucleus. This was supported by our phosphoproteome data, which revealed two main processes, GTPase-related signal transduction and cytoskeleton organization. Furthermore, a general de-ubiquitination in ρ0 cells was observed, for example, 80S ribosomal proteins were in average threefold and SLC amino acid transporters fivefold de-ubiquitinated. The latter might cause the observed significant increase of amino acid levels in ρ0 cells. We conclude that an elimination of the respiratory electron chain, e.g. mtDNA depletion, not only leads to an uneven down-regulation of mitochondrial energy pathways, but also triggers the retrograde response. Hundreds of genes have been associated with respiratory chain disease (RCD), the most common inborn error of metabolism so far. Elimination of the respiratory electron chain by depleting the entire mitochondrial DNA (mtDNA, ρ0 cells) has therefore one of the most severe impacts on the energy metabolism in eukaryotic cells. In this study, proteomic data sets including the post-translational modifications (PTMs) phosphorylation and ubiquitination were integrated with metabolomic data sets and selected enzyme activities in the osteosarcoma cell line 143B.TK−. A shotgun based SILAC LC-MS proteomics and a targeted metabolomics approach was applied to elucidate the consequences of the ρ0 state. Pathway and protein–protein interaction (PPI) network analyses revealed a nonuniform down-regulation of the respiratory electron chain, the tricarboxylic acid (TCA) cycle, and the pyruvate metabolism in ρ0 cells. Metabolites of the TCA cycle were dysregulated, such as a reduction of citric acid and cis-aconitic acid (six and 2.5-fold), and an increase of lactic acid, oxalacetic acid (both twofold), and succinic acid (fivefold) in ρ0 cells. Signaling pathways such as GPCR, EGFR, G12/13 alpha, and Rho GTPases were up-regulated in ρ0 cells, which could be indicative for the mitochondrial retrograde response, a pathway of communication from mitochondria to the nucleus. This was supported by our phosphoproteome data, which revealed two main processes, GTPase-related signal transduction and cytoskeleton organization. Furthermore, a general de-ubiquitination in ρ0 cells was observed, for example, 80S ribosomal proteins were in average threefold and SLC amino acid transporters fivefold de-ubiquitinated. The latter might cause the observed significant increase of amino acid levels in ρ0 cells. We conclude that an elimination of the respiratory electron chain, e.g. mtDNA depletion, not only leads to an uneven down-regulation of mitochondrial energy pathways, but also triggers the retrograde response. The mitochondrial energy metabolism is necessary for the generation of more than 90% of cellular energy in form of adenosine triphosphate (ATP) (1Ernster L. Schatz G. Mitochondria: a historical review.J. Cell Biol. 1981; 91: 227s-255sCrossref PubMed Scopus (375) Google Scholar, 2Watt I.N. Montgomery M.G. Runswick M.J. Leslie A.G.W. Walker J.E. Bioenergetic cost of making an adenosine triphosphate molecule in animal mitochondria.Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 16823-16827Crossref PubMed Scopus (368) Google Scholar). Human mitochondria contain ∼1500–2000 proteins (3Prokisch H. Andreoli C. Ahting U. Heiss K. Ruepp A. Scharfe C. Meitinger T. MitoP2: the mitochondrial proteome database – now including mouse data.Nucleic Acids Res. 2006; 34: D705-D711Crossref PubMed Scopus (85) Google Scholar) and have an own genome (mtDNA) encoding 37 genes, including 13 proteins of the oxidative phosphorylation (OXPHOS), 22 tRNAs, and two rRNAs (4Anderson S. Bankier A.T. Barrell B.G. de Bruijn M.H. Coulson A.R. Drouin J. Eperon I.C. Nierlich D.P. Roe B.A. Sanger F. Schreier P.H. Smith A.J. Staden R. Young I.G. Sequence and organization of the human mitochondrial genome.Nature. 