High-resolution renal perfusion mapping using contrast-enhanced ultrasonography in ischemia-reperfusion injury monitors changes in renal microperfusion
2016; Elsevier BV; Volume: 89; Issue: 6 Linguagem: Inglês
10.1016/j.kint.2016.02.004
ISSN1523-1755
AutoresKrisztina Fischer, F. Can Meral, Yongzhi Zhang, Márk Vangel, Ferenc A. Jólesz, Takaharu Ichimura, Joseph V. Bonventre,
Tópico(s)Traumatic Brain Injury and Neurovascular Disturbances
ResumoAlterations in renal microperfusion play an important role in the development of acute kidney injury with long-term consequences. Here we used contrast-enhanced ultrasonography as a novel method for depicting intrarenal distribution of blood flow. After infusion of microbubble contrast agent, bubbles were collapsed in the kidney and postbubble destruction refilling was measured in various regions of the kidney. Local perfusion was monitored in vivo at 15, 30, 45, 60 minutes and 24 hours after 28 minutes of bilateral ischemia in 12 mice. High-resolution, pixel-by-pixel analysis was performed on each imaging clip using customized software, yielding parametric perfusion maps of the kidney, representing relative blood volume in each pixel. These perfusion maps revealed that outer medullary perfusion decreased disproportionately to the reduction in the cortical and inner medullary perfusion after ischemia. Outer medullary perfusion was significantly decreased by 69% at 60 minutes postischemia and remained significantly less (40%) than preischemic levels at 24 hours postischemia. Thus, contrast-enhanced ultrasonography with high-resolution parametric perfusion maps can monitor changes in renal microvascular perfusion in space and time in mice. This novel technique can be translated to clinical use in man. Alterations in renal microperfusion play an important role in the development of acute kidney injury with long-term consequences. Here we used contrast-enhanced ultrasonography as a novel method for depicting intrarenal distribution of blood flow. After infusion of microbubble contrast agent, bubbles were collapsed in the kidney and postbubble destruction refilling was measured in various regions of the kidney. Local perfusion was monitored in vivo at 15, 30, 45, 60 minutes and 24 hours after 28 minutes of bilateral ischemia in 12 mice. High-resolution, pixel-by-pixel analysis was performed on each imaging clip using customized software, yielding parametric perfusion maps of the kidney, representing relative blood volume in each pixel. These perfusion maps revealed that outer medullary perfusion decreased disproportionately to the reduction in the cortical and inner medullary perfusion after ischemia. Outer medullary perfusion was significantly decreased by 69% at 60 minutes postischemia and remained significantly less (40%) than preischemic levels at 24 hours postischemia. Thus, contrast-enhanced ultrasonography with high-resolution parametric perfusion maps can monitor changes in renal microvascular perfusion in space and time in mice. This novel technique can be translated to clinical use in man. The pathophysiology of acute kidney injury (AKI) involves tubular injury, inflammatory processes, and changes in renal microvascular perfusion,1Bonventre J.V. Yang L. Cellular pathophysiology of ischemic acute kidney injury.J Clin Invest. 2011; 121: 4210-4221Crossref PubMed Scopus (1326) Google Scholar which result in a generalized or localized impairment of oxygen and nutrient delivery to, and waste product removal from, cells of the kidney.2Le Dorze M. Legrand M. Payen D. Ince C. The role of the microcirculation in acute kidney injury.Curr Opin Crit Care. 2009; 15: 503-508Crossref PubMed Scopus (130) Google Scholar The postischemia perfusion to the outer medulla is decreased disproportionately to the reduction in total kidney perfusion in animals and likely in patients following ischemic injury.7Oostendorp M. de Vries E.E. Slenter J.M. et al.MRI of renal oxygenation and function after normothermic ischemia-reperfusion injury.NMR Biomed. 2011; 24: 194-200Crossref PubMed Scopus (37) Google Scholar, 4Yamamoto K. Wilson D.R. Baumal R. Outer medullary circulatory defect in ischemic acute renal failure.Am J Pathol. 1984; 116: 253-261PubMed Google Scholar, 5Okusa M.D. Jaber B.L. Doran P. et al.Physiological biomarkers of acute kidney injury: a conceptual approach to improving outcomes.Contrib Nephrol. 2013; 182: 65-81Crossref PubMed Scopus (43) Google Scholar, 6Evans R.G. Ince C. Joles J.A. et al.Haemodynamic influences on kidney oxygenation: clinical implications of integrative physiology.Clin Exp Pharmacol Physiol. 2013; 40: 106-122Crossref PubMed Scopus (173) Google Scholar, 7Oostendorp M. de Vries E.E. Slenter J.M. et al.MRI of renal oxygenation and function after normothermic ischemia-reperfusion injury.NMR Biomed. 2011; 24: 194-200Crossref PubMed Scopus (37) Google Scholar The local perfusion in the outer medulla can be reduced due to arteriolar vasoconstriction, endothelial injury, and local interstitial edema secondary to increased capillary permeability. This can result in tubular injury and interstitial inflammation, which, in turn, can lead to decreased capillary density, chronic tissue hypoxia, and eventually fibrosis.6Evans R.G. Ince C. Joles J.A. et al.Haemodynamic influences on kidney oxygenation: clinical implications of integrative physiology.Clin Exp Pharmacol Physiol. 