Portal de Periódicos da CAPES

Primary T-cell immunodeficiency with functional revertant somatic mosaicism in CD247

2016; Elsevier BV; Volume: 139; Issue: 1 Linguagem: Inglês

10.1016/j.jaci.2016.06.020

1097-6825

Ana V. Marín, Anaïs Jiménez-Reinoso, Alejandro C. Briones, Miguel Muñoz‐Ruiz, Çiğdem Aydoğmuş, Luke J. Pasick, Jorge Couso, Marina S. Mazariegos, Ángel F. Álvarez-Prado, Alfonso Blázquez-Moreno, Funda Çipe, Şule Haskoloğlu, Figen Doğu, Matías Morín, Miguel A. Moreno‐Pelayo, F. García‐Sánchez, Juana Gil-Herrera, Edgar Fernández-Malavé, Hugh T. Reyburn, Almudena R. Ramiro, Aydan İkincioğulları, María J. Recio, José R. Regueiro, Beatriz Garcillán,

Cytomegalovirus and herpesvirus research

T lymphocytes detect antigens with the T-cell receptor (TCR) composed of a variable heterodimer (either αβ or γδ), 2 invariant heterodimers (CD3γε and CD3δε), and an invariant homodimer (CD247 or ζζ).1Call M.E. Pyrdol J. Wiedmann M. Wucherpfennig K.W. The organizing principle in the formation of the T cell receptor-CD3 complex.Cell. 2002; 111: 967-979Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar Because of the crucial role of TCR signaling in thymic selection, mutations in TCR, CD3, or CD247 selectively impair T-cell development, albeit to different degrees: deficiency of CD3δ or CD3ε, but not of CD3γ or CD247, causes severe T-cell lymphopenia. Their clinical outcome is also disparate, because CD3γ deficiency does not require urgent transplantation. Thus, TCR immunodeficiencies display a range of phenotypes and careful differential diagnosis is essential for appropriate therapy. We describe an infant born to consanguineous parents with early-onset chronic cytomegalovirus infection, severe immunodeficiency, and extremely low surface TCR levels. Her immunologic characterization at age 11 months is summarized in Table E1 in this article's Online Repository at www.jacionline.org. Briefly, she showed low T- and B-cell counts, selective severe CD4+ T-cell lymphopenia (Fig 1, A), low recent thymic emigrants, and naive T cells and poor TCRVβ repertoire, all suggestive of a defect in T-cell development despite a normal-sized thymus (see Fig E1 in this article's Online Repository at www.jacionline.org). Surface TCR expression was markedly reduced in both αβ and γδ T cells (Fig 1, B), suggesting a defect in an invariant chain of the TCR complex. Intracellular (i) flow cytometry showed normal CD3γ, δ, and ε expression but almost absolute absence of CD247 (Fig 1, C). cDNA sequencing revealed a homozygous T-to-C mutation at position +2 of exon 1 of CD247 as reported recently2Valés-Gómez M. Esteso G. Aydogmus C. Blázquez-Moreno A. Marin A.V. Briones A.C. et al.NK cell hyporesponsiveness and impaired development in a CD247-deficient patient.J Allergy Clin Immunol. 2016; 137: 942-945.e4Abstract Full Text Full Text PDF PubMed Google Scholar (NCBI/ClinVar: rs672601318), which causes loss of the initiation codon and therefore prevents translation. The patient's parents and 4 additional family members were asymptomatic but heterozygous for the mutation (see Fig E2 in this article's Online Repository at www.jacionline.org). Interestingly, surface TCR expression in mutation carriers was reduced 2-fold (Fig 1, B), revealing a clear correlation between surface TCR and CD247 genotype, which was useful for diagnosis and genetic counseling. Notably, a few T cells in the patient expressed surface TCR levels (Fig 1, A) comparable to those of carriers (CD3εhigh), which correlated with the rare CD247+ T-cell subset (0.2%, Fig 1, C). To confirm this correlation, T cells from the patient were cultured in allogeneic cultures, where CD3εhigh T cells became prominent (see Fig E3 in this article's Online Repository at www.jacionline.org). Fluorescence-activated cell sorting and CD247 Western blot analysis confirmed that the patient's CD3εhigh T cells had recovered CD247 expression (Fig 1, D). RNA sequencing of CD3εhigh T cells revealed 2 independent somatic mutations at or near the germline mutation: a reversion (c.2T>C>T) and a second-site mutation (c.