1981; 290: 457-465Crossref PubMed Scopus (7611) Google Scholar). Mitochondria store the majority of cellular calcium, play an important role during apoptosis, heat production, membrane potential, and harbor important catabolic and anabolic pathways such as TCA cycle, beta oxidation, amino acid, and heme synthesis pathways (5Ruiz-Romero C. Blanco F.J. Mitochondrial proteomics and its application in biomedical research.Mol. Biosyst. 2009; 5: 1130-1142Crossref PubMed Scopus (15) Google Scholar). Respiratory chain diseases (RCD) 1The abbreviations used are:RCDRespiratory chain disease143B.TK−143B Thymidine kinase deficient2-DE2-D electrophoresisBC assayBicinchoninic acid assayBHBenjamini-HochbergDMEMDulbecco's Modified Eagle MediumdNTPDeoxynucleotideFAFormic acidFBSFetal bovine serumFDRFalse discovery rateGOGene ontologyGSEAGene set enrichment analysisHILICHydrophilic interaction chromatographyMeOHMethanolMRMMultiple reaction monitoringmtDNAMitochondrial DNAPEPPosterior error probabilityPPIProtein–protein interactionPTMPost-translational modificationRPReversed phaseSAXStrong anion exchange chromatographySCXStrong cation exchange chromatographySILACStable isotope labeling by amino acids in cell cultureTBETRIS-Borat-EDTATiO2Titanium dioxideρ0Rho 0. represent a large subset of mitochondrial disorders and are biochemically characterized by defective OXPHOS, leading predominantly to neurological and muscular degeneration. They occur at an estimated prevalence of one in 5000 live births and are collectively the most common inborn error of metabolism (6DiMauro S. Hirano M. Schon E.A. Approaches to the treatment of mitochondrial diseases.Muscle Nerve. 2006; 34: 265-283Crossref PubMed Scopus (108) Google Scholar). Human cells lacking mtDNA (ρ0 cells) were originally obtained from the human osteosarcoma cell line 143B.TK− (7King M.P. Attardi G. Isolation of human cell lines lacking mitochondrial DNA.Methods Enzymol. 1996; 264: 304-313Crossref PubMed Google Scholar) by chronic exposure to the DNA intercalating dye ethidium bromide. Since then, ρ0 cell lines have been established from various tissues and species applying additional methods such as application of the anticancer drug ditercalinium (8Inoue K. Takai D. Hosaka H. Ito S. Shitara H. Isobe K. LePecq J.B. Segal-Bendirdjian E. Hayashi J. Isolation and characterization of mitochondrial DNA-less lines from various mammalian cell lines by application of an anticancer drug, ditercalinium.Biochem. Biophys. Res. Commun. 1997; 239: 257-260Crossref PubMed Scopus (44) Google Scholar) or restriction enzymes specifically targeting mitochondria (9Kukat A. Kukat C. Brocher J. Schäfer I. Krohne G. Trounce I.A. Villani G. Seibel P. Generation of rho0 cells utilizing a mitochondrially targeted restriction endonuclease and comparative analyses.Nucleic Acids Res. 2008; 36: e44Crossref PubMed Scopus (80) Google Scholar, 10Schubert S. Heller S. Löffler B. Schäfer I. Seibel M. Villani G. Seibel P. Generation of rho zero cells: visualization and quantification of the mtDNA depletion process.Int. J. Mol. Sci. 2015; 16: 9850-9865Crossref PubMed Scopus (15) Google Scholar). However, ρ0 cells are viable in culture, provided appropriate conditions are met (11King M.P. Attardi G. Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation.Science. 1989; 246: 500-503Crossref PubMed Scopus (1448) Google Scholar), e.g. supplementation with uridine to compensate for impaired pyrimidine biosynthesis, and pyruvate to provide electron acceptors for anaerobic glycolysis. The mitochondria of ρ0 cells still maintain an electrochemical gradient across the inner membrane by a mechanism coupled to ATP hydrolysis (12Chandel N.S. Schumacker P.T. Cells depleted of mitochondrial DNA (rho0) yield insight into physiological mechanisms.FEBS Lett. 1999; 454: 173-176Crossref PubMed Scopus (166) Google Scholar), thus making them net consumers of ATP. Our study was performed with the ρ0 cell line generated from 143B.TK− cells, as it is one of the best characterized ρ0 cell lines available (7King M.P. Attardi G. Isolation of human cell lines lacking mitochondrial DNA.Methods Enzymol. 