Identification of amino acid residues that determine the substrate specificity of mammalian membrane-bound front-end fatty acid desaturases
2015; Elsevier BV; Volume: 57; Issue: 1 Linguagem: Inglês
10.1194/jlr.m064121
ISSN1539-7262
AutoresKenshi Watanabe, Makoto Ohno, Masahiro Taguchi, Seiji Kawamoto, Kazuhisa Ono, Tsunehiro Aki,
Tópico(s)Peroxisome Proliferator-Activated Receptors
ResumoMembrane-bound desaturases are physiologically and industrially important enzymes that are involved in the production of diverse fatty acids such as polyunsaturated fatty acids and their derivatives. Here, we identified amino acid residues that determine the substrate specificity of rat Δ6 desaturase (D6d) acting on linoleoyl-CoA by comparing its amino acid sequence with that of Δ5 desaturase (D5d), which converts dihomo-γ-linolenoyl-CoA. The N-terminal cytochrome b5-like domain was excluded as a determinant by domain swapping analysis. Substitution of eight amino acid residues (Ser209, Asn211, Arg216, Ser235, Leu236, Trp244, Gln245, and Val344) of D6d with the corresponding residues of D5d by site-directed mutagenesis switched the substrate specificity from linoleoyl-CoA to dihomo-γ-linolenoyl-CoA. In addition, replacement of Leu323 of D6d with Phe323 on the basis of the amino acid sequence of zebra fish Δ5/6 bifunctional desaturase was found to render D6d bifunctional. Homology modeling of D6d using recent crystal structure data of human stearoyl-CoA (Δ9) desaturase revealed that Arg216, Trp244, Gln245, and Leu323 are located near the substrate-binding pocket. To our knowledge, this is the first report on the structural basis of the substrate specificity of a mammalian front-end fatty acid desaturase, which will aid in efficient production of value-added fatty acids. Membrane-bound desaturases are physiologically and industrially important enzymes that are involved in the production of diverse fatty acids such as polyunsaturated fatty acids and their derivatives. Here, we identified amino acid residues that determine the substrate specificity of rat Δ6 desaturase (D6d) acting on linoleoyl-CoA by comparing its amino acid sequence with that of Δ5 desaturase (D5d), which converts dihomo-γ-linolenoyl-CoA. The N-terminal cytochrome b5-like domain was excluded as a determinant by domain swapping analysis. Substitution of eight amino acid residues (Ser209, Asn211, Arg216, Ser235, Leu236, Trp244, Gln245, and Val344) of D6d with the corresponding residues of D5d by site-directed mutagenesis switched the substrate specificity from linoleoyl-CoA to dihomo-γ-linolenoyl-CoA. In addition, replacement of Leu323 of D6d with Phe323 on the basis of the amino acid sequence of zebra fish Δ5/6 bifunctional desaturase was found to render D6d bifunctional. Homology modeling of D6d using recent crystal structure data of human stearoyl-CoA (Δ9) desaturase revealed that Arg216, Trp244, Gln245, and Leu323 are located near the substrate-binding pocket. To our knowledge, this is the first report on the structural basis of the substrate specificity of a mammalian front-end fatty acid desaturase, which will aid in efficient production of value-added fatty acids. Fatty acid desaturases are oxidases that introduce a double bond in the acyl chain of a fatty acid substrate by removing two hydrogens from adjacent carbon atoms using active oxygen. They comprise two types. Water-soluble desaturases are found in cyanobacteria and higher plants and act on the acyl chain bound to acyl carrier protein (ACP) (1.McKeon T.A. Stumpf P.K. Purification and characterization of the stearoyl-acyl carrier protein desaturase and the acyl-acyl carrier protein thioesterase from maturing seeds of safflower.J. Biol. Chem. 1982; 257: 12141-12147Abstract Full Text PDF PubMed Google Scholar), whereas membrane-bound desaturases from fungi, higher plants, and animals act on acyl-CoA or acyl-lipid substrates (2.Watts J.L. Browse J. Isolation and characterization of a Δ5-fatty acid desaturase from Caenorhabditis elegans..Arch. Biochem. Biophys. 