Expression of the MOZ-TIF2 oncoprotein in mice represses senescence
2016; Elsevier BV; Volume: 44; Issue: 4 Linguagem: Inglês
10.1016/j.exphem.2015.12.006
ISSN1873-2399
AutoresAnne Largeot, Flor M. Pérez-Campo, Elli Marinopoulou, Michael Lie‐A‐Ling, Valérie Kouskoff, Georges Lacaud,
Tópico(s)Protein Degradation and Inhibitors
Resumo•MOZ-TIF2 transformation is associated with inhibition of senescence through repression of the CDKN2A locus.•MOZ histone acetyltransferase activity of MOZ-TIF2 is required for the inhibition of senescence.•MOZ-TIF2 acts on the p53 apoptosis-versus-senescence balance. The MOZ-TIF2 translocation, which fuses monocytic leukemia zinc finger protein (MOZ) histone acetyltransferase (HAT) with the nuclear co-activator TIF2, is associated with the development of acute myeloid leukemia. We recently found that in the absence of MOZ HAT activity, p16 INK4a transcriptional levels are significantly increased, triggering an early entrance into replicative senescence. Because oncogenic fusion proteins must bypass cellular safeguard mechanisms, such as senescence and apoptosis, to induce leukemia, we hypothesized that this repressive activity of MOZ over p16 INK4a transcription could be preserved, or even reinforced, in MOZ leukemogenic fusion proteins, such as MOZ-TIF2. We describe here that, indeed, MOZ-TIF2 silences expression of the CDKN2A locus (p16 INK4a and p19 ARF), inhibits the triggering of senescence and enhances proliferation, providing conditions favorable to the development of leukemia. Furthermore, we describe that abolishing the MOZ HAT activity of the fusion protein leads to a significant increase in expression of the CDKN2A locus and the number of hematopoietic progenitors undergoing senescence. Finally, we report that inhibition of senescence by MOZ-TIF2 is associated with increased apoptosis, suggesting a role for the fusion protein in p53 apoptosis-versus-senescence balance. Our results underscore the importance of the HAT activity of MOZ, preserved in the fusion protein, for repression of the CDKN2A locus transcription and the subsequent block of senescence, a necessary step for the survival of leukemic cells. The MOZ-TIF2 translocation, which fuses monocytic leukemia zinc finger protein (MOZ) histone acetyltransferase (HAT) with the nuclear co-activator TIF2, is associated with the development of acute myeloid leukemia. We recently found that in the absence of MOZ HAT activity, p16 INK4a transcriptional levels are significantly increased, triggering an early entrance into replicative senescence. Because oncogenic fusion proteins must bypass cellular safeguard mechanisms, such as senescence and apoptosis, to induce leukemia, we hypothesized that this repressive activity of MOZ over p16 INK4a transcription could be preserved, or even reinforced, in MOZ leukemogenic fusion proteins, such as MOZ-TIF2. We describe here that, indeed, MOZ-TIF2 silences expression of the CDKN2A locus (p16 INK4a and p19 ARF), inhibits the triggering of senescence and enhances proliferation, providing conditions favorable to the development of leukemia. Furthermore, we describe that abolishing the MOZ HAT activity of the fusion protein leads to a significant increase in expression of the CDKN2A locus and the number of hematopoietic progenitors undergoing senescence. Finally, we report that inhibition of senescence by MOZ-TIF2 is associated with increased apoptosis, suggesting a role for the fusion protein in p53 apoptosis-versus-senescence balance. Our results underscore the importance of the HAT activity of MOZ, preserved in the fusion protein, for repression of the CDKN2A locus transcription and the subsequent block of senescence, a necessary step for the survival of leukemic cells. The monocytic leukemia zinc finger protein (MOZ, MYST3, KAT6A) is the founding member of the MYST family of histone acetyltransferases (HATs) [1Avvakumov N. Côté J. Functions of myst family histone acetyltransferases and their link to disease.Subcell Biochem. 2007; 41: 295-317PubMed Google Scholar, 2Borrow J. Stanton Jr., V.P. Andresen J.M. et al.The translocation t(8;16)(p11;p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB-binding protein.Nat Genet. 1996; 14: 33-41Crossref PubMed Scopus (647) Google Scholar, 3Perez-Campo F.M. Costa G. Lie-A-Ling M. Kouskoff V. Lacaud G. The MYSTerious MOZ, a histone acetyltransferase with a key role in haematopoiesis.Immunology. 2013; 139: 161-165Crossref PubMed Scopus (37) Google Scholar]. MOZ is essential for hematopoietic stem cell (HSC) emergence and self-renewal [4Katsumoto T. Aikawa Y. Iwama A. et al.MOZ is essential for maintenance of hematopoietic stem cells.Genes Dev. 2006; 20: 1321-1330Crossref PubMed Scopus (141) Google Scholar, 5Thomas T. Corcoran L.M. Gugasyan R. et al.Monocytic leukemia zinc finger protein is essential for the development of long-term reconstituting hematopoietic stem cells.Genes Dev. 2006; 20: 1175-1186Crossref PubMed Scopus (125) Google Scholar, 6Perez-Campo F.M. Borrow J. Kouskoff V. Lacaud G. The histone acetyl transferase activity of monocytic leukemia zinc finger is critical for the proliferation of hematopoietic precursors.Blood. 