1996; 264: 304-313Crossref PubMed Google Scholar, 9Kukat A. Kukat C. Brocher J. Schäfer I. Krohne G. Trounce I.A. Villani G. Seibel P. Generation of rho0 cells utilizing a mitochondrially targeted restriction endonuclease and comparative analyses.Nucleic Acids Res. 2008; 36: e44Crossref PubMed Scopus (80) Google Scholar, 13Wittig I. Meyer B. Heide H. Steger M. Bleier L. Wumaier Z. Karas M. Schägger H. Assembly and oligomerization of human ATP synthase lacking mitochondrial subunits a and A6L.Biochim. Biophys. Acta. 2010; 1797: 1004-1011Crossref PubMed Scopus (86) Google Scholar, 14Chae S. Ahn B.Y. Byun K. Cho Y.M. Yu M.-H. Lee B. Hwang D. Park K.S. A systems approach for decoding mitochondrial retrograde signaling pathways.Sci. Signal. 2013; 6: rs4Crossref PubMed Scopus (136) Google Scholar). Respiratory chain disease 143B Thymidine kinase deficient 2-D electrophoresis Bicinchoninic acid assay Benjamini-Hochberg Dulbecco's Modified Eagle Medium Deoxynucleotide Formic acid Fetal bovine serum False discovery rate Gene ontology Gene set enrichment analysis Hydrophilic interaction chromatography Methanol Multiple reaction monitoring Mitochondrial DNA Posterior error probability Protein–protein interaction Post-translational modification Reversed phase Strong anion exchange chromatography Strong cation exchange chromatography Stable isotope labeling by amino acids in cell culture TRIS-Borat-EDTA Titanium dioxide Rho 0. The progression of mitochondrial diseases has a broad spectrum with variable clinical manifestations and can originate by mutations either in the mitochondrial or the nuclear genome (15DiMauro S. The many faces of mitochondrial diseases.Mitochondrion. 2004; 4: 799-807Crossref PubMed Scopus (14) Google Scholar, 16Nunnari J. Suomalainen A. Mitochondria: in sickness and in health.Cell. 2012; 148: 1145-1159Abstract Full Text Full Text PDF PubMed Scopus (1847) Google Scholar). More than 250 gene defects have been reported to date and this number continues to grow (17Mayr J.A. Haack T.B. Freisinger P. Karall D. Makowski C. Koch J. Feichtinger R.G. Zimmermann F.A. Rolinski B. Ahting U. Meitinger T. Prokisch H. Sperl W. Spectrum of combined respiratory chain defects.J. Inherit. Metab. Dis. 2015; 38: 629-640Crossref PubMed Scopus (80) Google Scholar). MtDNA depleted cells can be used to investigate the pathogenesis of specific mtDNA mutations, and for developing a better understanding of interactions between nuclear and mitochondrial genomes in mitochondrial disease (12Chandel N.S. Schumacker P.T. Cells depleted of mitochondrial DNA (rho0) yield insight into physiological mechanisms.FEBS Lett. 1999; 454: 173-176Crossref PubMed Scopus (166) Google Scholar). However, little is known about protein abundance changes, the influence and regulation of post-translational modifications (PTMs) or metabolites in ρ0 cells. Based on a previous proteomics study from ρ0 mitochondria separated by 2-D electrophoresis, others could identify an uneven down-regulation of subunits of the respiratory electron chain and of mitochondrial ribosomes (18Chevallet M. Lescuyer P. Diemer H. van Dorsselaer A. Leize-Wagner E. Rabilloud T. Alterations of the mitochondrial proteome caused by the absence of mitochondrial DNA: a proteomic view.Electrophoresis. 2006; 27: 1574-1583Crossref PubMed Scopus (41) Google Scholar). In this study, metabolome and proteome profiles of the parental cell line 143B.TK− versus ρ0 were integrated, including PTM analyses such as phosphorylation and ubiquitination to characterize the impact of the absence of mtDNA for the entire cell (Fig. 1). For quantitative proteome profiling, a shotgun LC-MS/MS approach including the classical SILAC labeling was performed. For comprehensive metabolome profiling, a targeted LC-MS approach, based on multiple reaction monitoring (MRM) (19Gielisch I. Meierhofer D. Metabolome and proteome profiling of complex I deficiency induced by rotenone.J. Proteome Res. 2015; 14: 224-235Crossref PubMed Scopus (48) Google Scholar) was applied. Our study revealed that mtDNA depletion leads to a nonuniform