Portal de Periódicos da CAPES

Primary resistance mutations to fusion inhibitors and polymorphisms in gp41 sequences of HIV-1 non-B subtypes and recombinants

2003; Lippincott Williams & Wilkins; Volume: 17; Issue: 7 Linguagem: Inglês

10.1097/00002030-200305020-00020

1473-5571

María Luisa Villahermosa, Lucía Pérez-Álvarez, Rocío Carmona, María Teresa Cuevas, Migue M Thomson, Leandro Medrano, Elena Vazquezde Parga, Elena Delgado, J. Pedreira, Rafael Nájera,

Monoclonal and Polyclonal Antibodies Research

Primary resistance mutations to fusion inhibitors and polymorphisms in gp41 sequences of non-B subtypes and recombinant HIV-1 isolates were analysed. L91H to RPR103611 was detected in one DGpol/Denv/Dgp41recombinant; L9F and K144R, rarely reported previously, were frequent in the B region of CRF14_BG recombinants. V194I and V318A, not described in the G subtype, were detected in the G region of BG recombinants and in G subtype viruses that also show the rare mutations T115L, M118V and K90R. Genetic diversity within the gp41 gene and its immunodominant regions should have possible functional influences. Gp41 has many functional domains, including the immunodominant region in the aminoterminal portion [1], which contains a cytotoxic T lymphocyte (CTL) epitope (amino acids 591–602), the cysteine loop (aa 607–613), which is the most immunogenic region of gp41, and the ectodomain (aa 671–676). Some 99% of HIV-1-infected patients produce antibodies against these targets [1–3]. HIV-1 gp41 envelope protein mediates viral fusion with human host cells. HIV-1 fusion inhibitor T20, which is in phase III clinical trials, represents a new, successful drug for the treatment of HIV infection in preclinical studies. T20 is a peptide that binds to the helical domain target HR-1 (heptad repeat region) near the fusion domain at the amino-(N)-terminus, and consequently inhibits transition to its fusion-active conformation [4], blocking cell fusion and viral entry. In the gp41 sequence, both G36S and V38M resistance-associated mutations against T20 have been described in vitro [5], and I84S and L91H substitutions have been associated with resistance against the non-peptidic compound RPR103611, which is an efficient inhibitor of membrane fusion [6]. These new entry/fusion inhibitors should increase the success rate of salvage therapy for individuals failing highly active antiretroviral therapy (HAART), and should provide combination therapy alternatives for initial therapy in infected patients. Therefore, it will be important to know whether primary resistance to these drugs can be detected in patients before the initiation of treatments with fusion inhibitors. On the other hand, the frequency of non-B subtypes and recombinant HIV-1 strains is increasing in different countries [7]. In Spain, we have previously described a high genetic diversity in Galicia [8], showing a high prevalence and incidence of non-B subtypes and recombinant forms in native patients [9]. The aim of this study was to analyse the presence of resistance mutations against T20 and RPR103611 fusion inhibitors and the polymorphisms within the gp41 region of non-B subtypes and recombinant forms of HIV-1 in our studies of patients from Galicia (Spain). We selected 34 patients (74% men and 26% women), infected with different non-B subtypes and recombinants, who were included in a previous epidemiologically designed study. Seventeen out of 34 patients were under HAART and 17 were treatment naive. Transmission was by intravenous drug use in 18 cases (53%), and by heterosexual contact in 16 (47%). Reverse transcriptase (RT) and protease genes were amplified and sequenced as reported [10], and resistance mutations were defined following the criteria of Stanford HIV RT and Protease Sequence Database (http://hivdb.stanford.edu/hiv/). The V3 gene was amplified using a nested polymerase chain reaction with primer pairs v3-1s-(position 6557–6582)-(5'–ATGGGATCAAAGCCTAAAGCCATG–3')/v3-2as-(position 7782–7805)-(5'TCCTGCTGCT CCCAAGAACCCAAG–3') as external, and v3-3s-(position 6981–7012)-(5'–CCAGTRGTATCAACTC AACTGCTG–3')/v3-4as-(position 7648–7679)-(5'–TTTATATAATTCACTTCTCCAATT–3') as internal primers. The Gp41 gene was amplified using a nested polymerase chain reaction with primer pairs gp41-1s-(position 7347–7375)-(5'–AGTTTTAATTG TRGAGGRGAATTT–3')/gp41-2as-(position 9436–9457)-(5'–GAAAGTCCCCAGCGGAAAGTCC–3') as external, and gp41-3s-(position 7696–7720)-(5'–TTGAACCAYTAGGAGTAGCACCCA–3')/gp41-4as-(position 9392–9418)-(5'–GTCAGCAGTCCTT GTAGTACTCCGGAT–3') as internal primers. The amplification products were sequenced using Big-Dye Terminator Cycle Sequencing (Applied Biosystems, Perkin Elmer, California, USA) on an automated sequencer (Abi Prism, Applied Biosystems DNA Sequences, Perkin Elmer, California, USA) with primer v3-1s, gp41-3s and gp41-5s-(position 8260–8295)-(5'–TGTGGTATATAAAAATATTCATAA–3'). All the sequences were compared with B and non-B subtype consensus sequences derived from an alignment of all sequences maintained at the Los Alamos HIV Sequence Database. Non-B subtype sequences were examined