1999; 362: 175-182Crossref PubMed Scopus (80) Google Scholar, 3.Knutzon D.S. Thurmond J.M. Huang Y.S. Chaudhary S. Bobik E.G. Chan G.M. Kirchner S.J. Mukerji P. Identification of Δ5-desaturase from Mortierella alpina by heterologous expression in bakers' yeast and canola.J. Biol. Chem. 1998; 273: 29360-29366Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). Some water-soluble enzymes such as castor Δ9 desaturase and ivy Δ4 desaturase are well characterized, and their crystal structures have revealed a molecular interaction between the ACP portion of the substrate and an amino acid located at the substrate-binding pocket of the enzyme, which could be the basis for change in the substrate specificity (4.Guy J.E. Whittle E. Moche M. Lengqvist J. Lindqvist Y. Shanklin J. Remote control of regioselectivity in acyl-acyl carrier protein-desaturases.Proc. Natl. Acad. Sci. USA. 2011; 108: 16594-16599Crossref PubMed Scopus (49) Google Scholar). The membrane-bound desaturases associate with endoplasmic reticulum membranes via two large hydrophobic domains that separate three hydrophilic clusters. The N-terminal hydrophilic region of some of these desaturases including mammalian Δ5 and Δ6 desaturases (D5d and D6d, respectively) and the C-terminal region of Saccharomyces cerevisiae Δ9 desaturase (OLE1p) contain a cytochrome b5-like heme-binding His-Pro-Gly-Gly (HPGG) motif. The histidine residue is indispensable for electron transfer from NADH-dependent cytochrome b5 reductase during the redox reaction (5.Sayanova O. Shewry P.R. Napier J.A. Histidine-41 of the cytochrome b5 domain of the borage Δ6 fatty acid desaturase is essential for enzyme activity.Plant Physiol. 1999; 121: 641-646Crossref PubMed Scopus (63) Google Scholar, 6.Gostinčar C. Turk M. Gunde-Cimerman N. The evolution of fatty acid desaturases and cytochrome b5 in eukaryotes.J. Membr. Biol. 2010; 233: 63-72Crossref PubMed Scopus (32) Google Scholar). Both this motif and that of diffused cytochrome b5 are necessary to fully express desaturase activity (7.Michinaka Y. Aki T. Inagaki K. Higashimoto H. Shimada Y. Nakajima T. Shimauchi T. Ono K. Suzuki O. Production of polyunsaturated fatty acids by genetic engineering of yeast.J. Oleo Sci. 2001; 50: 359-365Crossref Scopus (5) Google Scholar, 8.Guillou H. Rioux V. Catheline D. Thibault J-N. Bouriel M. Jan S. D'Andrea S. Legrand P. Conversion of hexadecanoic acid to hexadecenoic acid by rat Δ 6-desaturase.J. Lipid Res. 2003; 44: 450-454Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). The other hydrophilic regions contain three histidine clusters (HX3-4H, HX2-3HH, and QX2-3HH) that form a catalytic center by coordinating nonheme diiron centers, and all of these histidine residues and the glutamine residue are essential for enzymatic activity (9.Shanklin J. Whittle E. Fox B.G. Eight histidine residues are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenase.Biochemistry. 1994; 33: 12787-12794Crossref PubMed Scopus (647) Google Scholar, 10.Sayanova O. Beaudoin F. Libisch B. Castel A. Shewry P.R. Napier J.A. Mutagenesis and heterologous expression in yeast of a plant Δ6-fatty acid desaturase.J. Exp. Bot. 2001; 52: 1581-1585Crossref PubMed Scopus (61) Google Scholar). D5d and D6d, as well as Δ4 desaturase, introduce a double bond at the respective Δ positions of fatty acid substrates between the carboxyl group and a preexisting double bond; therefore, these enzymes are called "front-end" desaturases (11.Meesapyodsuk D. Qiu X. The front-end desaturase: structure, function, evolution and biotechnological use.Lipids. 