down-regulation of the mitochondrial energy metabolism in ρ0 cells on the proteome level. Metabolites of the TCA cycle were highly dysregulated which in turn had an impact on the amino acid levels, which were up-regulated. Perturbation of the mitochondrial energy metabolism could be indicative for an activation of the retrograde response, supported by proteome data and phosphorylation patterns in GTPase signaling pathways and the cytoskeleton as well as a general de-ubiquitination in ρ0 cells. The thymidine kinase deficient (TK−) osteosarcoma cell line 143B.TK− (ATCC-CRL-8303), with a bromodeoxyuridine resistance was obtained from LGC Standards and is the parental line of recently generated ρ0 cells (13Wittig I. Meyer B. Heide H. Steger M. Bleier L. Wumaier Z. Karas M. Schägger H. Assembly and oligomerization of human ATP synthase lacking mitochondrial subunits a and A6L.Biochim. Biophys. Acta. 2010; 1797: 1004-1011Crossref PubMed Scopus (86) Google Scholar) by the protocol from (7King M.P. Attardi G. Isolation of human cell lines lacking mitochondrial DNA.Methods Enzymol. 1996; 264: 304-313Crossref PubMed Google Scholar). The wild-type cell line 143B.TK− and the according ρ0 cells were cultivated in SILAC DMEM (Silantes, Munich, Germany, without l-lysine and l-arginine) containing 4.5 g/L glucose, 1 mm pyruvate, supplemented with 5% dialyzed FBS (Silantes, Munich, Germany), 1% Penicillin-Streptomycin-Neomycin (Invitrogen, Carlsbad, CA), 100 μg/ml bromodeoxyuridine (Sigma-Aldrich) and 50 μg/ml uridine (Sigma-Aldrich) at 37 °C in a humidified atmosphere of 5% CO2. Cells were labeled with light (L) or heavy (H) isotopes of arginine (12C614N4, 13C615N4;30 mg/L) and lysine (12C614N2, 13C615N2; 80 mg/L; both: Silantes) and grown to confluency in one 300 cm2 polystyrene flask per replicate. Proteomic experiments were done in biological quadruplicates, including a label-switch. For metabolome profiling and enzymatic measurements, light SILAC labeled cultures were grown in biological triplicates. Full depletion of the mtDNA was verified by PCR according to (13Wittig I. Meyer B. Heide H. Steger M. Bleier L. Wumaier Z. Karas M. Schägger H. Assembly and oligomerization of human ATP synthase lacking mitochondrial subunits a and A6L.Biochim. Biophys. Acta. 2010; 1797: 1004-1011Crossref PubMed Scopus (86) Google Scholar). In brief, genomic DNA was isolated using the QIAmp DNA Mini Kit for amplification of a 399-bp mtDNA product with following primers: 5′TTCACAAAGCGCCTTCCCCCGT and 5′GCGATGGTGAGAGCTAAGGTCGGG, which span a region of nt 3153–nt 3551 (accession number NC_012920.1). For the 238-bp nuclear DNA product amplification, primer 5′AGTGTCTTAAGAGTAAAGCTGGCCACA and 5′ TTGCCTTTGTTGCATTTTCTACAG, spanning a region of exon 5 of the gene USMG5 (accession number NT_030059.13, nt 55953445 - nt 55953207) were used. PCR was performed with 50 ng of genomic DNA as template, 250 μm dNTPs (Invitrogen), 0.5 μm of each primer, and 2.5 U of Taq polymerase (Invitrogen) were used. PCR conditions were as following: initial denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, primer annealing 30 s at 60 °C, elongation 60 s at 72 °C, 30 cycles in a thermocycler (Mastercycler personal 5332, Eppendorf, Hamburg, Germany). PCR products and mass calibration ladder (New England Biolabs, Ipswich, MA) were loaded and separated on a 2% agarose/TBE gel. Sample preparation for spectrophotometric detection of selected enzyme activities was done as reported previously (20Mayr J.A. Meierhofer D. Zimmermann F. Feichtinger R. Kögler C. Ratschek M. Schmeller N. Sperl W. Kofler B. Loss of complex I due to mitochondrial DNA mutations in renal oncocytoma.Clin. Cancer Res. 2008; 14: 2270-2275Crossref PubMed Scopus (134) Google Scholar). Measurements were performed in biological triplicates from independent culture dishes and normalized for total protein content. Malate dehydrogenase (MDH) and fumarase (FH) activities were measured according to the manufactures' protocol (Biovision Technologies, Golden, CO), citrate synthase (CS), and isocitrate dehydrogenase (IDH2) according to (21Meierhofer D. Mayr J.A. Foetschl U. Berger A. Fink K. Schmeller N. Hacker G.W. Hauser-Kronberger C. Kofler B. Sperl W. Decrease of mitochondrial DNA content and energy metabolism in renal cell carcinoma.Carcinogenesis. 