2013; 40: 106-122Crossref PubMed Scopus (173) Google Scholar, 8Yang L. Besschetnova T.Y. Brooks C.R. et al.Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury.Nat Med. 2010; 16: 535-543Crossref PubMed Scopus (906) Google Scholar Patients at risk for AKI often receive a combination of i.v. fluids and vasoconstrictive agents, which can further decrease local perfusion and increase interstitial edema.6Evans R.G. Ince C. Joles J.A. et al.Haemodynamic influences on kidney oxygenation: clinical implications of integrative physiology.Clin Exp Pharmacol Physiol. 2013; 40: 106-122Crossref PubMed Scopus (173) Google Scholar Therapeutic approaches, guided by impaired intrarenal perfusion and localized intrarenal edema, are not possible due to the absence of suitable bedside diagnostic and treatment monitoring technologies for detecting alterations and distributional deficiencies in renal microvascular perfusion. We have applied contrast-enhanced ultrasonography (CEUS) to the assessment of the distribution of renal microperfusion in space and time in mice subjected to ischemia-reperfusion injury (IRI). Whereas CEUS has been used to provide information regarding cortical perfusion,9Kalantarinia K. Novel imaging techniques in acute kidney injury.Curr Drug Targets. 2009; 10: 1184-1189Crossref PubMed Scopus (39) Google Scholar, 10Schwenger V. Korosoglou G. Hinkel U.P. et al.Real-time contrast-enhanced sonography of renal transplant recipients predicts chronic allograft nephropathy.Am J Transplant. 2006; 6: 609-615Crossref PubMed Scopus (95) Google Scholar, 11Schneider A.G. Hofmann L. Wuerzner G. et al.Renal perfusion evaluation with contrast-enhanced ultrasonography.Nephrol Dial Transplant. 2012; 27: 674-681Crossref PubMed Scopus (61) Google Scholar, 12Schneider A.G. Goodwin M.D. Bellomo R. Measurement of kidney perfusion in critically ill patients.Crit Care. 2013; 17: 220Crossref PubMed Google Scholar to our knowledge there is no CEUS study that reliably demonstrates perfusion changes in the outer medulla. One reason why outer medullary perfusion could not be adequately assessed is interference with signals from large vessels. Another limitation of previous studies13Kogan P. Johnson K.A. Feingold S. et al.Validation of dynamic contrast-enhanced ultrasound in rodent kidneys as an absolute quantitative method for measuring blood perfusion.Ultrasound Med Biol. 2011; 37: 900-908Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar is the use of reperfusion time to reach a percentage of quasi-steady-state blood flow. In AKI, when many outer medullary capillaries may be without flow, this parameter will not reliably reflect regional blood flow because the quasi-steady-state flow may be very impaired and yet the time to reach a specific percentage of that low steady-state flow unchanged. In our study we used parasagittal transducer orientation, in which the large vessels are perpendicular to the imaging plane and do not disturb the visualization of the microvasculature in the outer medulla. In addition, for data analysis, we used plateau image intensity values. This reflects the actual microbubble delivery (microvascular blood flow) to the given location. During a 2-minute intravascular infusion, the microbubbles are collapsed using high mechanical indices (MI) ultrasound bursts and recovery is monitored over time in various regions of the kidney. High-resolution parametric perfusion maps were developed to detect and monitor microvascular perfusion changes in space and time, providing insight into the distributional changes in the microvascular perfusion, over space and time, in the kidney following IRI. Mice were imaged at baseline and at various times after 28 minutes of bilateral ischemia with B-mode ultrasonography. A dark region secondary to decreased echogenicity was present under the kidney cortical area in images taken after 15 minutes of reperfusion (Figure 1). In the first hour after the clamp release, this dark band became progressively less visible, and at 60 minutes postischemia-reperfusion (post-IR), it was no longer apparent. The dark band was not seen in any pre-IR or 24-hour post-IR image or at any time point in control (sham) animals. There are 2 possible reasons for the brighter appearance of the post-IR cortical image: (i) The manipulation around the renal pedicles caused the elongation and modification of subcutaneous fat; and (ii) a small amount of contrast agent may remain from the first contrast infusion, although this is unlikely because the post-IR B-mode image was taken 43 minutes later (28 [ischemia duration] +15 [waiting time post-IR] = 43 minutes). The half-life of the contrast agent is short (<5 minutes). To estimate whole kidney and regional microvascular perfusion, high-resolution parametric perfusion maps of the kidneys were