-8A>T) that generates an alternative in-frame initiation codon, 3 codons upstream of the original ATG (Fig 1, E). Given the low frequency of revertant T cells in vivo, it seems improbable that a single cell would carry both somatic mutations. Collectively, these results show that a very small percentage of the patient's T cells had undergone somatic mutations able to revert the inherited mutation, allowing CD247 protein synthesis and thus higher surface TCR expression. Revertant T cells showed diversity in TCRCβ1, CD4, and CD8 expression (data not shown), suggesting that the reversion events occurred early in development. CD69 upregulation and short-term proliferation of primary T cells after anti-CD3 antibody stimulation was impaired in the patient and reduced in carriers (Fig 2, A and B). ZAP-70 and extracellular signal-regulated kinase (ERK) phosphorylation was also impaired in CD247-deficient T cells, whereas revertant T cells displayed carrier phosphorylation levels (Fig 2, C). These results indicate that the reversions could partially rescue TCR signaling in vitro. In contrast, the patient's T cells (both CD3εlow and CD3εhigh) readily proliferated when cultured with allogeneic cells and IL-2 (Fig 2, D), suggesting that their TCR signaling defect could be overcome if a long-term TCR stimulus together with continuous IL-2 supply were present. This is in line with the in vivo expansion of the patient's CD8+ T cells being driven by chronic cytomegalovirus infection, which, in turn, would explain their exhaustion and reduced proliferative response in vitro compared with their CD4+ counterparts. Revertant T cells were capable of expansion in vitro (Fig 2, D) and also, but less efficiently, in vivo (data not shown), where they did not suffice to repopulate the T-cell compartment. The immunologic phenotype of this new patient resembled that of 2 other reported cases of CD247 deficiency (see Table E2 and Fig E4 in this article's Online Repository at www.jacionline.org). In both cases, CD3εlow and CD3εhigh T cells were also identified. The first study3Rieux-Laucat F. Hivroz C. Lim A. Mateo V. Pellier I. Selz F. et al.Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency.N Engl J Med. 2006; 354: 1913-1921Crossref PubMed Scopus (72) Google Scholar reported 3 second-site somatic mutations in CD247 that partially rescued TCR expression but not function, as measured solely by anti-CD3–induced ZAP-70 phosphorylation. No molecular analysis for somatic mutations was reported for the second patient.4Roberts J.L. Lauritsen J.P. Cooney M. Parrott R.E. Sajaroff E.O. Win C.M. et al.T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the T-cell antigen receptor complex.Blood. 2007; 109: 3198-3206Crossref PubMed Scopus (47) Google Scholar Thus, the presence of revertants along with strongly reduced surface TCR expression is pathognomonic of CD247 deficiency.5Garcillan B. Marin A.V. Jimenez-Reinoso A. Briones A.C. Munoz-Ruiz M. Garcia-Leon M.J. et al.Gammadelta T lymphocytes in the diagnosis of human T cell receptor immunodeficiencies.Front Immunol. 2015; 6: 20Crossref PubMed Scopus (30) Google Scholar, 6Marin A.V.M. Garcillán B. Jiménez-Reinoso A. Muñoz-Ruiz M. Briones A.C. Fernández-Malavé E. et al.Human congenital T cell receptor disorders.LymphoSign J. 2015; 2: 3-19Crossref Google Scholar The new case described here showed complete CD247 protein deficiency due to loss of the initiation codon. The disorder was associated with strongly reduced surface TCR and multiple developmental and functional T-cell derangements, suggesting that, as observed in mice,7Love P.E. Shores E.W. Johnson M.D. Tremblay M.L. Lee E.J. Grinberg A. et al.T cell development in mice that lack the zeta chain of the T cell antigen receptor complex.Science. 1993; 261: 918-921Crossref PubMed Scopus (197) Google Scholar CD247 plays a critical role for T-cell selection in the thymus. Yet partial TCR complexes lacking CD247 can signal to some extent for selection. The somatic mutations rescued surface TCR expression as well as proximal and distal TCR-dependent signal transduction, expectedly reaching only mutation carriers’ values. In conclusion, mild lymphopenia and functional revertant somatic mosaicism should not confound the fact that CD247 deficiency is a very severe condition that requires urgent transplantation, but easy to diagnose by intracellular flow cytometry or by the surface TCR phenotype of obligate carriers. We thank the patients, families, and clinicians; Cristina Vicario, María Luisa Jurado, and Miguel Ángel Rodríguez Granado (Regional Transfusion Center, Madrid); Pedro Roda, Patricia Castro, and José Manuel Martin Villa (Complutense University); Craig W. Reynolds (National Cancer Institute, National Institutes of Health, Frederick); Paloma Sánchez-Mateos (Gregorio Marañón Hospital of Madrid); Aurélie Baldolli (University Hospital Caen, France); Rebecca Buckley and Joseph Roberts (Duke University); Alain Fischer (Paris Descartes University); and the Complutense Flow Cytometry and Microscopy Facility. The case has been reported in full previously, in connection with her natural killer (NK)-cell dysfunctions in Valés-Gómez et al.E1Valés-Gómez M. Esteso G. Aydogmus C. Blázquez-Moreno A. Marin A.V. Briones A.C. et al.NK cell hyporesponsiveness and impaired development in a CD247-deficient patient.J Allergy Clin Immunol. 