2012; 47: 227-237Crossref PubMed Scopus (108) Google Scholar). They are distinct from desaturases of ω-x and ν+x types that form double bonds at the methyl-terminal side. The substrate specificity and regioselectivity (double bond positioning) of membrane-bound desaturases are defined by the structural fitness and interface affinity between the fatty acid substrate, including CoA and the lipid carrier, and the substrate-binding pocket with its surrounding residues. Protein engineering has been applied to understand the structure-function relationship. For instance, domain swapping has been used to identify the regioselective sites of nematode Δ12 and ω3 desaturases (12.Sasata R.J. Reed D.W. Loewen M.C. Covello P.S. Domain swapping localizes the structural determinants of regioselectivity in membrane-bound fatty acid desaturases of Caenorhabditis elegans..J. Biol. Chem. 2004; 279: 39296-39302Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar), a region determining the substrate specificity of Aspergillus nidulans Δ12 and ω3 desaturases (13.Hoffmann M. Hornung E. Busch S. Kassner N. Ternes P. Braus G.H. Feussner I. A small membrane-peripheral region close to the active center determines regioselectivity of membrane-bound fatty acid desaturases from Aspergillus nidulans..J. Biol. Chem. 2007; 282: 26666-26674Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar), and a substrate recognition region of black currant Δ6 fatty acid desaturase and Δ8 sphingolipid desaturase (14.Song L.Y. Zhang Y. Li S.F. Hu J. Yin W.B. Chen Y.H. Hao S.T. Wang B.L. Wang R.R.C. Hu Z.M. Identification of the substrate recognition region in the Δ6-fatty acid and Δ8-sphingolipid desaturase by fusion mutagenesis.Planta. 2014; 239: 753-763Crossref PubMed Scopus (10) Google Scholar). Site-directed mutagenesis based on amino acid sequence comparison has been used to identify amino acids participating in the substrate specificity of Mucor rouxii D6d (15.Na-Ranong S. Laoteng K. Kittakoop P. Tanticharoen M. Cheevadhanarak S. Targeted mutagenesis of a fatty acid Δ6-desaturase from Mucor rouxii: role of amino acid residues adjacent to histidine-rich motif II.Biochem. Biophys. Res. Commun. 2006; 339: 1029-1034Crossref PubMed Scopus (28) Google Scholar), Siganus canaliculatus Δ4 and D5d/D6d (16.Lim Z.L. Senger T. Vrinten P. Four amino acid residues influence the substrate chain-length and regioselectivity of Siganus canaliculatus Δ4 and Δ5/6 desaturases.Lipids. 2014; 49: 357-367Crossref PubMed Scopus (25) Google Scholar), and marine copepod Δ9 desaturase (17.Meesapyodsuk D. Qiu X. Structure determinants for the substrate specificity of acyl-CoA Δ9 desaturases from a marine copepod.ACS Chem. Biol. 2014; 9: 922-934Crossref PubMed Scopus (28) Google Scholar). The regioselectivity of house cricket Δ12/Δ9 desaturase was investigated using chemical mutagenesis and yeast complementation assays (18.Vanhercke T. Shrestha P. Green A.G. Singh S.P. Mechanistic and structural insights into the regioselectivity of an acyl-CoA fatty acid desaturase via directed molecular evolution.J. Biol. Chem. 2011; 286: 12860-12869Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Moreover, fatty acid-modifying enzymes with protein structures similar to, but chemoselectivities different from, the fatty acid desaturases have been used to swap the function of Arabidopsis oleate 12-desaturase and hydroxylase (19.Broun P. Boddupalli S. Somerville C. A bifunctional oleate 12-hydroxylase: desaturase from Lesquerella fendleri..Plant J. 1998; 13: 201-210Crossref PubMed Scopus (140) Google Scholar) and to alter the product partitioning between Crepis alpina Δ12 desaturase and acetylenase (20.Gagné S.J. Reed D.W. Gray G.R. Covello P.S. Structural control of chemoselectivity, stereoselectivity, and substrate specificity in membrane-bound fatty acid acetylenases and desaturases.Biochemistry. 