collected to detect distributional change in the microvascular perfusion. These are presented in pseudocolor (Figure 2). Although there was some variability among animals, the perfusion maps clearly showed regional differences in microvascular perfusion of the post-IR kidney. The parametric maps revealed the most prominent perfusion loss in the outer medulla as early as 15 minutes after reperfusion (Figure 2). The dark regions under the cortical region (outer medulla) that were found on B-mode images (Figure 1), reflecting reduced local perfusion, were located at the same regions on the parametric maps. On the 24-hour post-IR images, delayed perfusion recovery persisted in the outer medulla. One animal, mouse #IR7 developed more severe injury in response to the 28-minute ischemia. The rapid and marked reduction in the microvascular perfusion can be identified on the parametric perfusion maps at post-IR 30, 45, and 60 minutes. This animal died post-IR 24 hours. No such spatial distributional change was found in any of the control animals (Figure 2). Representative single kidney perfusion tracings for the whole kidney (Figure 3, Figure 4), or cortical, outer, and inner medullary regions (Figure 5, Figure 6) were obtained for ischemic and control animals, by monitoring refill-induced nonlinear signals of intact microbubbles after acutely collapsing them with high MI ultrasound bursts. After the removal of renal pedicle clamps, the microvascular perfusion gradually decreased in the whole kidney over the first hour post-IR (average perfusion decrease in the whole kidney was found as 50%, P = 0.0006, n = 12) as reflected by lower echo intensity plateau value at baseline at preburst and after burst. At 60-minute post-IR, perfusion was decreased in the cortex and inner medulla but mostly in the outer medulla (by 69% vs. baseline pre-IR; P = 0.0001). Whereas cortical and inner medullary perfusion returned to levels close to baseline by 24 hours post-IR, outer medullary blood flow remained ∼40% (P = 0.0034) reduced at 24-hour post-IR (Table 1). Total renal blood flow was decreased by ∼25% (P = 0.002) at 24-hour post-IR. Furthermore, the perfusion decrease was more significant (P < 0.0001) at each time point post-IR in the outer medulla than in the cortex or inner medulla. There was approximately equivalent percentage reduction in cortical and inner medullary perfusion at various time points over the first 60 minutes after reperfusion. In control animals there were no significant spatial changes of perfusion in the cortex, inner, or outer medulla over time. Original Doppler and contrast recordings of the control and IR kidneys are shown in Supplementary Movies S1 to S10 online.Figure 4Whole kidney perfusion curves of a control kidney. No major change was found in the whole kidney microvascular perfusion in the sham kidneys. The lower panel shows the timeline of the experiment.View Large Image Figure ViewerDownload (PPT)Figure 5Regional perfusion curves, example of 1 animal. The regional perfusion curves show that the microvascular perfusion decreased the most in the outer medulla during the first hour after ischemic reperfusion (post-IR), and its recovery took longer compared with the times for the cortex or the inner medulla. Blue = cortex; green = outer medulla; red = inner medulla. Regions of interest selection on parametric maps and on B-mode images are shown in the lower panel of the figure. The region of interest selection was performed on the parametric perfusion maps (left panel) and confirmed on B-mode and contrast images at pre-IR, 15 minutes post-IR, and 24 hours post-IR. The selected regions were maintained (placed automatically) on consecutive images (15, 30, 45, and 60 minutes post-IR). The right panel shows an overlay of the region selections onto a photograph of the freshly excised parasagittal view of the mouse kidney (centimeter scale).View Large Image Figure ViewerDownload (PPT)Figure 6Regional perfusion curves of the sham kidneys, example of 1 animal. No major change in regional perfusion was found in the sham kidney. Blue = cortex; green = outer medulla; red = inner medulla.View Large Image Figure ViewerDownload (PPT)Table 1Average regional plateau image intensity pre- and post-ischemic injury at varying time pointsPreischemiaPost-IR 15 minPost-IR 30 minPost-IR 45 minPost-IR 60 minPost-IR 24 hCortex (n = 12) Mean ± SD48.81 ± 16.638.57 ± 13.4334.36 ± 1329.2 ± 13.2824.65 ± 14.5837.56 ± 16.82 Mean Δ (%)−21−29.6−40.2−49.5−23 P (mean Δ)0.02650.00790.00210.0010.0911Outer medulla (n = 12) Mean ± SD46.27 ± 15.7826.02 ± 10.6224.32 ± 1019.48 ± 9.2214.55 ± 8.227.55 ± 10.57 Mean Δ (%)−43.8−47.4−58−69−40.5 P (mean Δ)0.00240.00180.00050.00010.0034Inner medulla (n = 12) Mean ± SD46.48 ± 15.6632.76 ± 12.431 ± 12.4325.75 ± 11.118.87 ± 1137.34 ± 13.17 Mean Δ (%)−29.5−33.5−44.6−59.4−19.7 P (mean Δ)0.02300.01580.0010.0020.0407IR, ischemia reperfusion.Mean Δ (%) = [(post-IR/pre-IR)–1] × 100: change in the average plateau image intensity at various time points. Open table in a new tab IR, ischemia reperfusion. Mean Δ (%) = [(post-IR/pre-IR)–1] × 100: change in the average plateau image intensity at various time points. To document postischemic kidney dysfunction and tissue injury, we measured plasma creatinine and performed histopathology and immunoperoxidase staining for kidney injury molecule-1 (KIM-1) (Figure 7). After 24 hours of reperfusion, the serum creatinine increased significantly (from 0.2 ± 0.1 mg/dl at baseline to 2.0 ± 0.6 mg/dl, P = 0.0009) with the range of 24-hour post-IR serum creatinine 1.3 to 2.9 mg/dl. KIM-1 expression, an established biomarker of renal proximal tubular injury,8Yang L. Besschetnova T.Y. Brooks C.R. et al.Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury.Nat Med. 2010; 16: 535-543Crossref PubMed Scopus (906) Google Scholar was greatly up-regulated in the proximal tubules 24-hour post-IR as measured by quantitative reverse transcription polymerase chain reaction (PCR) (Figure 8). One day after IRI, the level of normalized KIM-1 mRNA expression was increased by 40- to 180-fold in each animal. The KIM-1 mRNA expression levels (24-hour post-IR) correlated well (R = 0.82, P = 0.01, n = 8) with the decrease in outer medullary image echo intensity at 60-minute post-IR (Figure 9).Figure 8Quantitative assessment of renal injury. One day after the 28-minute bilateral ischemia, the mean normalized kidney injury molecule-1 (KIM-1 mRNA) expression level was 40- to 180-fold elevated compared with that of sham kidneys. Control = no ischemia-reperfusion injury; #1 to #6 = KIM-1 expression level in individual animals. *P < 0.05. Values are mean + SD of triplicate measurements.View Large Image Figure ViewerDownload (PPT)Figure 9Relationship between the decrease in outer medullary perfusion and KIM-1 mRNA expression. Correlation (R = 0.82, P = 0.013, n = 8) was found between kidney injury molecule-1 (KIM-1) mRNA expression normalized to before ischemic reperfusion (pre-IR) mRNA levels and the outer medullary perfusion decrease at 60 minutes post-IR. The outer medullary perfusion decrease was calculated from the plateau image intensity at 60 minutes post-IR and plotted against normalized KIM-1 mRNA levels at 24 hours.View Large Image Figure ViewerDownload (PPT) Thus, in this study, we have demonstrated that CEUS, coupled with our custom-designed analysis algorithm, can effectively detect and monitor renal microvascular changes in space and time post-IRI in mice. The fact that our parametric perfusion maps indicated more severe ischemic injury in 1 of the IR animals (mouse #IR7), which died post-IR at 24 hours, further supports our method's reflection of the severity of AKI. Regional analyses and the perfusion maps indicated that microvascular perfusion recovery was delayed in the outer medulla relative to the cortex and inner medulla. Histological analyses revealed the typical signs of IRI. There were no signs (e.g., interstitial hemorrhage) suggestive of cavitation effects induced by the microbubble disruption. These findings are in accordance with invasive studies,3Mason J. Torhorst J. Welsch J. Role of the medullary perfusion defect in the pathogenesis of ischemic renal failure.Kidney Int. 1984; 26: 283-293Abstract Full Text PDF PubMed Scopus (108) Google Scholar, 4Yamamoto K. Wilson D.R. Baumal R. Outer medullary circulatory defect in ischemic acute renal failure.Am J Pathol. 1984; 116: 253-261PubMed Google Scholar including recent ones by Legrand et al.,14Legrand M. Mik E.G. Balestra G.M. et al.Fluid resuscitation does not improve renal oxygenation during hemorrhagic shock in rats.Anesthesiology. 2010; 112: 119-127Crossref PubMed Scopus (98) Google Scholar Aksu et al.,15Aksu U. Demirci C. Ince C. The pathogenesis of acute kidney injury and the toxic triangle of oxygen, reactive oxygen species and nitric oxide.Contrib Nephrol. 2011; 174: 119-128Crossref PubMed Scopus (75) Google Scholar Siegemund et al.,16Siegemund M. van Bommel J. Ince C. Assessment of regional tissue oxygenation.Intensive Care Med. 1999; 25: 1044-1060Crossref PubMed Scopus (91) Google Scholar and Legrand et al.,17Legrand M. Bezemer R. Kandil A. et al.The role of renal hypoperfusion in development of renal microcirculatory dysfunction in endotoxemic rats.Intensive Care Med. 2011; 37: 1534-1542Crossref PubMed Scopus (104) Google Scholar revealing that the outer medulla has the largest deficit in microvascular perfusion after IRI. We found a dramatic perfusion decrease in the outer medulla between 30- and 45-minute post-IR, which was only partially resolved by 24 hours. These findings are in accordance with previous pathophysiology findings that the vasoconstriction, vascular congestion, small vessel occlusion, local edema, and neutrophil infiltration develop very early (during the first hour post-IR) in AKI and persist in the outer medulla over the first 24 hours in ischemic animal models.1Bonventre J.V. Yang L. Cellular pathophysiology of ischemic acute kidney injury.J Clin Invest. 