2009; 113: 4866-4874Crossref PubMed Scopus (68) Google Scholar]. The gene encoding MOZ was initially identified in several recurrent chromosomal translocations, with either CBP, p300, or TIF2/NCOA2 found in a distinct subtype of acute myeloid leukemia (AML) with French–American–British M4/5 morphology characterized by a poor prognosis [2Borrow J. Stanton Jr., V.P. Andresen J.M. et al.The translocation t(8;16)(p11;p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB-binding protein.Nat Genet. 1996; 14: 33-41Crossref PubMed Scopus (647) Google Scholar, 7Kitabayashi I. Aikawa Y. Yokoyama A. et al.Fusion of MOZ and p300 histone acetyltransferases in acute monocytic leukemia with a t(8;22)(p11;q13) chromosome translocation.Leukemia. 2001; 15: 89-94Crossref PubMed Scopus (132) Google Scholar, 8Carapeti M. Aguiar R.C. Goldman J.M. Cross N.C. A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia.Blood. 1998; 91: 3127-3133Crossref PubMed Google Scholar, 9Chaffanet M. Gressin L. Preudhomme C. Soenen-Cornu V. Birnbaum D. Pébusque M.J. MOZ is fused to p300 in an acute monocytic leukemia with t(8;22).Genes Chromosomes Cancer. 2000; 28: 138-144Crossref PubMed Scopus (149) Google Scholar, 10Esteyries S. Perot C. Adelaide J. Imbert M. Lagarde A. Paulas C. NCOA3, a new fusion partner for MOZ/MYST3 in M5 acute myeloid leukemia.Leukemia. 2008; 22: 663-665Crossref PubMed Scopus (51) Google Scholar]. Remarkably, the HAT domain of MOZ is preserved in the fusion protein, and all the fusion partners of MOZ are themselves directly (CBP, P300) or indirectly (TIF2 can interact with CBP via the CBP interaction domain or CID [11Demarest S.J. Martinez-Yamout M. Chung J. et al.Mutual synergistic folding in recruitment of CBP/p300 by p160 nuclear receptor coactivators.Nature. 2002; 415: 549-553Crossref PubMed Scopus (353) Google Scholar]) involved in posttranslational histone modifications and transcriptional regulation. This observation led to the proposition that abnormal histone acetylation driven by the fusion proteins might be at the origin of the leukemic transformation [12Kitabayashi I. Aikawa Y. Nguyen L.A. Yokoyama A. Ohki M. Activation of AML1-mediated transcription by MOZ and inhibition by the MOZ–CBP fusion protein.EMBO J. 2001; 20: 7184-7196Crossref PubMed Scopus (179) Google Scholar, 13Deguchi K. Ayton P.M. Carapeti M. et al.MOZ-TIF2-induced acute myeloid leukemia requires the MOZ nucleosome binding motif and TIF2-mediated recruitment of CBP.Cancer Cell. 2003; 3: 259-271Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar]. Alternatively, it has been proposed that the ability of MOZ-TIF2 to deplete CBP, particularly from the promyelocytic leukemia (PML) bodies, results in subversion of normal gene expression leading to development of leukemia [14Kindle K.B. Troke P.J. Collins H.M. et al.MOZ-TIF2 inhibits transcription by nuclear receptors and p53 by impairment of CBP function.Mol Cell Biol. 2005; 25: 988-1002Crossref PubMed Scopus (54) Google Scholar, 15Collins H.M. Kindle K.B. Matsuda S. et al.MOZ-TIF2 alters cofactor recruitment and histone modification at the RARbeta2 promoter: Differential effects of MOZ fusion proteins on CBP- and MOZ-dependent activators.J Biol Chem. 2006; 281: 17124-17133Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 16Kindle K.B. Collins H.M. Heery D.M. MOZ-TIF2-mediated destruction of CBP/p300 is blocked by calpain inhibitor 2.Leukemia. 2010; 24: 1359-1361Crossref PubMed Scopus (5) Google Scholar]. MOZ-TIF2 is able to immortalize murine hematopoietic progenitors in vitro and to recapitulate AML in vivo in murine and zebrafish models [13Deguchi K. Ayton P.M. Carapeti M. et al.MOZ-TIF2-induced acute myeloid leukemia requires the MOZ nucleosome binding motif and TIF2-mediated recruitment of CBP.Cancer Cell. 2003; 3: 259-271Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 17Huntly B.J. Shigematsu H. Deguchi K. et al.MOZ-TIF2, but not BCR-ABL, confers properties of leukemic stem cells to committed murine hematopoietic progenitors.Cancer Cell. 2004; 6: 587-596Abstract Full Text Full Text PDF PubMed Scopus (586) Google Scholar, 18Zhuravleva J. Paggetti J. Martin L. et al.MOZ/TIF2-induced acute myeloid leukaemia in transgenic fish.Br J Haematol. 2008; 143: 378-382Crossref PubMed Scopus (60) Google Scholar, 19Aikawa Y. Katsumoto T. Zhang P. et al.PU.1-mediated upregulation of CSF1R is crucial for leukemia stem cell potential induced by MOZ-TIF2.Nat Med. 2010; 16 (1p following 585): 580-585Crossref PubMed Scopus (75) Google Scholar]. Previous reports have indicated that a functional CID or MOZ HAT activity is required to increase the proliferative potential of hematopoietic progenitors in vitro, and to induce AML in vivo [13Deguchi K. Ayton P.M. Carapeti M. et al.MOZ-TIF2-induced acute myeloid leukemia requires the MOZ nucleosome binding motif and TIF2-mediated recruitment of CBP.Cancer Cell. 2003; 3: 259-271Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 17Huntly B.J. Shigematsu H. Deguchi K. et al.MOZ-TIF2, but not BCR-ABL, confers properties of leukemic stem cells to committed murine hematopoietic progenitors.Cancer Cell. 2004; 6: 587-596Abstract Full Text Full Text PDF PubMed Scopus (586) Google Scholar, 20Shima H. Yamagata K. Aikawa Y. et al.Bromodomain-PHD finger protein 1 is critical for leukemogenesis associated with MOZ-TIF2 fusion.Int J Hematol. 