2004; 25: 1005-1010Crossref PubMed Scopus (132) Google Scholar). Metabolite extraction was done as reported previously by us (19Gielisch I. Meierhofer D. Metabolome and proteome profiling of complex I deficiency induced by rotenone.J. Proteome Res. 2015; 14: 224-235Crossref PubMed Scopus (48) Google Scholar). Protein containing pellets of the first extraction-step were used to determine the protein concentration by a BC assay (Sigma-Aldrich), which was used for sample normalization. Additionally, an internal standard, containing chloramphenicol and C13-labeled l-glutamine, l-arginine, l-proline, l-valine, and uracil (3.5 μm final concentration) was added to each sample. Samples were cleaned by iso-disc filters (iso-disc filters PTFE 13 mm × 0.2 mm, Supelco, Bellafonte, PA), to avoid column clogging. Dry residuals were suspended in 50 μl ACN, 0.1% FA, and 50 μl MeOH, 0.1% FA for analysis by according HILIC mode, in 50 μl H2O, 0.1% FA for RPLC mode and centrifuged at 17,500 × g for 5 min at 4 °C. The supernatants were transferred to microvolume inserts, 5 μl per run were injected for LC-MS/MS analysis. 264 metabolites, such as amino acids, nucleic acids, bile acids, carbohydrates, vitamins, hormones, nucleotides, and biogenic amines beside others, were selected to cover most of the important metabolic pathways in mammals. Metabolites are chemically very diverse, therefore several different LC columns have been used for metabolite separation: A Reprosil-PUR C18-AQ (1.9 μm, 120 Å, 150 × 2 mm ID; Dr. Maisch; Ammerbuch, Germany) column and a zicHILIC (3.5 μm, 100 Å, 150 × 2.1 mm ID; di2chrom; Marl, Germany). LC-MS instrument (1290 series UHPLC; Agilent, Santa Clara, CA) conditions online coupled to a QTrap 6500 (Sciex, Foster City, CA) were reported previously (19Gielisch I. Meierhofer D. Metabolome and proteome profiling of complex I deficiency induced by rotenone.J. Proteome Res. 2015; 14: 224-235Crossref PubMed Scopus (48) Google Scholar). A list of all metabolites including MRM ion ratios, retention times and KEGG or HMDB metabolite identifiers can be found in supplemental Table S1. The mass spectrometry metabolomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository (22Vizcaíno J.A. Côté R.G. Csordas A. Dianes J.A. Fabregat A. Foster J.M. Griss J. Alpi E. Birim M. Contell J. O'Kelly G. Schoenegger A. Ovelleiro D. Pérez-Riverol Y. Reisinger F. Ríos D. Wang R. Hermjakob H. The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013.Nucleic Acids Res. 2013; 41: D1063-1069Crossref PubMed Scopus (1595) Google Scholar) with the data set identifier PXD002425. Relative quantification was performed using MultiQuantTM software v.2.1.1 (Sciex, Foster City, CA). Integration settings were a Gaussian smooth width of two points and a peak splitting factor of two. Peak integrations were reviewed manually and normalized according to the protein content and subsequently by internal standards. Cells were harvested and lysed under denaturing conditions in a buffer containing 4% SDS, 0.1 m DTT, and 0.1 m Tris, pH 8.0. Equal amounts of differently labeled ρ0 and parental samples were mixed, ∼17 mg of protein for each replicate in total. Lysates were sonicated for 1 min, boiled at 95 °C for 5 min and precipitated with acetone at −20 °C overnight. Lyophilized proteins were dissolved in 8 m urea, 10 mm Tris, pH 8, alkylated with a final concentration of 5.5 mm chloroacetamide for 30 min and Lys-C digested (1:2000) for 4 h at room temperature followed by a trypsin digestion (1:1000) overnight in 2 m urea at 37 °C (23Meierhofer D. Weidner C. Hartmann L. Mayr J.A. Han C.-T. Schroeder F.C. Sauer S. Protein sets define disease states and predict in vivo effects of drug treatment.Mol. Cell. Proteomics. 