by neighbouring phylogenetic trees, and intersubtype recombination was analysed by bootscanning using the Simplot program (Ray SC. Simplot for Windows (version 2.5). Distributed by author. http://www.jhu. edu/deptmed/sray/download/Simplot 25.exe.1999). The different HIV-1 genetic forms (pol/V3/gp41) were two subtype A (6%); three C (9%); two F (6%); three G (9%); seven G/B/BG (CRF-14 BG), 21%; one BG/B/BG, (3%); one BGB/B/B, (3%); one BG/B/B, (3%); one BG/G/G, (3%); one AJU/G/A, (3%); one AJU/G/J, (3%); three AGA/A/AG (CRF-02 AG), (9%); one GUG/U/J (CRF-06), (3%); three GU/A/AG (CRF-02 AG), (9%); one KU/A/A, (3%); one GH/K/K, (3%); one FBF/F/BF (3%) and one DG/D/D (3%). Resistance mutations to RT or protease inhibitors were detected in 12 of 17 treated patients (70.59%) corresponding to: nucleoside reverse transcriptase inhibitors (NRTI) (two, 16.67%); non-nucleoside reverse transcriptase inhibitors (NNRTI) (two,16.67%); protease inhibitors (PI) (one, 8.30%); both NRTI and NNRTI (three, 25%); NRTI and PI (three, 25%); and to all inhibitors (one, 8.30%). Resistance mutations to T20 (G36D/S, V38M) or to RPR103611 (I84S, L91H) were not observed in gp41 sequences of any patient. In only one case, (DGpol/Denv/Dgp41 recombinant) was the L91H substitution detected (Table 1). This mutation is located in the 'loop region' of gp41, between the proximal and distal helix domains, and it is characteristic of subtype D.Table 1: Primary resistance mutations to fusion inhibitors and polymorphisms in GP41 sequences of HIV-1 non-B subtypes and recombinant isolates.The results of our study show that primary resistance to fusion inhibitors are a rare event in treated and untreated patients, which is in concordance with a recent study indicating the absence of G36D/S, V38M substitutions in long-term infected and heavily pretreated patients [11]. These findings could indicate the absence of a selective advantage of these variants during the infection or during previous antiretroviral treatment, offering great promise as a new class of antiviral drug. The analysis of polymorphisms showed different patterns (Table 1): two associated characteristic mutations (L9F and K144R) within the B region of gp41 were observed in a very high frequency (86%) of the recently described CRF14_BG [12]. These mutations are only described in 0.42% (4/946) and 0.21% (2/942), respectively, of B sequences of the Los Alamos Database (http://hiv-web.lanl.gov), which contains a collection of 946 HIV sequences. The L9F change is located in the peptide fusion sequence, and K144R is within the carboxy terminal heptad repeat preceding the transmembrane segment in the ectodomain. We also detected the V194I and V318A associated mutations in 100 and 92%, respectively, in the G region of gp41 sequences corresponding to the CRF14_BG and G subtype viruses. These mutations, located in the transmembrane segment and endodomain, respectively, were not described in any G sequences of the Los Alamos Database. G subtype sequences showed 75 and 100% of two characteristic mutations, T115L and M118V, which are located between two heptad repeat regions. T115L has been reported in 90% of group O only (14/15 sequences) and SIVcpz (4/5 sequences), and in 3.38% of all sequences of the Los Alamos Database. M118V was reported in 0.42% of the Los Alamos Database. The K90R substitution, located in the most immunogenic region of gp41 (cysteine loop), was detected in 75% of the G sequences analysed within the gp41 region. K90R is present at a very low frequency in the Los Alamos Database alignments (7.8%). A substitution within the cysteine loop could affect antibody reactivity, as previous reports showed in relation to the substitution L91H [13]. This is the first study in which characteristic mutations in the gp41 sequence of HIV-1 recombinants and non-B subtypes are described. These mutations have been detected specifically in CRF14_BG and G subtype, being in relation to the newly described description of these viruses [14]. These polymorphisms may influence the accessibility of fusion inhibitors to their target sequence, and may have implications in driving complex conformational changes in gp41, affecting the fusion and entry into the cell. The significance of the K90R mutation remains to be determined. The Spanish Group for Antiretroviral Resistance Studies in Galicia A. Agulla, A. Mariño, Hospital Arquitecto Marcide, Ferrol (La Coruña); S. López-Calvo, J.D. Pedreira, Hospital Juan Canalejo (La Coruña); A. Aguilera, E. Losada, A. Prieto, Complejo Hospitalario Universitario de Santiago (La Coruña); J. Corredoira, M.J. López-Alvarez, A. Rodríguez, Hospital Xeral-Calde (Lugo); M. Bustillo, J. García-Costa, R. Fernández-Rodríguez, Hospital Nuestra Señora del Cristal (Orense); R. Rodríguez, Hospital Provincial Santa María Madre (Orense); C. Miralles, A. Ocampo, Hospital Xeral-Cíes, Vigo (Pontevedra); R. Ojea de Castro, Hospital Montecelo (Pontevedra); L.E. Morano, R. Pérez-Rodríguez, A. Rodríguez, J. Torres, Hospital Meixoeiro, Vigo (Pontevedra); J. Díz, R. Rodríguez-Real, Hospital Xeral Provincial (Pontevedra).