2014; 99: 21-31Crossref PubMed Scopus (25) Google Scholar]. Cells acquiring oncogenic mutations or translocations need to evade defense mechanisms, such as senescence and apoptosis, to survive and proliferate. In this context, MOZ has been found to regulate, upon cellular stress, expression of the tumor suppressor gene p21 and to increase premature senescence through acetylation of P53 [21Rokudai S. Aikawa Y. Tagata Y. Tsuchida N. Taya Y. Kitabayashi I. Monocytic leukemia zinc finger (MOZ) interacts with p53 to induce p21 expression and cell-cycle arrest.J Biol Chem. 2009; 284: 237-244Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 22Rokudai S. Laptenko O. Arnal S.M. Taya Y. Kitabayashi I. Prives C. MOZ increases p53 acetylation and premature senescence through its complex formation with PML.Proc Natl Acad Sci USA. 2013; 110: 3895-3900Crossref PubMed Scopus (98) Google Scholar]. In contrast to this positive role of MOZ in inducing senescence, we, and others, have reported that in the absence of MOZ, mouse embryonic fibroblasts (MEFs) undergo an early entrance into replicative senescence mediated by the upregulation of expression from the CDKN2A locus (p16 INK4a and p19 ARF) [23Perez-Campo F.M. Costa G. Lie-A-Ling M. Stifani S. Kouskoff V. Lacaud G. MOZ-mediated repression of p16(INK) (4) (a) is critical for the self-renewal of neural and hematopoietic stem cells.Stem Cells. 2014; 32: 1591-1601Crossref PubMed Scopus (49) Google Scholar, 24Sheikh B.N. Phipson B. El-Saafin F. et al.MOZ (MYST3, KAT6A) inhibits senescence via the INK4A-ARF pathway.Oncogene. 2015; 34: 5807-5820Crossref PubMed Scopus (48) Google Scholar]. These observations raise the possibility that this repressive activity could be exacerbated in MOZ leukemic fusion proteins. In this work, we sought to investigate this possibility by determining the effect of MOZ-TIF2 expression on the transcriptional levels of p16 INK4a/p19 ARF and proliferation of the targeted cells. We also investigated the relevance of the HAT activity of MOZ, preserved in all known leukemic proteins originated by MOZ translocation, in this context. Bone marrow cells were stained with a biotinylated anti-cKit antibody (BD Biosciences, clone 2B8m 553353) and incubated with the anti-biotin magnetic MACS beads (Miltenyi Biotec). cKit+ cells were enriched using an LS column and a MACS Separator magnetic isolation device (Miltenyi Biotec). Embryoid bodies (EBs), generated as previously described [25Costa G. Mazan A. Gandillet A. Pearson S. Lacaud G. Kouskoff V. SOX7 regulates the expression of VE-cadherin in the haemogenic endothelium at the onset of haematopoietic development.Development. 2012; 139: 1587-1598Crossref PubMed Scopus (63) Google Scholar], or MEFs were trypsinized (TryplE, Gibco). Stained single-cell suspensions were analyzed on a FACScan or a FACS Calibur flow cytometer (Becton Dickinson) or sorted on a FACS Vantage cell sorter (Becton Dickinson). Cell cycle analysis was performed using the Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Thermo Fisher Scientific). Apoptosis analysis was performed using the PE Annexin V Apoptosis Detection Kit (BD Biosciences). Senescence-associated β-galactosidase (SA-β-Gal) activity was detected using the Senescence β-galactosidase Staining Kit from Cell Signalling. Chromatin immunoprecipitation (ChIP) was performed using the High Cells Chip Kit (Diagenode) following the instructions of the manufacturer. Additional information concerning other techniques and materials can be found in the Supplementary Methods (online only, available at www.exphem.org) [26Gilham D.E. Lie-A-Ling M. Taylor N. Hawkins R.E. Cytokine stimulation and the choice of promoter are critical factors for the efficient transduction of mouse T cells with HIV-1 vectors.J Gene Med. 2010; 12: 129-136Abstract Full Text PDF PubMed Google Scholar, 27Chappell S.A. Edelman G.M. Mauro V.P. A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity.Proc Natl Acad Sci USA. 2000; 97: 1536-1541Crossref PubMed Scopus (206) Google Scholar, 28Szymczak A.L. Workman C.J. Wang Y. et al.Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector.Nat Biotechnol. 