2013; 12: 1965-1979Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Subsequent, the peptides were purified with C18 columns. For whole proteome profiling 100 μg of each sample was further separated using six pH fractions (pH levels 11, 8, 6, 5, 4, and 3) of strong anion exchange chromatography (SAX, 3 m Purification, Meriden, CT) according to (24Wiœniewski J.R. Zougman A. Mann M. Combination of FASP and StageTip-based fractionation allows in-depth analysis of the hippocampal membrane proteome.J. Proteome Res. 2009; 8: 5674-5678Crossref PubMed Scopus (437) Google Scholar). The remaining sample amount of each C18 purified peptide mixture was used for immunoprecipitation of ubiquitinated peptides using the PTMScan Ubiquitin Remnant Motif Kit (Cell Signaling, Cambridge, UK) (25Wagner S.A. Beli P. Weinert B.T. Schölz C. Kelstrup C.D. Young C. Nielsen M.L. Olsen J.V. Brakebusch C. Choudhary C. Proteomic analyses reveal divergent ubiquitylation site patterns in murine tissues.Mol. Cell. Proteomics. 2012; 11: 1578-1585Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). Peptides were immunoprecipitated with 40 μl of α-diGly coupled to protein A agarose beads over night at 4 °C on a rotation wheel. The beads were washed three times in ice-cold immunoprecipitation buffer followed by three washes in water. Subsequently, the enriched peptides were purified and desalted with C18 StageTips. The peptides which did not bind to the immunoaffinity beads were used for subsequent phosphoproteome profiling. Therefore, samples were fractionated by strong cation exchange (SCX) chromatography. Five μg of each fraction were again used for proteome profiling, whereas the remaining sample was used for TiO2 (GL Sciences, Torrance, CA) enrichment of phosphorylated peptides, according to (23Meierhofer D. Weidner C. Hartmann L. Mayr J.A. Han C.-T. Schroeder F.C. Sauer S. Protein sets define disease states and predict in vivo effects of drug treatment.Mol. Cell. Proteomics. 2013; 12: 1965-1979Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). All SAX and SCX fractions, as well as the PTM scans, were allocated to the corresponding replicate and analyzed jointly by MaxQuant (Fig. 1). LC-MS/MS was carried out by nanoflow reverse phase liquid chromatography (Dionex Ultimate 3000, Thermo Scientific, Waltham, MA) coupled online to a Q-Exactive Plus Orbitrap mass spectrometer (Thermo Scientific, Waltham, MA). Briefly, the LC separation was performed using a PicoFrit analytical column (75 μm ID × 25 cm long, 15 μm Tip ID (New Objectives, Woburn, MA) in-house packed with 3-μm C18 resin (Reprosil-AQ Pur, Dr. Maisch, Ammerbuch-Entringen, Germany). Peptides were eluted using a nonlinear gradient from 2 to 40% solvent B 79.9% acetonitrile, 20% H2O, 0.1% formic acid). 3 kV were applied for nanoelectrospray over 210 min at a flow rate of 266 nL/min (solvent A: 99.9% H2O, 0.1% formic acid; solvent B: generation. A cycle of one full FT scan mass spectrum (300–1750 m/z, resolution of 70,000 at m/z 200, AGC target 1e6) was followed by 12 data-dependent MS/MS scans (resolution of 35,000, AGC target 5e5) with normalized collision energy of 25 eV. To avoid repeated sequencing of the same peptides a dynamic exclusion window of 30 s was used. In addition, only the peptide charge states between two to eight were sequenced, in the case of ubiquitinated peptide samples, only charge states three to eight were allowed. Raw MS data were processed with MaxQuant software (v1.5.0.0) (26Cox J. Mann M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.Nat. Biotechnol. 