2009; 48: 12298-12304Crossref PubMed Scopus (23) Google Scholar) and Momordica conjugase itself (21.Rawat R. Yu X.H. Sweet M. Shanklin J. Conjugated fatty acid synthesis: residues 111 and 115 influence product partitioning of Momordica charantia conjugase.J. Biol. Chem. 2012; 287: 16230-16237Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). In this study, we aimed to elucidate the structural basis of the substrate specificity of Rattus norvegicus D6d and D5d (22.Aki T. Shimada Y. Inagaki K. Higashimoto H. Kawamoto S. Shigeta S. Ono K. Suzuki O. Molecular cloning and functional characterization of rat Δ6 fatty acid desaturase.Biochem. Biophys. Res. Commun. 1999; 255: 575-579Crossref PubMed Scopus (111) Google Scholar) by domain swapping and site-directed mutagenesis. The corresponding genes are positioned in a head-to-head configuration on the rat genome, suggesting a paralogous relationship (11.Meesapyodsuk D. Qiu X. The front-end desaturase: structure, function, evolution and biotechnological use.Lipids. 2012; 47: 227-237Crossref PubMed Scopus (108) Google Scholar). Although their primary structures are highly homologous, they are in charge of mutually exclusive substrates: D6d catalyzes the conversion of linoleic acid (LA; 18:2 Δ9,12) and α-linolenic acid (18:3 Δ9,12,15) into γ-linolenic acid (GLA; 18:3 Δ6,9,12) and stearidonic acid (18:4 Δ6,9,12,15), respectively, whereas D5d acts on dihomo-γ-linolenic acid (DGLA; 20:3 Δ8,11,14) and eicosatetraenoic acid (20:4 Δ8,11,14,17) to generate arachidonic acid (ARA; 20:4 Δ5,8,11,14) and eicosapentaenoic acid (20:5 Δ5,8,11,14,17), respectively. To identify and evaluate the amino acid residues important for substrate selection of D6d, we performed additional analyses on the basis of the primary sequence of zebra fish bifunctional Δ5/6 desaturase [zD5/6d (23.Hastings N. Agaba M. Tocher D.R. Leaver M.J. Dick J.R. Sargent J.R. Teale A.J. A vertebrate fatty acid desaturase with Δ5 and Δ6 activities.Proc. Natl. Acad. Sci. USA. 2001; 98: 14304-14309Crossref PubMed Scopus (281) Google Scholar)] and the recently reported crystal structure of human stearoyl-CoA (Δ9) desaturase (24.Wang H. Klein M.G. Zou H. Lane W. Snell G. Levin I. Li K. Sang B-C. Crystal structure of human stearoyl–coenzyme A desaturase in complex with substrate.Nat. Struct. Mol. Biol. 2015; 22: 581-585Crossref PubMed Scopus (107) Google Scholar, 25.Bai Y. McCoy J.G. Levin E.J. Sobrado P. Rajashankar K.R. Fox B.G. Zhou M. X-ray structure of a mammalian stearoyl-CoA desaturase.Nature. 2015; 524: 252-256Crossref PubMed Scopus (140) Google Scholar). Transformants of Escherichia coli DH5α were grown in LB medium (0.5% yeast extract, 1% NaCl, 1% Bacto tryptone, 2% agar for plates) or 2× YT medium (1.6% Bacto tryptone, 1% yeast extract, 0.5% NaCl) supplemented with ampicillin (50 μg/ml) at 37°C with rotary shaking at 160 rpm. Transformants of S. cerevisiae INVSc1 (Invitrogen, Carlsbad, CA) were selected on SD agar plates (0.67% yeast nitrogen base, 0.19% yeast synthetic dropout medium without uracil, 2% d-glucose, 2% agar) and cultivated in SCT medium (0.67% yeast nitrogen base, 0.19% yeast synthetic dropout medium without uracil, 4% raffinose, 0.1% Tergitol) or YPD medium (2% polypeptone, 1% yeast extract, 2% d-glucose) at 28°C and 160 rpm. Fatty acids were purchased from Sigma-Aldrich (St. Louis, MO) or Cayman Chemical (Ann Arbor, MI). Other guaranteed reagents were obtained from Nacalai Tesque (Kyoto, Japan), Sigma-Aldrich, Toyobo (Osaka, Japan), or