2004; 22: 589-594Crossref PubMed Scopus (918) Google Scholar, 29Morita S. Kojima T. Kitamura T. Plat-E: An efficient and stable system for transient packaging of retroviruses.Gene Ther. 2000; 7: 1063-1066Crossref PubMed Scopus (1359) Google Scholar]. To assess the effect of MOZ-TIF2 oncoprotein on the transcriptional levels of the CDKN2A locus (p16 INK4a /p19 ARF ), we first transduced either wild-type (WT) or MOZ HAT–/– MEFs with two vectors linking MOZ-TIF2 to GFP either through a small S8 IRES or through a self-cleaving 2A peptide sequence (Supplementary Figure E1, online only, available at www.exphem.org). Untransduced cells, as well as cells transduced with a lentivirus expressing only GFP (EF1GFP), were used as controls (Fig. 1 A). Polymerase chain reactions (PCRs) confirmed the presence of MOZ-TIF2 transcripts in the transduced cells (Fig. 1B). A significant reduction in p16 INK4a/p19 ARF mRNA levels was observed not only in WT MEFs, but also in MOZ HAT–/– MEFs, which, as previously reported [23Perez-Campo F.M. Costa G. Lie-A-Ling M. Stifani S. Kouskoff V. Lacaud G. MOZ-mediated repression of p16(INK) (4) (a) is critical for the self-renewal of neural and hematopoietic stem cells.Stem Cells. 2014; 32: 1591-1601Crossref PubMed Scopus (49) Google Scholar], express higher levels of p16 INK4a/p19 ARF than the WT cells (Fig. 1C). As the GFP-2A-MOZ-TIF2 lentivirus (2AMT2) had higher transduction efficiency (Fig. 1A), we chose this virus to perform the subsequent experiments.Figure 1(A) Flow cytometry profile of untransduced MEFs (UT) and MEFs transduced with the different lentiviruses (EF1GFP, 2AGFP_MOZTIF2, and S8MOZ-TIF2) and therefore expressing GFP. Numbers represent the percentages of cells positive for GFP 48 hours after transduction in each case (n = 3 for each genotype). Multiplicity of infection (MOI) = 30. (B) PCR for the MOZ-TIF2 transcript on untransduced cells and MEFs transduced with the different lentiviruses. (C) Quantitative PCR revealing the relative expression levels of p16 INK4a/p19 ARF in WT and Moz HAT–/– MEFs (passage 3) untransduced or transduced with the different lentiviruses. The transcript levels were normalized to β-actin for all reactions. Values reflect averages of triplicate samples. Bars represent standard errors of the mean values. (D) Growth curves of cultures of WT and Moz HAT–/– MEFs transduced with the different lentiviruses. The graph represents the average values from three independent cultures. Passage numbers are indicated. Bars represent standard errors of the mean values. (E) Flow cytometry profile of untransduced (UT) CD34+cKit+ hematopoietic progenitors and the same cells transduced with either EF1GFP or 2AGFP_MOZTIF2 lentivirus. Numbers represent the percentages of cells positive for GFP 48 hours after transduction in each case. MOI = 50. (F) Specific PCR for the detection of MOZ-TIF2 transcripts in transduced CD34+cKit+ cells. (G) Growth curves of WT CD34+cKit+ cultures transduced with the different lentiviruses. The graph represents the average values from three independent cultures. Passage numbers are indicated. Bars indicate standard errors of the mean values.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next analyzed whether the lower levels of the CDKN2A locus transcription were correlated with changes in proliferation upon successive passages. As expected, the MOZ HAT–/– MEFs proliferated less than the WT MEFs. This difference was maintained following transduction with EF1GFP viruses (Fig. 1D). In contrast, expression of MOZ-TIF2 conferred a clear growth advantage to both WT and MOZ HAT–/– MEFs (Fig. 1D). These results suggest that overexpression of the MOZ-TIF2 fusion protein is able to counteract the effect of the native MOZ protein and its HAT deficient version. To test whether the effect of MOZ-TIF2 expression was also observed in hematopoietic progenitors, we transduced WT CD34+cKit+ cells isolated from day 6 in vitro differentiated embryonic stem cells with the 2AMT2 lentivirus (Fig. 1E). PCRs on sorted GFP+ cells confirmed the presence of MOZ-TIF2 transcripts in these cells (Fig. 1F). Similarly to MEFs, CD34+cKit+ hematopoietic progenitors transduced with MOZ-TIF2 had an increased proliferation rate compared with the control cells (Fig. 1G). We then studied the effect of MOZ-TIF2 on senescence in leukemic cells transformed with this fusion protein. cKit+ cells isolated from adult WT mouse bone marrow were transduced with MOZ-TIF2 and control retroviruses (Fig. 2 A). As previously described [17Huntly B.J. Shigematsu H. Deguchi K. et al.MOZ-TIF2, but not BCR-ABL, confers properties of leukemic stem cells to committed murine hematopoietic progenitors.Cancer Cell. 2004; 6: 587-596Abstract Full Text Full Text PDF PubMed Scopus (586) Google Scholar, 20Shima H. Yamagata K. Aikawa Y. et al.Bromodomain-PHD finger protein 1 is critical for leukemogenesis associated with MOZ-TIF2 fusion.Int J Hematol. 