2008; 26: 1367-1372Crossref PubMed Scopus (9154) Google Scholar) with the Andromeda search engine (27Cox J. Neuhauser N. Michalski A. Scheltema R. a Olsen J.V. Mann M. Andromeda: a peptide search engine integrated into the MaxQuant environment.J. Proteome Res. 2011; 10: 1794-1805Crossref PubMed Scopus (3450) Google Scholar) and searched against the human proteome database UniProtKB with 69,714 entries released in 06/2015. Additionally, the "requantify" and "match between runs" features were implemented to increase the number of peptides which can be used for quantification. A false discovery rate (FDR) of 0.01 for proteins and peptides, a minimum peptide length of seven amino acids, a mass tolerance of 4.5 ppm for precursor, and 20 ppm for fragment ions were required. A minimum Andromeda score of 0 and 40 (delta score 0 and 9) for unmodified peptides and modified peptides was applied. A maximum of two missed cleavages was allowed for the tryptic digest, except for ubiquitination where three missed cleavages were allowed. Following SILAC modifications were used: 13C615N4-arginine and 13C615N2-lysine. Cysteine carbamidomethylation was set as fixed modification, whereas N-terminal acetylation, methionine oxidation, diGly modification of lysine and phosphorylation of serine, threonine, and tyrosine were set as variable modifications. The two later PTM's were only used for the according enriched fractions. MaxQuant processed output files can be found in supplemental Table S2, showing peptide and protein identification, accession numbers, % sequence coverage of the protein, posterior error probability (PEP) values, and normalized SILAC ratios. To correct for mixing errors of total protein amounts, the SILAC ratios were normalized for each LC-MS run separately, according to (26Cox J. Mann M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.Nat. Biotechnol. 2008; 26: 1367-1372Crossref PubMed Scopus (9154) Google Scholar). Contaminants as well as proteins identified by site modification and proteins derived from the reversed part of the decoy database were strictly excluded from further analysis. For PTM analysis, only high confidence sites, defined by a localization probability higher than 0.75 for phosphorylation sites and 0.9 for ubiquitination sites, PEP score smaller than 0.01 and an Andromeda score difference between the best and second best peptide match larger than five, were considered (28Iesmantavicius V. Weinert B.T. Choudhary C. Convergence of ubiquitylation and phosphorylation signaling in rapamycin-treated yeast cells.Mol. Cell. Proteomics. 2014; 13: 1979-1992Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). All PTM analyses were performed with these high confidence criteria. For metabolome data sets, a two-sample t test, and for the proteome data sets, a one sample t test was performed. Multiple test correction was done by Benjamini-Hochberg (BH) with a FDR of 0.05. Significantly regulated metabolites and proteins were marked by a plus sign in according (supplemental Tables S2 and S3). For comprehensive proteome data analyses, gene set enrichment analysis (GSEA, v2.1.0) (29Subramanian A. Tamayo P. Mootha V.K. Mukherjee S. Ebert B.L. Gillette M.A. Paulovich A. Pomeroy S.L. Golub T.R. Lander E.S. Mesirov J.P. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15545-15550Crossref PubMed Scopus (26559) Google Scholar) was applied to see if a priori defined sets of proteins show statistically significant, concordant differences between ρ0 and parental state. Only proteins with valid values in all replicates were averaged and used for GSEA analysis and log2 transformation (supplemental Table S2). GSEA default settings were used, except the minimum size exclusion was set to five and reactome v5.0 was used as gene set database. The cut off for significantly regulated pathways was set to ≤ 0.05 p value and ≤ 0.25 FDR. Only pathways with significant values in merged replicates were extracted, average p- and FDR values are shown in Table I.Table ISignificantly regulated Reactome pathways in ρ0 versus parental cells, analyzed by GSEA (thresholds: p value ≤ 0.05; q-value ≤ 0.25)Reactome pathwayGSEAGlobaltestProtein entriesp-Valueq-Valuep-Valueq-Value> down-regulated pathways in ρ0 cellsRespiratory electron transport410.000.000.000.00TCA cycle and respiratory electron transport770.000.000.000.00Respiratory electron transport ATP synthesis by chemiosmotic coupling and heat production by uncoupli
Referência(s)