Wako Chemicals (Osaka, Japan), unless otherwise indicated. A FLAG DNA fragment was synthesized by PCR amplification with Takara Ex Taq (Takara, Kyoto, Japan) and the oligonucleotide primers FLAGf and FLAGr (Table 1), using 10 cycles of 95°C for 30 s, 50°C for 30 s, and 74°C for 30 s, without template. The fragment was subcloned in pGEM-T Easy vector (Promega, Madison, WI) and transformed into E. coli DH5α (pGEM-FLAG). The rat D6d gene (DDBJ accession number AB021980) was amplified from stock plasmid with KOD-Dash DNA polymerase (Toyobo) and the primers 24aF+ and 24R+ (Table 1), using 30 cycles of 95°C for 30 s, 68°C for 2 s, and 74°C for 30 s, and was digested with KpnI and XbaI. The product was ligated into KpnI/SpeI-digested pGEM-FLAG and the plasmid was transformed into E. coli DH5α (pGEM-FLAG-D6d). The rat D5d gene (DDBJ accession number AB052085) was amplified using KOD polymerase (Toyobo), the primers rD5df and rD5dr (Table 1), and a rat liver cDNA library (Clontech Laboratories, Palo Alto, CA) under the same thermal cycling conditions as for D6d, and was ligated into pGEM-FLAG (pGEM-FLAG-D5d). The nucleotide sequences of all plasmids were determined using the DYEnamic ET terminator cycle sequencing kit (GE Healthcare, Buckinghamshire, UK) or BigDye Terminator v3.1 cycle sequencing kit (Life Technologies, Carlsbad, CA) with T7, SP6, and other appropriate primers (Table 1) on an ABI PRISM 310 or 3130 × 1 genetic analyzer (Life Technologies).TABLE 1Oligonucleotide primers used in this studyPrimerNucleotide Sequence (5′ to 3′ Direction)Purposeaneed to check actual footnote or notAmino acids are indicated by single characters. Δ indicates a gap in the amino acid sequence alignment.Preparation of whole and partial regions of desaturasesFLAGfGCAAAGCTTAAGATGGACTATAAGGATGATGATGACFLAG tagFLAGrCGTGGTACCCTTGTCATCATCATCCTTATAGFLAG tag24aF+ACAGGTACCATGGGGAAGGGAGGTAACCAGD6d24R+GTCTCTAGATTCATTTGTGGAGGTAGGCATCCD6dD5dfCCCGGTACCATGGCTCCCGACCCGGTGCAGACCCD5dD5drCCCCTGCAGCTATTGGTGAAGGTAAGCATCCAGCCD5dD6d-cytrGGGCCGCGGAAGTACGAGAGGATGAACCN-terminal region of D6dD6d-cytfCCCTTCCGCGGCAATGGCTGGATTCCCMiddle and C-terminal regions of D6dD5d-cytrGGGTTCCGCGGAAGATCCAAAGAGTGAGCN-terminal region of D5dD5d-cytfCCCTTCCGCGGAACTTCCTTGGTGCCCMiddle and C-terminal regions of D5dAmino acid substitution of D6d with D5dd6d5-1ACCGTCATCACGGCCGTTCTGCTTGCTACCTCCCF166V, V167Ld6d5-2ACGGCCTTTGTCCTTTCTACCGTCCAGGCCCAAGCTGGAA169S, S171Vd6d5-3GGCTACAACATGATTTTGGCCACCTTTCTGTY182Fd6d5-4GCCACCTTTCTGTCTTTAGCACCTCCATATGGAACY188F, K189S, K190Td6d5-5TTTCTGTCTATAAGAAATCCACATGGAACCACATTGTCI192Td6d5-6TCCATATGGAACCACCTTGTCCACCATTTTGTCATTGGCCACTTI196L, K199Hd6d5-7CACTTAAAGGGTGCCCCCGCCAGCTGGTGGAACCATCGS209P, N211Sd6d5-8AACTGGTGGAACCATATGCATTTCCAGCACCATR216Md6d5-9CATGCGAAGCCCAACTGCTTCCGCAAGGACCCCGACATI226C, H228Rd6d5-10GGACCCCGACATAAACATGCACGTGTTTGTCCK234N, S235M, L236Δd6d5-11ATAAAGAGCCTGCACCCATTGGTGTTTGTCCTTGGAΔ238P, Δ239Ld6d5-12ATAAAGAGCCTGCACTTCTTTGCCCTTGGAGAGTGGCAV238F, V240Ad6d5-13GTGTTTGTCCTTGGAAAGGTGCTGCCCCTCGAGTATGGE243K, W244V, Q245Ld6d5-14CTTGGAGAGTGGCAGTCCGTCGAGCTTGGCAAGAAGAAGCTGP246S, L247V, Y249Ld6d5-15CTCGAGTATGGCAAGGAGAAGAAGAAATATCTGCCCTAK252E, L254Kd6d5-16AAGAAGAAGCTGAAACATATGCCCTACAACCACCY256H, L257Md6d5-17TACAACCACCAGCATAAATACTTCTTCCTGAE264Kd6d5-18ATCTTGGGAGCCCTGTGTCTTTTCAACTTTATCAGGTV321C, F322L, L323Fd6d5-19GCCCTGGTTTTCCTCTTCATTGTCAGGTTCCTGGAGAN324F, F325I, I326Vd6d5-20AGGTTCCTGGAGAGCAACTGGTTTGTGTGGGH332Nd6d5-21CAGATGAACCACATTCCCATGCACATTGATCTTGATCACV344P, E346Hd6d5-22TCATGGAGATTGATCATGATCGCTACCGGGACTGGTTCAL349H, H351Rd6d5-23ATTGATCTTGATCACAACGTGGACTGGTTCAGCAGCY352N, R353Vd6d5-24CACTACCGGGACTGGGTCAGCACCCAGCTGGCAGCCACF356V, S358Td6d5-25TTCAGCAGCCAGCTGCAAGCCACCTGCAATGTA361Qd6d5-26GCCACCTGCAATGTGCACCAGTCCTTCTTCAE367Hd6d5-27AATGTGGAGCAGTCCGCCTTCAATAACTGGTTCAGCGGGCF370A, D373Nd6d5-28TGCCAAGACACAACTACCACAAGGTTGCCCCACTGGTGAL396Y, I399Vd6d5-29AAGATTGCCCCACTGGTGCAGTCTCTCTGCGCCAK404Qd6d5-30TCTCTCTGCGCCAAGTATGGCATTAAATACCAAGAGAAGCH410Y, E413Kd6d5-31CATGGCATTGAATACGAATCGAAGCCGCTGCTGAGQ415E, E416Sd6d5-32AGAAGCCGCTGCTGACGGCCTTCGCCGACATTGTGAGTTCR421T, L423F, L424Ad6d5-33CTGCTCGACATTGTGTATTCACTGAAGAAGTCS428Yd6d5-34GTGAGTTCACTGAAGGAGTCTGGGCAGCTGTGGCTGGATGK432E, E435Qd6d5-35GATGCCTACCTCCACCAATGAATCTAGTGAAK444QAmino