2014; 99: 21-31Crossref PubMed Scopus (25) Google Scholar], cells transduced with MOZ-TIF2, but not with the GFP control viruses, could be serially replated in vitro in methylcellulose cultures (Fig. 2B), presented a blast morphology (Fig. 2C, D), and expressed high levels of the homeotic gene HoxA9 (Fig. 2E). Furthermore, these cells, when injected into sublethally irradiated recipients, induced the development of fully penetrant leukemia with concomitant invasion of hematopoietic organs with GFP+ (MOZ-TIF2-expressing) cells (Fig. 2F). This leukemic transformation induced by MOZ-TIF2 was associated with a decrease in expression of both genes encoded in the CDKN2A locus, p16 INK4a and p19 ARF (Fig. 2G), a decrease in p16INK4a protein level (Fig. 2H), and a marked increase in cell division (Fig. 2I). Accordingly, only a low percentage of cells expressing the MOZ-TIF2 fusion protein were positive for SA-β-Gal (Fig. 2J), in contrast to control GFP+ cells. In agreement with these results, cells transduced with the MOZ-TIF2 fusion protein also expressed much lower levels of interleukin (IL)-6, a member of the senescence-associated secretory pathway (Fig. 2K), compared with the cells transduced with the control vector. Together, these results clearly indicate that expression of the MOZ-TIF2 fusion protein, though inducing the development of leukemia, inhibits the triggering of senescence.Figure 2(A) Schematic representation of the experimental design. Bone marrow cKit+ cells infected with a retrovirus encoding MOZ-TIF2 were tested for their leukemic potential and senescence status. (B) Serial replating of MOZ-TIF2 (MT2)-expressing cells and GFP control cells (n = 3). (C) Photographs of the colonies after the second replating. Representative images from three independent experiments. (D) MGG staining of cytospin from the second replating. Representative images from three independent experiments. (E) Analysis of HOXA9 transcript levels in cKit+ expressing MOZ-TIF2 or the control virus (n = 3). (F) Flow cytometry detection of MOZ-TIF2-expressing cells (GFP+) in the bone marrow (BM) and the spleen of mice culled because of sickness. Representative FACS plots of five mice. (G) Analysis of p16 INK4a/p19 ARF transcript levels in cKit+ expressing MOZ-TIF2 or cells transduced with the control virus (n = 3). (H) Western blot analysis for p16INK4a protein levels in the MOZ-TIF2 and control cells. Results are representative of two independent experiments. (I) Flow cytometry analysis of cell cycle. (J) Photographs of MT2 and control cells after SA-β-Gal staining and quantification (n = 3). (K) Analysis of IL6 transcript levels in cKit+ expressing MOZ-TIF2 or in control cells (n = 3).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To determine the relevance of MOZ HAT activity, we then transduced cells with a mutated version of MOZ-TIF2 (Q654E/G657E) that abrogates this activity [20Shima H. Yamagata K. Aikawa Y. et al.Bromodomain-PHD finger protein 1 is critical for leukemogenesis associated with MOZ-TIF2 fusion.Int J Hematol. 2014; 99: 21-31Crossref PubMed Scopus (25) Google Scholar]. We detected dramatically higher expression levels of p16 Ink4a/p19ARF mRNA, p16Ink4 protein, and SA-β-Gal in these cells than in cells transduced with MOZ-TIF2-expressing viruses (Fig. 3 A–C). These results suggest that the HAT activity of MOZ is crucial to avoid replicative senescence.Figure 3(A) Analysis of p16 INK4a/p19 ARF transcript levels in cKit+ cells expressing MOZ-TIF2, MOZ-TIF2 with the mutated HAT domain of MOZ, or the control virus (n = 2). (B) Western blot analysis of p16INK4a protein levels in the cells expressing the mutated form of MOZ-TIF2 compared with WT MOZ-TIF2 cells. (C) Photographs of cells expressing either the WT or the mutant MOZ-TIF2 fusion protein and control cells after SA-β-Gal staining (left) and quantification (right) (n = 3). (D) ChIP analysis of the recruitment of the Ty1-tagged MOZ-TIF2 using an anti-Ty1 antibody (n = 2). (E) Analysis of p53 transcript levels in cKit+ expressing MOZ-TIF2 or the control virus (n = 3). (F) Western blot analysis of p53 and p53 acetylated at lysine 120 (p53K120) protein levels in cells expressing MOZ-TIF2 or control cells. (G) Analysis of p21 transcript levels in cKit+ expressing MOZ-TIF2 or the control virus (n = 3). (H) Flow cytometry analysis of apoptosis using annexin V and 7ADD staining. Results are representative images from two independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next wanted to check if the repression of p16 INKa was a direct effect of the binding of the MOZ-TIF2 fusion protein to the p16 INKa promoter. We therefore performed chromatin immunoprecipitation (ChIP) analysis using a Ty1-tagged MOZ-TIF2. Although we detected good enrichment of the fusion protein at the HOXA9 promoter (a known target of MOZ or MOZ-TIF2) [20Shima H. Yamagata K. Aikawa Y. et al.Bromodomain-PHD finger protein 1 is critical for leukemogenesis associated with MOZ-TIF2 fusion.Int J Hematol. 2014; 99: 21-31Crossref PubMed Scopus (25) Google Scholar, 30Paggetti J. Largeot A. Aucagne R. et al.Crosstalk between leukemia-associated proteins MOZ and MLL regulates HOX gene expression in human cord blood CD34+ cells.Oncogene. 