2011; 121: 4210-4221Crossref PubMed Scopus (1326) Google Scholar, 3Mason J. Torhorst J. Welsch J. Role of the medullary perfusion defect in the pathogenesis of ischemic renal failure.Kidney Int. 1984; 26: 283-293Abstract Full Text PDF PubMed Scopus (108) Google Scholar, 18Farrar C.A. Wang Y. Sacks S.H. Zhou W. Independent pathways of P-selectin and complement-mediated renal ischemia/reperfusion injury.Am J Pathol. 2004; 164: 133-141Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 19Park K.M. Chen A. Bonventre J.V. Prevention of kidney ischemia/reperfusion-induced functional injury and JNK, p38, and MAPK kinase activation by remote ischemic pretreatment.J Biol Chem. 2001; 276: 11870-11876Crossref PubMed Scopus (283) Google Scholar CEUS is a readily available modality. The equipment is portable (bedside imaging is possible) and inexpensive. Testing is easily repeatable over time and, hence, is ideally applicable to the intensive care unit setting. CEUS measurement is minimally invasive, requiring only an i.v. microbubble infusion. Studies have showed that CEUS can be used to reliably estimate renal perfusion in humans.9Kalantarinia K. Novel imaging techniques in acute kidney injury.Curr Drug Targets. 2009; 10: 1184-1189Crossref PubMed Scopus (39) Google Scholar, 10Schwenger V. Korosoglou G. Hinkel U.P. et al.Real-time contrast-enhanced sonography of renal transplant recipients predicts chronic allograft nephropathy.Am J Transplant. 2006; 6: 609-615Crossref PubMed Scopus (95) Google Scholar, 11Schneider A.G. Hofmann L. Wuerzner G. et al.Renal perfusion evaluation with contrast-enhanced ultrasonography.Nephrol Dial Transplant. 2012; 27: 674-681Crossref PubMed Scopus (61) Google Scholar, 12Schneider A.G. Goodwin M.D. Bellomo R. Measurement of kidney perfusion in critically ill patients.Crit Care. 2013; 17: 220Crossref PubMed Google Scholar, 20Hosotani Y. Takahashi N. Kiyomoto H. et al.A new method for evaluation of split renal cortical blood flow with contrast echography.Hypertens Res. 2002; 25: 77-83Crossref PubMed Scopus (35) Google Scholar These previous studies, however, all presented the analysis of subjectively selected regions of interest in the kidney. To our knowledge, there is no previous study demonstrating the quantitation of medullary, especially outer medullary, microvascular perfusion in a reliable way using CEUS in animals or humans. The uniqueness of our study is the ability to provide information on the heterogeneous nature and spatial distribution of kidney local perfusion abnormalities in AKI through high-resolution, pixel-by-pixel, parametric perfusion maps. The regional perfusion discrepancies following IRI were detected as early as 15 minutes post-IR and lasted as long as 24 hours post-IR in each kidney. The observed mean decrease in relative blood perfusion in the outer medulla was significant at each examined time point despite the small number of animals studied. The potential ability to detect decreased intrarenal regional perfusion with CEUS in the clinical setting could guide therapeutic decision making, especially with respect to vasoconstrictor agents and fluid therapies. The results demonstrate that the described analysis methods can reliably detect microvascular perfusion changes in space and time. In this study, isoflurane anesthesia was used, which has been previously associated with a protective effect on the development of AKI in IRI via an anti-inflammatory process.21Lee H.T. Ota-Setlik A. Fu Y. et al.Differential protective effects of volatile anesthetics against renal ischemia-reperfusion injury in vivo.Anesthesiology. 2004; 101: 1313-1324Crossref PubMed Scopus (192) Google Scholar Although injury was found in each animal, the isoflurane anesthesia may have reduced the extent of the injury. In addition, the relative blood volume, which was used to estimate the microvascular perfusion in each pixel, is not measured in a conventional unit, but rather as a perfusion estimation value, representing the local ultrasonographic contrast agent concentration. Our results, however, show a correlation between the decrease in outer medullary perfusion and the degree of kidney injury, supporting the validity of our technique in reflecting intrarenal distribution of blood flow. CEUS can potentially be used in a repetitive way in the intensive care unit to monitor intrarenal blood flow characteristics over time. In conclusion, CEUS can be used to map renal microvascular perfusion heterogeneities at high resolution in mice after an ischemic insult. We propose that this approach can be applied to humans, and the resulting information can be used to monitor, at the bedside, the effects of the underlying disease state and guide personalized therapeutic interventions, including fluid treatment and vasoconstrictor agents. The perfusion maps might be particularly useful in sepsis or other states where vascular permeability is altered and interstitial edema may accumulate in the outer medulla affecting capillary blood flow to the S3 segment of the proximal tubule leading to the development of tubular injury. CEUS could also be useful in monitoring patients receiving nephrotoxic agents allowing early detection of drug-related renal regional ischemia. The complete Methods are available online as