acid substitution of D5d with D6dd6d5-36CACTTAAAGGGTGCCTCCGCCAGCTGGTGGAACP209Sd6d5-37AGGGTGCCCCCGCCAACTGGTGGAACCATS211Nd6d5-38CTGGTGGAACCATCGACATTTCCAGCACCATM216Rd6d5-39GGACCCCGACATAAAGATGCACCCATTGGTGTN234Kd6d5-40ACCCCGACATAAACAGCCACCCATTGGTGTTTGM235Sd6d5-41CCGACATAAACATGCTGCACCCATTGGTGTTTGΔ236Ld6d5-42ATAAACATGCACTTGGTGTTTGTCCTTGGAP238Δd6d5-43ATAAACATGCACCCAGTGTTTGTCCTTGGAL239Δd6d5-44GTGTTTGTCCTTGGAGAGGTGCTGCCCCTCGAK243Ed6d5-45TTTGTCCTTGGAAAGTGGCTGCCCCTCGAGTAV244Wd6d5-46GTCCTTGGAAAGGTGCAGCCCCTCGAGTATGGL245Qd6d5-47CAGATGAACCACATTGTCATGCACATTGATCTTP344Vd6d5-48AACCACATTCCCATGGAGATTGATCTTGATCACH346EAmino acid substitution of D6d with zD5/6dd6zebd5-1TCGTACTTCGGCACTGGCTGGATTCCCN156Td6zebd5-2ACCGTCATCACGGCCGTTGTCCTTGCTACCTCCF166Vd6zebd5-3TGGCTACAACATGATTTCGGCCACCTTTCTGTCY182Fd6zebd5-4CACCTTTCTGTCTTCAAGACCTCCATATGGAACY188F, K190Td6zebd5-5TCCATATGGAACCACCTCGTCCACAAGTTTGTCI195Ld6zebd5-6GGACCCCGACATAAATATGCTGCACGTGTTTGK234N, S235Md6zebd5-7CTTGGAGAGGTCCAGCCCGTCGAGTATGGCW245V, L248Vd6zebd5-8AAGAAGAAGCTGAAACACCTGCCCTACAACCACY257Hd6zebd5-9TACAACCACCAGCATAAGTACTTCTTCCTGATCE265Kd6zebd5-10TCCAGTACCAGATCTTCATGACCATGATCAGI284Fd6zebd5-11GCCATCAGCTACTATGTTCGTTTCTTCTACACCA305Vd6zebd5-12TTGGGAGCCCTGGTTCTCTTCAACTTTATCAGGTTCF322L, L323Fd6zebd5-13GTTTTCCTCAACTTTGTCAGGTTCCTGGAGAGCI326Vd6zebd5-14CAGATGAACCACATTCCCATGGAGATTGATCTTGV344Pd6zebd5-15ATTGATCTTGATCACAACCGGGACTGGTTCAGCAGY352Nd6zebd5-16AATGTGGAGCAGTCCGCCTTCAATGACTGGTTCF370Ad6zebd5-17TGCCAAGACACAACTATCACAAGATTGCCCCL396Yd6zebd5-18CTCTGCGCCAAGTACGGCATTAAGTACCAAGAGAAGH410Yd6zebd5-19GCCAAGTACGGCATTAAATACCAAGAGAAGCCGE413Kd6zebd5-20CGCTGCTGAGGGCCTTCGCTGACATTGTGAGTTCL423F, L424Aa Amino acids are indicated by single characters. Δ indicates a gap in the amino acid sequence alignment. Open table in a new tab DNA fragments corresponding to the N-terminal region (cyt) and the central and C-terminal regions (des) of D6d (D6cyt and D6des) and D5d (D5cyt and D5des) were amplified by PCR using KOD Dash, the template plasmids, and the following sets of oligo primers (Table 1): D6cyt (amino acids 1–154), 24aF+, and D6d-cytr; D6des (amino acids 155–444), D6d-cytrf, and 24R+; D5cyt (amino acids 1–156), D5df, and D5d-cytr; and D5des (amino acids 157–447), D5d-cytf, and D5dr. The products were digested with Sac II at the coupling site, incubated at 70°C for 15 min to inactivate the enzyme, and ligated with T4 DNA ligase in the following combinations: D6cyt-D6des, D6cyt-D5des, D5cyt-D6des, and D5cyt-D5des. Each of the resultant fragments was adenylated with Ex Taq (Takara) at 72°C for 10 min, subcloned into the pGEM-T Easy vector, digested with KpnI and SalI, and ligated into pGEM-FLAG. The oligonucleotide primers d6d5-1–d6d5-48 and d6zebd5-1–d6zebd5-20 (Table 1) were designed to introduce nucleotide mutations for substitution of amino acids in D6d and D5d with each of their D5d, zD5/6d, or D6d counterparts (see Fig. 1). Each mutation site was flanked by at least 15 nucleotides in each primer. For multiple-site mutagenesis, 3 or 4 primers carrying mutation site(s) at least 15 amino acid residues apart from each other were mixed in an equivalent molar ratio. The primers were phosphorylated at the 5′ end with T4 polynucleotide kinase (Takara). Plasmids carrying single or multiple mutation(s) were synthesized using