2010; 29: 5019-5031Crossref PubMed Scopus (39) Google Scholar], compared with the two negative controls (condensed region in chromosome 2 or promoter of the TBP gene), we did not detect clear enrichment of MOZ-TIF2 recruitment into the p16 Ink4a promoter (Fig. 3D). These data suggest that MOZ-TIF2 is repressing p16 INKa expression in an indirect manner. In addition to its role in inhibition of senescence through the CDKN2A locus, MOZ has been reported to acetylate p53 to activate p21-dependent senescence after DNA damage [21Rokudai S. Aikawa Y. Tagata Y. Tsuchida N. Taya Y. Kitabayashi I. Monocytic leukemia zinc finger (MOZ) interacts with p53 to induce p21 expression and cell-cycle arrest.J Biol Chem. 2009; 284: 237-244Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 22Rokudai S. Laptenko O. Arnal S.M. Taya Y. Kitabayashi I. Prives C. MOZ increases p53 acetylation and premature senescence through its complex formation with PML.Proc Natl Acad Sci USA. 2013; 110: 3895-3900Crossref PubMed Scopus (98) Google Scholar]. We therefore investigated the status of this pathway in MOZ-TIF2 leukemic cells and detected an increase in the transcriptional levels of p53 (Fig. 3E) in these cells. Furthermore expression of MOZ-TIF2 was associated with K120 acetylation of p53, whereas no acetylated p53 was detected in cells expressing the control vector or the mutated MOZ-TIF2 (Fig. 3F). Surprisingly, p21 transcription levels were however reduced, and not increased, upon expression of the MOZ-TIF2 fusion protein (Fig. 3G). Although this is consistent with the decrease in the number of cells undergoing replicative senescence, it does not reflect the previously described positive effect of K120 acetylation of p53 on p21 expression [21Rokudai S. Aikawa Y. Tagata Y. Tsuchida N. Taya Y. Kitabayashi I. Monocytic leukemia zinc finger (MOZ) interacts with p53 to induce p21 expression and cell-cycle arrest.J Biol Chem. 2009; 284: 237-244Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 22Rokudai S. Laptenko O. Arnal S.M. Taya Y. Kitabayashi I. Prives C. MOZ increases p53 acetylation and premature senescence through its complex formation with PML.Proc Natl Acad Sci USA. 2013; 110: 3895-3900Crossref PubMed Scopus (98) Google Scholar, 31Sykes S.M. Mellert H.S. Holbert M.A. et al.Acetylation of the p53 DNA-binding domain regulates apoptosis induction.Mol Cell. 2006; 24: 841-851Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar, 32Tang Y. Luo J. Zhang W. Gu W. Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis.Mol Cell. 2006; 24: 827-839Abstract Full Text Full Text PDF PubMed Scopus (558) Google Scholar]. Furthermore we detected a striking increase in cells undergoing apoptosis in MOZ-TIF2 leukemic cells compared to cells transduced with the control virus (Fig. 3H). Together our results suggest that MOZ-TIF2 alters the p53 apoptosis-versus-senescence balance in favor of apoptosis. The exact molecular regulation of this balance, and in particular the role of acetylation of p53 on lysine K120 in this process, is not yet fully understood. Indeed, although p53 K120 acetylation and p53-dependent p21 transcription are prevented by deletion of MOZ or TIP60, suggesting a direct correlation between these events [21Rokudai S. Aikawa Y. Tagata Y. Tsuchida N. Taya Y. Kitabayashi I. Monocytic leukemia zinc finger (MOZ) interacts with p53 to induce p21 expression and cell-cycle arrest.J Biol Chem. 2009; 284: 237-244Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 22Rokudai S. Laptenko O. Arnal S.M. Taya Y. Kitabayashi I. Prives C. MOZ increases p53 acetylation and premature senescence through its complex formation with PML.Proc Natl Acad Sci USA. 2013; 110: 3895-3900Crossref PubMed Scopus (98) Google Scholar, 33Berns K. Marielle Hijmans E. Mullenders J. et al.A large-scale RNAi screen in human cells identifies new components of the p53 pathway.Nature. 2004; 428: 431-437Crossref PubMed Scopus (940) Google Scholar], mutation of K120 of p53 results in a decrease in the capacity of p53 to activate apoptosis, but has, in contrast, no effect on p21 transcription [31Sykes S.M. Mellert H.S. Holbert M.A. et al.Acetylation of the p53 DNA-binding domain regulates apoptosis induction.Mol Cell. 2006; 24: 841-851Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar, 32Tang Y. Luo J. Zhang W. Gu W. Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis.Mol Cell. 2006; 24: 827-839Abstract Full Text Full Text PDF PubMed Scopus (558) Google Scholar]. We conclude from this work that the expression of MOZ-TIF2 fusion protein represses the transcription of p16 INK4a and p19 ARF and blocks senescence, and that the MOZ HAT activity of the fusion protein is crucial for this repressive activity. We propose that silencing of the CDKN2A locus by MOZ fusion proteins could be an important step in the expansion of cells harboring these oncogenic mutations. Moreover, MOZ-TIF2 seems to be acting on p53 apoptosis-versus-senescence balance. Finally, as p16 INK4a expression is a frequent target gene inactivated in human cancers, our work also raises the prospect that targeting the epigenetic HAT activity of MOZ [34Falk H. Connor T. Yang H. et al.An efficient high-throughput screening method for MYST family acetyltransferases, a new class of epigenetic drug targets.J Biomol Screen. 