Supplementary Material. All experimental work was performed in accordance with the animal care and use protocol approved by the Institutional Animal Care and User Committee of the Harvard Medical School. Male BALB/c mice (n = 15) were anesthetized with 1.2% isoflurane in combination with compressed medical air and placed on a heated platform. The tail vein was catheterized for the contrast agent infusion. Body temperature and heart rate were monitored with a built-in monitoring system of the ultrasonographic scanner (results are shown in Table 2). Once the kidneys were isolated, the pre-IR image acquisitions were performed. Bilateral renal ischemia was induced by clamping both renal pedicles with nontraumatic microaneurysm clamps from a retroperitoneal approach for 28 minutes at 37.0 °C. After removal of the clamps, reperfusion of the kidneys was visually confirmed.8Yang L. Besschetnova T.Y. Brooks C.R. et al.Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury.Nat Med. 2010; 16: 535-543Crossref PubMed Scopus (906) Google Scholar The post-IR image acquisitions were then performed at 15, 30, 45, and 60 minutes, and 24 hours post-IR. Animals were sacrificed 24 hours after the ischemic insult. Control (sham, n = 3) animals were prepared and imaged over time, as in the IR animals, but no renal ischemia was induced.Table 2Physiological parametersIR model or shamDay of ischemic insult24-h post-IRPre-IRDuring ischemiaPost-IR (first hour)Average body temperature (°C)IR (n = 12)37.9 ± 0.837.7 ± 1.537.8 ± 0.537.9 ± 0.5Sham (n = 3)38.3 ± 1.238.6 ± 0.538.6 ± 0.438.5 ± 0.9Average heart rate (beats per min)IR (n = 12)475 ± 48474 ± 38482 ± 36479 ± 46Sham (n = 3)496 ± 58513 ± 26514 ± 25516 ± 31Average duration of the experiments (min)IR (n = 12)116 ± 1532 ± 9Sham (n = 3)110 ± 834 ± 2IR, ischemia reperfusion.Animal body temperature was maintained ≥37 °C throughout the experiments (mean ± SD in °C). Average heart rate was stable throughout the experiments (mean ± SD in beats per minute). Visualization of the kidney was possible in each experiment. The average duration of the experiment is shown on the day of the ischemic insult and on the following day (mean ± SD in minutes). The microbubble infusion and the ultrasonographic imaging were well tolerated in every animal. Open table in a new tab IR, ischemia reperfusion. Animal body temperature was maintained ≥37 °C throughout the experiments (mean ± SD in °C). Average heart rate was stable throughout the experiments (mean ± SD in beats per minute). Visualization of the kidney was possible in each experiment. The average duration of the experiment is shown on the day of the ischemic insult and on the following day (mean ± SD in minutes). The microbubble infusion and the ultrasonographic imaging were well tolerated in every animal. Nonlinear contrast imaging was performed with a Vevo 2100 (Visual Sonics, Toronto, Ontario, Canada) ultrasonographic scanner and a 21-MHz linear transducer array. The ultrasonographic transducer was fixed in place with a mechanical positioning system, ensuring constant position throughout the image acquisitions. Regular B-mode images were used to initially visualize the right kidney of the animal and to optimally position the imaging plane. A microbubble-based contrast agent (MicroMarker, Bracco, Milan, Italy) was injected with a syringe pump at the rate of 0.78 ml/h for approximately 2 minutes. A destruction-reperfusion sequence was used. Nonlinear contrast images were acquired based on the principle of amplitude modulation. Low MI nonlinear imaging mode was used until and ∼20 seconds after the contrast agent concentration reached the "steady state." High MI "burst" (MI = 0.8, line density 512) pulses were delivered to destroy the contrast agents. Refilling was observed at low MI (MI = 0.11, acquired at 25 Hz for 32 seconds). The image depth, focus gain, time gain compensation, and frame rate was optimized at the beginning of the study and was held constant in the experiments. Audio video interleave (AVI) files were acquired and processed on a personal computer using a nonlinear time series analysis algorithm developed "in house" in Matlab (The Mathworks, Natick, MA). Spectral analysis consisted of a pixel-by-pixel Fourier transform approach, which was used to calculate the amount of "activity" in a given image pixel. The mask computed limited the region of interest (ROI) within the kidney tissue, excluding the major blood vessels. Intensities of the remaining pixels were fitted to an exponential perfusion model. In addition to the pixel-by-pixel analysis, a similar nonlinear curve-fitting technique was applied to the manually selected ROI. The spatial average of each region was calculated and represented by a single curve. Three ROIs were chosen to be large enough to represent the cortex, outer, and inner medulla. ROI selection was performed on parametric maps and confirmed on B-mode images and contrast images. The selected ROIs in the cortex, the outer medulla, and the inner medulla were placed automatically on the consecutive images. (See more details in the complete