pGEM-FLAG-D6d or pGEM-FLAG-D5d as a template, the phosphorylated primers, and the QuikChange multi site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) or a combination of the AMAP multi site-directed mutagenesis kit (MBL International, Woburn, MA) and Pfu DNA polymerase (Thermo Scientific Fermentas, Carlsbad, CA), according to the manufacturer's instructions. The reaction mix was used to transform E. coli DH5α or XL10-Gold ultracompetent (Agilent Technologies) cells, and transformants were randomly selected to check the nucleotide sequences of the cloned DNA fragments. The wild-type, chimera, and mutant desaturase genes were obtained by digestion of the pGEM-based plasmids with HindIII and EcoRI and were ligated into the yeast expression vector pYES2 (Invitrogen). The desaturase expression vectors were introduced into S. cerevisiae INVSc1 by using the lithium acetate method (26.Ito H. Fukuda Y. Murata K. Transformation of intact yeast cells treated with alkali cations.J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar). Transformants were selected on uracil-deficient SD plates and cultivated at 28°C for 6 h with rotary shaking at 160 rpm in 15 ml of SCT medium supplemented with LA or DGLA at a concentration of 0.25 mM. After addition of galactose (2%, w/v) and further cultivation for another 16 h, yeast cells were recovered by centrifugation for fatty acid and protein analyses. The yeast cells from ∼15 ml of broth were washed with distilled water and then vigorously vortexed in 2 ml of chloroform-methanol (2:1, v/v) plus 0.5 ml of distilled water. The chloroform phase was recovered by centrifugation, and methanolysis of total lipid was carried out by adding 1 ml of 10% methanolic hydrochloric acid (Tokyo Kasei, Tokyo, Japan) and heating at 60°C for 2 h. After evaporation of the solvents, fatty acid methyl esters (FAMEs) were extracted twice and dissolved in hexane. Fatty acid composition was determined using a gas chromatographic system (GC-17A and GC-2014; Shimadzu, Kyoto, Japan) equipped with a capillary column (TC-70, 0.25 mm × 30 m, GL Sciences, Tokyo, Japan; or Omegawax 250, 0.25 mm × 30 m, Sigma-Aldrich), a split injector (split ratio at 1:20–25; 270°C), and a flame ionization detector (270°C). The temperature of the column oven was maintained at 180°C (TC-70) or raised from 210°C to 225°C at 0.5°C/min (Omegawax 250). FAMEs were identified by comparing their retention time with those of the 37-Component FAME mix (Supelco, Bellefonte, PA) and by analyzing their molecular mass using MS. For GC/MS analysis, total lipid or FAME extracts were dissolved in 0.5 ml of 2-amino-2-methyl-1-propanol preheated at 75°C and were heated at 180°C for 24 h to form 4,4-dimethyloxazoline (DMOX) derivatives of fatty acids. After cooling to 75°C and adding 2 ml of distilled water preheated at 75°C, the DMOX derivatives were extracted several times with n-hexane/dichloromethane (2:3, v/v), dehydrated with anhydrous sodium sulfate, and analyzed on a GC/MS system consisting of a gas chromatograph (7890A, Agilent Technologies) equipped with a ZB-1HT Inferno capillary column (0.25 mm × 30 m; Phenomenex, Torrance, CA) and an electron ionization mass spectrometer (70 eV, JMS-T100GCV; JEOL, Tokyo, Japan). The enzymatic activity of the desaturase expressed in yeast was evaluated using the conversion ratio, which was determined as the ratio of the amount of product to the sum of the amounts of substrate and product and was expressed as a percentage. Yeast cells recovered from 1 ml of broth were washed with distilled water and suspended in 0.1 ml of 50 mM Tris-HCl (pH 7.5) containing 4 μl EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland). An equivalent volume of glass beads (0.5 mm in diameter) was added to disrupt the cells by eight rounds of vortexing for 30 s and chilling on ice for 30 s. The homogenate was centrifuged at 5,000 g for 10 min and the supernatant was subjected to SDS-PAGE (27.Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature. 1970; 227: 680-685Crossref PubMed Scopus (207012) Google Scholar). The proteins separated in the gel were transferred to an Immobilon membrane (Merck Millipore, Darmstadt, Germany) using a semidry blotter. The membrane was blocked by immersing in 5% skim milk in PBST (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.76 mM KH2PO4, 0.05% (w/v) Tween-20), and then moved to the same buffer containing mouse anti-FLAG antibody (Sigma-Aldrich; 1:5,000). After shaking for 1 h and washing with PBST, the membrane was probed with rabbit anti-mouse IgG (1:20000) for 1 h. The FLAG-tagged proteins were detected by using ECL plus (GE Healthcare) and exposure to X-ray film. All experiments were performed at least twice. Student's t-test was used to compare experimental values between groups where applicable. P < 0.05 was considered significant. To examine the involvement of the N-terminal hydrophilic regions of D6d and D5d, including the cytochrome b5-like domain, in the substrate specificity of both desaturases, chimeras D5cyt-D6des and D6cyt-D5des were constructed and expressed in yeast in the presence of LA or DGLA. The results indicated that D5cyt-D6des and D6cyt-D6des converted LA into GLA, but did not act on DGLA, whereas D6cyt-D5des and D5cyt-D5des generated ARA from DGLA, but did not use LA as a substrate (Table 2). No other fatty acids, except spontaneous ones, were detected in all cases (data not shown). These results indicated that the N-terminal domains of both enzymes do not determine the specificity toward the corresponding substrates. However, the rate of conversion by D5cyt-D6des (8%) was substantially lower than that by D6cyt-D6des (40%), suggesting that a specific interaction between the N-terminal region and the central and C-terminal regions may contribute to maximum activity of D6d through conformational stabilization of the enzyme.TABLE 2Substrate specificity of chimeric desaturasesRate of Substrate Conversion (%)DesaturaseLA to GLADGLA to ARAD6cyt-D6des400D5cyt-D6des8.00D6cyt-D5des045D5cyt-D5des045 Open table in a new tab The amino acid sequence homology between D6d and D5d was 66% (67/101 amino acids) in the central hydrophilic region (hydrophilic region II) and 73% (91/124) in the C-terminal region (hydrophilic region III). To identify the amino acids involved in substrate specificity, site-directed mutagenesis was applied to the 67 nonidentical amino acids, which had been organized into 35 groups of 1–3 amino acid substitutions as depicted in Fig. 1. Multi site-directed mutagenesis using mixtures of three or four groups of oligonucleotide primers (d6d5-1–d6d5-35; Table 1) resulted in the generation of an array of mutant D6d genes encoding enzymes in which various (numbers of) amino acids were substituted with the corresponding D5d residues (Fig. 2). The mutant genes were individually expressed in S. cerevisiae in the presence of DGLA. Despite the successful expression of mutant proteins, none of the mutants generated ARA at a detectable level (data not shown). A series of expression experiments was then performed in the presence of LA to see whether the D6d activity of the mutants had been changed. As shown in Fig. 2, the D6d activity of four mutants constructed using the primer sets d6d5-1/11/25 (introducing the mutations F166V+V167L, Δ238P+Δ239L, A361Q), d6d5-5/10/35 (I192T, K234N+S235M+L236Δ, K444Q), d6d5-7/23/30 (S209P+N211S, Y352N+R353V, H410Y+E413K), and d6d5-8/14/24/31 (R216M, P246S+L247V+Y249L, F356V+S
Referência(s)