2011; 16: 1196-1205Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar] could represent an interesting strategy to induce senescence and eliminate oncogenic cells. Work in our laboratory is supported by the Leukemia and Lymphoma Research Foundation (LLR), Cancer Research UK (CRUK), and the Biotechnology and Biological Sciences Research Council (BBSRC). AL designed and performed experiments, analyzed data, and wrote the article. FMPC initiated the project, designed and performed experiments, analyzed data, and wrote the article. ML and EM developed analytical tools. VK gave conceptual advice, discussed the results and implications, and commented on the article. GL gave conceptual advice, discussed the results and implications, and wrote the article. The authors declare no competing financial interests. See Supplementary Table E1. The MOZ-TIF2 cDNA and the retroviral MSCV-MOZ-TIF2-IRES-GFP construct were kind gifts from Dr. Brian Huntly. To perform chromatin immunoprecipitation (ChIP), a 3XTy1 tag was added in frame at the 5′ extremity of the MOZ-TIF2 coding sequence. The mutant was generated using the Quickchange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) by two steps of mutagenesis. The sequences of the primers used for mutagenesis are: From WT to G657E:5′-cctcaataccagcgtaaggaatatggcaggtttctcatcg5′-cgatgagaaacctgccatattccttacgctggtattgagg From G657E to Q654E/G657E:5′- ctgccatattccttacgctcgtattgaggaagaatcatta5′-taatgattcttcctcaatacgagcgtaaggaatatggcag All third-generation lentiviral transfer vectors used in this study have the same backbone as EF1-eGFP [26Gilham D.E. Lie-A-Ling M. Taylor N. Hawkins R.E. Cytokine stimulation and the choice of promoter are critical factors for the efficient transduction of mouse T cells with HIV-1 vectors.J Gene Med. 2010; 12: 129-136Abstract Full Text PDF PubMed Google Scholar] and were constructed by replacing the eGFP gene with the expression cassette of interest. The MOZ-TIF2 cDNA was cloned into PCR2.1 TOPO (Invitrogen), creating TOPO-MOZ-TIF2. For the bicistronic MOZ-TIF2_S8GFP lentiviral vector, the MOZ-TIF2 cDNA was cloned upstream of 8 repeats of the 9-nt IRES module from the Gtx 5′-UTR followed by eGFP [27Chappell S.A. Edelman G.M. Mauro V.P. A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity.Proc Natl Acad Sci USA. 2000; 97: 1536-1541Crossref PubMed Scopus (206) Google Scholar]. The GFP2a_MOZ-TIF2 lentiviral vector was constructed by fusing eGFP to the foot-and-mouth disease virus self-cleaving 2a peptide sequence (F2A) [28Szymczak A.L. Workman C.J. Wang Y. et al.Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector.Nat Biotechnol. 2004; 22: 589-594Crossref PubMed Scopus (918) Google Scholar] and the first 256 bp of the MOZ-TIF2 cDNA by PCR. The resulting fragment was sequenced and used to replace the first 256 bp of MOZ-TIF2 in TOPO-MOZ-TIF2, creating TOPO-GFP2a-MOZ-TIF2. Subsequently the GFP2a-MOZ-TIF2 cassette was cloned into the lentiviral backbone. Supplementary Figure E1 is a schematic of the MOZ-TIF2 vectors. See Supplementary Table E2. The VSVg pseudotyped lentiviral particles were produced using a third-generation self-inactivating lentiviral vector system. Briefly, viral supernatant was harvested from transfected HEK293T cells 2, 3, and 4 days posttransfection. Supernatant was passed through a 0.45-μm filter (Millipore), concentrated by ultracentrifugation (2 hours at 20,000 rpm, 47,000K, 4°C; Optima L-90K ultracentrifuge; Beckman Coulter) and resuspended in phosphate-buffered saline. Viral titres were expressed as HeLa cell transducing units per milliliter (TU/mL) as determined by flow cytometry for eGFP (FACS Calibur; Becton-Dickinson Biosciences) 72-h posttransduction. Retroviral particles were produced using the Plat-E packaging cell line as described previously [29Morita S. Kojima T. Kitamura T. Plat-E: An efficient and stable system for transient packaging of retroviruses.Gene Ther. 2000; 7: 1063-1066Crossref PubMed Scopus (1359) Google Scholar]. Briefly, viral supernatant was harvested from transfected Plat-E cells 2 and 3 days posttransfection. Supernatant was passed through a 0.45-μm filter (Millipore). Bone marrow from adult (10–14 weeks) WT mice was flushed from the femurs. After red blood cell lysis, the cells were stained with a biotinylated anti c-Kit antibody (BD Biosciences, Clone 2B8m 553353) and incubated with anti-biotin magnetic MACS beads (2 μL for 106 cells, Miltenyi Biotec). After being washed with 10% serum in phosphate-buffered saline, the c Kit+ cells were enriched using an LS column and the manual MACS Separator magnetic isolation device (Miltenyi Biotec) accordingly to the manufacturer's protocol. The c Kit+ cells were infected using retroviral supernatants and retronectin, following the manufacturer's protocol (Takara, Clontech). Briefly, 10 μg of retronectin was coated in a noncoated 48-well plate for 2 hours at room temperature, the