Methods in the Supplementary Material.) A day before, and 24 hours post-IR, a blood sample was collected from the animals. The plasma creatinine concentration was determined by the picric acid method, using a Beckman Creatinine Analyzer II. Kidneys were perfused via the left ventricle with 0.9% saline solution at 37.0 °C until the kidney cortex completely cleared of blood. Kidneys were then removed immediately after the perfusion ended and either fixed and embedded in paraffin or shock frozen. Paraffin sections were stained with hematoxylin and eosin and periodic acid-Schiff for histological examination. To demonstrate the tubular damage in response to the bilateral renal ischemia, immunohistochemical staining for KIM-1 was performed on alternate sections using goat polyclonal antibody (TIM-1/KIM-1, catalogue number AF1817; R&D Systems, Minneapolis, MN), and a Vectastain Elite ABC kit (Vecor, Burlingame, CA) was used for visualization. Quantitative reverse transcriptase-PCR analysis of mouse KIM-1 mRNA and 18S rRNA was performed as previously described.8Yang L. Besschetnova T.Y. Brooks C.R. et al.Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury.Nat Med. 2010; 16: 535-543Crossref PubMed Scopus (906) Google Scholar The following mouse KIM-1 primer set was used for PCR: forward sequence: AGGAAGACCCACGGCTATTT; reverse sequence: TGTCACAGTGCCATTCCAGT. Each sample was measured 3 times. A mix-model regression analysis was performed by using the R statistics package to fit the perfusion changes. For all the other statistical measurements, Student t test (SPSS 21 software; SPSS Statistics, IBM Corporation, Armonk, NY) was used. A P value of <0.05 was considered to be significant. Results are expressed as means ± SD. JVB and TI are co-inventors on KIM-1 patents that are assigned to Partners Healthcare and licensed by Partners to Johnson and Johnson, Sekisui, BiodenIdec, Astute, Novartis, and a number of research reagent companies. All the other authors declared no competing interests. The study was funded by National Institutes of Health grants DK 39773, DK 72381, and R25 CA089017-06A2. We thank Visual Sonics (Toronto, Ontario, Canada) for providing the MicroMarker contrast agent for this research project. We are very grateful to Fred Roberts and Dr. Sudeshna Fisch for their generous assistance during the experiments. The preparation of this manuscript has been overshadowed by Dr. Jolesz's sudden passing in December 2014. The main ideas and most of the composition of the paper were written jointly, and we have done our best to complete them. In sorrow, we dedicate this work to his memory. Download .docx (.12 MB) Help with docx files Complete MethodseyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI0MDZiY2E0MGNhNzhjZGNlY2Y5YjM2OGM3MjQ4ZDdlOSIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.KFOrX-5lxf5UPMda4RSqLl-B7Cpge6mDJhYNO9e_78XQcilcdorLeOLumhXHFgmiT5HwDeq_Vm3z3_0A9BgyUql4xXg4m0E6ZwTJAjtOG561gUirWFVVxV9M_l-UjrWOxAwLkAywOygTFDwglPKqBIIGEz05ke32XmL6bGOg-fYi3KzoykpIuchsQXBQZTKf1_0z5fRMw-SPDJuJCpLloo_n30LuV8A76IISVcSlXzsH6F2yS5F8S8EOvbwjQQchigvJXhteiBgnsf04YGj4UEB8IvrPNusGj-BK3aCYsxGcd3TxLL8Wyx8eUfviV-289dr7shSAJO-nhhyPjSZN2w Download .mp4 (3.22 MB) Help with .mp4 files Movie S1Doppler recording of a sham animal (60 minutes post-sham operation procedure). The whole kidney blood flow is intact. Red indicates arterial flow and blue venous flow.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI0ZGVhNzA5OTJlNzRkNDQ4YTYyMzI4NTAzZGRlNTRiYyIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.SqkJLfuDKxvIMlnRjkxrX25Dje5E1jYYov1TdOwKHhAcJ9BlQgxJcgIGObqTRDmuhyQHwuT3m_yZ1fzIhjNGtQOiFhsQTV3uOlE5IA__VCA4K9fHbzTLhj7nYREuN75YEH3_7V1sk4_GznirQZVRDtSqMl68uYFszy0djZI2cO27yWjoZl1dypsSonePnFHAYQG3c4XrWa8qpxlKQ1Ev-fCzXDSyv_M6N-r85Wfm1qlTQgEz71ufk8-KxfS7lE1iKS4AvZgBZlI4ZdImgXLSvEGY97Q9uBubQzsmbcg2XnXCLFCY-9lbcsQM_Zec5G7m8O_YX5oEIihGVmdHxckqoQ Download .mp4 (3.99 MB) Help with .mp4 files Movie S2Doppler recording of an IR animal (post-IR 60 minutes). Markedly reduced blood flow is present in the entire kidney. However no distinction can be made between the cortex, outer, and inner medulla. IR, ischemic reperfusion.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiIzM2Y5NzhjYWIyOTM3ZjU3YjNlMmU0Y2I1MjVmMDkwOCIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.bCrtruk7FwxaesBrNncr5cHqoqPrGrkGJUK3iE1pMitFAd7QM8oD1n1YIJfQ03rKK0xChg74jc0BTI8VNV9CbJB83k06dHGReUI72bz1PtTuY_platjA9fUX_DEuViZ797YaHrRy7GgdTBwE9srMCqyVM2nlz_w-CH67gKwjsZdJ0CHoQp0bV3aHeTKYHbfr7fUNFxBLOsNDi7m24-LckSYPSESUAZD_pS1rz48QPa-WGrSAs9YGzzQc6NX5b3PGAlK3X8GY_VIrhrkcx7qfpVcPZD27QxlV9iH-k0S3Qc_Z8j-s0UbsRaHpwIhxv4yG5I_qNuKXhYoRB7yXaS52Yw Download .mp4 (14.62 MB) Help with .mp4 files Movie S3Original contrast mode recording of the preischemic kidney (mouse #IR5). The entire kidney is well perfused. Following the "burst," the entire kidney fills in with the contrast agent rapidly. (Left panel shows B-mode imaging; right panel represents the contrast image).eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiIyMGJiOWVlNmRiNTNiODMxNGY5Yzg5ZDNmNzFlYmJiOCIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.JxeUBnVD6cDW9zQDRKF3ER2JH3eubWkXX6eVB7DCUrVKH4_s8ewGKaCrsscDO9y82k9z1hIO8LMT6c-Pk1XJc-FCDUAnjfiyoreUldqJvq7wGMbRY68BOyabeQHz-tjejh7efmnlQUPBa9ysFXe2_gu28mn9K9z4YqaoIZwKFDyRgxbbn-Orrl_kAuQ--z-Zf4kdoCGjgb-UXDyUeMat-d_vkP8-SrX05DPgigpU0ykdgLi6fyJReKr7mj8OsgVxhMyk5IfdbtGYfp-X3ioZb28ep399COQc8lZzHtfC8x7hiyXXhnKQM7RZIgrXfFg_MFpmBuCU8UYQq_dPRY1D0g Download .mp4 (14.62 MB) Help with .mp4 files Movie S4Original contrast mode recording of the mouse #IR5 kidney, 60 minutes post-IR. Impaired perfusion is seen in the entire kidney, following the "burst" reduced contrast agent fill-in. IR, ischemic reperfusion.