plate was then blocked for 30 min with 1% phosphate-buffered saline–bovine serum albumin, and the retroviral supernatant was added to the well and centrifuged for 2 hours at 1,500g at 32°C. After removal of the supernatant, 50,000 cells were added, and cells were incubated from 24 to 48 hours. RNAs were extracted with the RNeasy kit from Qiagen. Half a microgram of RNA was subjected to reverse transcription using the high-capacity cDNA reverse transcription kit (Thermofisher Scientific). The Universal PCR Master Mix or the Power SYBR Green Master Mix (Thermofisher Scientific) was used for the quantitative PCRs. Forty-eight hours after infection, 10,000 cells infected with the retrovirus coding for MOZ-TIF2 IRES GFP or for GFP only were plated in a semisolid methylcellulose-based medium containing stem cell factor, interleukin-3, granulocyte–macrophage colony-stimulating factor, TPO (obtained from the supernatant of producing cell lines, 1/100 dilution), interleukin-11, erythropoietin, interleukin-6, and mouse colony-stimulating factor (R&D System), in a 35-mm dish (Corning). After 7 days in culture, the colonies were counted. The cells were then harvested and replated in a new dish. Fifty thousand cells were cytospun at 800 rpm for 5 min on a microscopy slide. The cells were then stained for 3 min in the May–Grunwald staining solution (VWR Chemicals), rinsed in water, and stained for 20 min in the Giemsa staining solution diluted 20 times in water (VWR Chemicals). Twenty-four hours after infection, 500,000 c Kit+ cells from PEP3 mice (CD45.1) infected with the MSCV-MOZ-TIF2-IRES-GFP retrovirus were injected into irradiated C57/Bl6 recipient mice (CD45.2). All animal work was performed under regulation in accordance with the UK Animal Scientific Procedures Act (ASPA) 1986. Animal experiments were approved by the Animal Welfare and Ethics Review Body (AWERB) of the Cancer Research UK Manchester Institute. Cell cycle analysis was performed using the Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit following the manufacturer's protocol (Thermo fisher scientific). After 30 min of incubation with EdU, the cells were fixed and permeabilized. Detection of EdU was performed with the Click-It dye conjugated with AF647, and DNA content was stained with FxViolet. Apoptosis analysis was performed using the PE Annexin V Apoptosis Detection Kit (BD Biosciences). The cells were washed and stained with 5 μL of PE Annexin V and 7 μL of 7-AAD for 15 min at room temperature in the dark. Thirty micrograms of proteins were loaded in a precast gel (Nupage, Invitrogen), and subjected to migration for 1 hour 30 min at 100 V. The proteins were transferred onto a nitrocellulose membrane using the iBlot device; the blocking and antibody probing were performed using the iBind device (Invitrogen). The antibodies used are listed in Supplementary Table E2. Chromatin immunoprecipitation was performed using the High Cells Chip Kit (Diagenode) following the instructions of the manufacturer. Five million cells were fixed for 8 min with 1% formaldehyde; after being washed with phosphate-buffered saline, the nucleus were isolated and sonicated for 15 cycles (30 sec on/30 sec off) with the Bioruptor NGS (Diagenode). The antibodies and quantities used for immunoprecipitations are listed in Supplementary Table E2. The pull-down experiments were conducted overnight. Eluted chromatin was quantified by quantitative PCR. Data were expressed as enrichment over Ig control. The error bars in the graphs represent standard deviations. Statistical comparisons of data sets were performed with the two-tailed Student's t test. Supplementary Table E1Primers for qPCRUniversal probes from RocheSequencemouse p16 + p1981CGACGGGCATAGCTTCAGGCTCTGCTCTTGGGATTGGmouse p2116AACATCTCAGGGCCGAAATGCGCTTGGAGTGATAGAAAmouse p534GCAACTATGGCTTCCACCTGTTATTGAGGGGAGGAGAGTACGmouse p19106GGGTTTTCTTGGTGAAGTTCGTTGCCCATCATCATCACCTmouse p16SYBRGTACCCCGATTCAGGTGATGCGAATCTGCACCGTAGTTGAmouse IL66GCTACCAAACTGGATATAATCAGGACCAGGTAGCTATGGTACTCCAGAAmouse beta actin106TGACAGGATGCAGAAGAAGACGCTCAGGAGGAGCAATGPrimers for ChIPmouse HOXA9 promoterSYBRGAGCGGTTCAGGTTTAATGCTGCCTGCTGCAGTGTATCATmouse p16G promoterSYBRACTCAGCTTGCTTGGTAGCAGGTTGGCCCTGCTTCTGTCmouse p16H promoterSYBRAATGCCAGGCCTTTAATCCTCCTGGAACTCAGCATAAACTCAmouse p16I promoterSYBRTTCTAATACCTGGGTGTTGCACAAAGTGAACTAGTCCTTCTCGAAATCmouse p16k promoterSYBRTCTGGAGCAGCATGGAGTCGGGGTACGACCGAAAGAGTTChr2SYBRAGGGATGCCCATGCAGTCTCCTGTCATCAGTCCATTCTCCATmouse TBP promoterSYBRCCGCAGTGCCCAGGTAACGGGGGACCCGCTGCAGAAGTCG Open table in a new tab Supplementary Table E2AntibodiesApplicationCompanyClone/catalog no.Dilution/quantityp16INK4a Western blotSigmaSAB45000721/2,000β-ActinWestern blotSigmaA19781/10,000p53Western blotAbcamab783161/1,000p53 k120 AcWestern blotAbcamab261/1,000Ty1ChIPDiagenodeC152000546 μg per IPIgG isotypeChIPDiagenodekch-803-0156 μg per IPc kit biotinylatedPurification of ckit+ cellsBD BiosciencesClone 2B8m, 5533531.5 μL for 10 × 106 cells Open table in a new tab
Referência(s)