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI5OTZjMTAyN2M0YTM4ZmVkNTljM2UwY2JiYjEzNDljNyIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.i_3-2rU-5-hJW-2RepYum8fGy1EKoAXs1dGBTAKmLGcRzzVR5rMNwUcFk1yeH7XgeIU3CG1QXU_tC5e5qKKoK0ivAIbMAFoe70onuHupT6khDh1YFfqzU2FN8tZ_3xzV7rEsqfTBdQ8xGZ0hqXEeuBdHvr2e05BnFEWxd1-3_KYwrXdC9ROioPEhzJNhEy9_UyXvJdiuU-5T0fiX1vU-ObNKm8yr--TogzQWDsDozUaFfkmGccdoREU7EBcbIh1vA6m098tCx_zXjJZZ6pXuvZulm6lys1B_Xlr0IEI_IJ_hcwcHvPjpinobnsHnciWg4Wnw2CRa-uzcdlJ7IdnnbA Download .mp4 (14.01 MB) Help with .mp4 files Movie S5Original contrast mode recording of the mouse #IR5 kidney, 24 hours post-IR. Partial recovery of the microvascular perfusion can be observed on the contrast recording. IR, ischemic reperfusion.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI2NmEwMGIzMmU5ZGQ3ODRlNTAzZTI1OGZjYzgzZjM2ZiIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU0fQ.EP4VZr4DSdef-8_7NRNe0mUhfYQStOeDIEJ36f9v976unY3OXccROSwi7F-tCs_g0gjwVN2Aa5Um95FHInGQSuxhAHpJZ99MdHex4sYZiaoFqVgZ5d_ykaIKo97UZFumDxpIh8USEZQn7QroeBquqpWX5VsV0kwiRbDDqDyyXQhpfh8fVTMTq6D9pAjUwWmztWwbYLyVjfCpi_SWBNHzXDeRqJcpc9RP7ULCm5oIxnHhHIJtl96TPXNsZKn2mG-8wSqFFhOsmRD-8GLEKQLY4zYbcThrSEGaU1EZdWtBRNvkaghRnO-ZoKjzGlV5vzGZBr5K5C4yxzJLJVH0dipQRg Download .mp4 (14 MB) Help with .mp4 files Movie S6Original contrast mode recording of the preischemic kidney of an animal (mouse #IR7) that succumbed to the ischemia. The entire kidney is well perfused. Following the "burst," the entire kidney fills in with the contrast agent rapidly.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiIzNzc4ZWQ3NzdhOWJlYjViNTRlODk5M2MyZjkyOTJkZiIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU1fQ.DjyAP_pNHvOJK_zaOoqN4mrDQ5WNGcHUlmVEjePtiaGp9peX-0PoE7lv5p4cMCRMgHbn2N2VfWzd33HqKDOqA2xXQ4dVPMkUzbEwMf5hOrGh2YjDenQvVOjz1zvMn8I6P9UX3xhPh85porG3ylngGv51bPiKorn8ezQWq9XP9h57JhJa3fJroia9pjYEUIoPg4kF5ZIZzDxS6b3GODoIa9f_mT5t3w-KsQncWqW_mVt8ZB834FpunjK0H3A2HfSfj8WXeKQuqYPx_ZEAFmGV6DxAAMvDbcryYasWX70zBaIo8zWr8nkxYZ5fNrlKWEYRPYAtrgB1iWoN1sbSM7cHhg Download .mp4 (14.03 MB) Help with .mp4 files Movie S7Original contrast mode recording of the mouse #IR7 kidney, 60 minutes post-IR. In this animal, the microvascular perfusion reduction was much more severe than in other animals. The contrast recording shows close to no perfusion in the kidney. This animal died 24 hours post-IR. IR, ischemic reperfusion.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI2OGRlMjYyNjk0YzNlYWQwMDNkODFhZmMzYTY2OThhMyIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU1fQ.TvMAQo0lUeFDZPUgi1qbIpK1uoQTTMqaUsne6oogNqauF7JJ1hMGTZw_0KF6MxvvY8QyZ5lwJVMIfVd1LZhP82-kQO0-dUb6_swAPxAnpuLPDmwLNdgGdYOiyVUFsFgmJ32bJX1NDAaeR9Xvi7N3NAFjhEbKL2Y8MQNVzmGHdthCNvxTtzTHgTuJRZqvvLVrZuyg1WcUD4DwtGi7YXpAn6xH0hOqfoDcWDZI7Cu11Xs524qL-PAfTjITI32N4KCrhhEVdiepjqRBzJ9d5SzDP74pGff6WlsMNZeWFVW-CSx3jISCky9M8MYy2JgwBPsbgwaaARmEv00CI39u6zm12w Download .mp4 (13.98 MB) Help with .mp4 files Movie S8Original contrast mode recording of the baseline kidney (mouse #C1). The entire kidney is well perfused. Following the "burst," the entire kidney fills in with the contrast agent rapidly.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiIxYWU3NzgyYzMzYzE3MDEzNzg0MDk4YTcwN2VhYTY1NSIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU1fQ.T7zJq7uyYiZH62nZOgM4XTos5JAtyKAajRmaxqrr6tE2IDPY3okd8y6u9aTXxW-JUVR37noe0nIrt8gYM1qZAPP_BJ6EYhiqapfc7z1eGki-nQGj3dOISGjnY9ctGwK1FzEpihEpa7BLniJA_D6oR6YEWJAeXyEr3b41F2DaTS0zlaJMPYiaa0UGSksYv9uV7LqHjHXL5DGGwo8Ccco5FU69qHP7mrUzhlF1S9LlDr-AZnPmNUuQz2eN8gyrHENJPc8wJgKn2yW0eUBE0kbiOfVzjia1GGN70LCCr6bFp3OR0_FKSQ5QKVm9nqWZhT0FnkCP82Qfn0NrSXjdL110VA Download .mp4 (13.95 MB) Help with .mp4 files Movie S9Original contrast mode recording of the mouse #C1 kidney at control – 60 minutes. The entire kidney is well perfused.eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiI1ZmI4NGY5MTRkOWM4MmI2MWZhYmYyMGNmOGViMzY0MyIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjc4ODI4MjU1fQ.DlXozcGVUmEOUul4oegJ_nYOMHnQrOWXxlKXbEb1FTmNhASm8Oir8bcWqqxtUo45z7V41mkZqKzUr8vAaCkG3t4zJOj1Ba0biFvMX4Ssx7XlbN2G8IqSYcC9ANfK68eZUlkqWQXOilKn5z0jcc4VfIO36mcFkXmpEy2EjbDc2ZrInnv0WJhlYDYLC0RhGS_09TrA77Ompoxe7mpJpNoG45X1NJEjPDWCVIEj5qZkpnxkKzD556uEiWg5QKQ2FIo5VEOEebEpVHFIAsIGIXpTDCApBzffLseeYTfa7fXdXE6M8BfniI0NpWJXffUkzshfLOSSqbk3QjduwwZpYe1THQ Download .mp4 (14.01 MB) Help with .mp4 files Movie S10Original contrast mode recording of the mouse #C1 kidney at control – 24 hours. The entire kidney is well perfused.
Referência(s)