2016; 137: 942-945.e4Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar In addition, and because of the association of reduced CD247 expression with several autoimmune disorders, we analyzed serum samples from the patient and several carriers (IV.1, IV.2, IV.5, IV.7, IV.8, IV.10, IV.11, IV.14, IV.15, IV.16) to determine antinuclear antibodies, thyroid autoantibodies (antithyroglobulin and antithyroperoxidase), antibodies against surface antigens, and intracytoplasmic myeloperoxidase and proteinase 3 in neutrophils, which were all found to be negative. Thus, carriers do not seem to be at risk of autoimmunity, despite their slightly impaired TCR functionality. However, the patient showed several positive direct Coombs tests results (November 2013 to June 2014), which became negative after lymphoid engraftment, thus compatible with asymptomatic subtle hemolytic anemia possibly related to the disease itself or to the chronic cytomegalovirus infection. The study was conducted according to the principles expressed in the Declaration of Helsinki and approved by the Institutional Research Ethics Committees of the hospitals involved. All participants or their guardians provided informed consent for the collection of samples and subsequent analyses. PBMCs from the patient, her family, and healthy controls (age-matched whenever possible) were isolated by centrifugation on a Ficoll-Paque PLUS (GE Healthcare, Little Chalfont, United Kingdom) gradient. Polyclonal T-cell lines were generated by stimulation at day 0 with 1 μg/mL PHA (Sigma-Aldrich, St Louis, Mo), and coculture with irradiated allogeneic feeder cells weekly (PBMC and EBV-transformed B cells, 40 and 65 Gy, respectively) at 1:2 ratio in Iscove's Modified Dulbecco's Medium (IMDM) (GE Healthcare) supplemented with 40 IU/mL recombinant human IL-2 (provided by Craig W. Reynolds, Frederick Cancer Research and Development Center, National Cancer Institute, National Institutes of Health, Frederick, Md), 10% AB+ human serum, and 1% l-glutamine and Antibiotic-Antimycotic (Life Technologies, Carlsbad, Calif). Cell growth was calculated weekly as the ratio of recovered versus seeded cells, and long-term growth plots were estimated as projections thereof. Multiparametric flow cytometry was performed with mAbs against CD3ε (UCHT-1 and S4.1), CD4 (13B8.2), CD45RA (ALB11), and CD45RO (UCHL-1) from Beckman Coulter (Brea, Calif); CD3δ (EP4426), CD3γ (EPR4517), and CD3ε (EPR5361(2)) from Abcam (Cambridge, United Kingdom); CD247 (6B10.2) from Biolegend (San Diego, Calif); CD247 (H146-968) from Thermo Fisher Scientific (Waltham, Mass); αβTCR (BMA 031) from Miltenyi Biotec (Bergisch Gladbach, Germany); and γδTCR (11F2), CD31 (WM59), CD27 (M-T271), CD56 (B159), and CD8 (RPA-T8) from BD Biosciences (San Jose, Calif). For unlabeled antibodies, an additional step with phycoerythrin-conjugated anti-mouse IgG (H + L) from Beckman Coulter or anti-rabbit IgG (H+L) from Life Technologies was performed. For intracellular staining, cells were fixed with 2% paraformaldehyde and permeabilized with 0.5% saponin. Data were acquired with a FACSCalibur flow cytometer (BD Biosciences) and analyzed with FlowJo software (TreeStar, Ashland, Ore). To analyze CD69 induction after TCR engagement, 0.2 × 106 PBMCs were plated in flat-bottom 96-well plates and stimulated for 24 hours with 10 μg/mL of plastic-coated anti-CD3ε mAb (UCHT-1 from BD Biosciences). CD69 induction was analyzed by flow cytometry with anti-CD69 (L-78 from BD Biosciences). Proliferation was measured by dilution of the cell tracer carboxyfluorescein diacetate succinimidyl ester (Sigma Aldrich). Briefly, cells were stained with 1 μM carboxyfluorescein diacetate succinimidyl ester and stimulated with 1 μg/mL UCHT-1 (eBioscience, San Diego, Calif) for 5 days. Phosphorylation of ZAP-70 and extracellular signal-regulated kinase was determined by intracellular flow cytometry after stimulation of 0.3 × 106 cultured cells with 20 μg/mL anti-CD3ε mAb (OKT3 from eBioscience) at 4°C for 30 minutes cross-linked with 10 μg/mL goat F(ab’)2 anti-mouse immunoglobulin (H + L) (Beckman Coulter) at 37 °C for 10 minutes. Phosphorylated (p) proteins were detected by intracellular flow cytometry with rabbit antibodies against pERK (Thr202/Tyr204) and pZAP-70 (Tyr319)/pSyk (Tyr352) from Cell Signaling (Danvers, Mass). A second step with phycoerythrin-labeled anti-rabbit antibody (Life Technologies) was performed. Clonality at the TCRβ locus was studied using a commercial kit (Master Diagnostica, Granada, Spain, EC-certified for clinical use), which amplifies genomic TCR VβJβ rearrangements using 2 specific primers for conserved V- and J-flanking regions. Polyclonal (healthy donor) control DNA was included for reference. Amplimers were separated and analyzed in an ABI Prism Genetic Analyzer 3110 using GeneMapper V 4.0 from Applied Biosystems (Foster City, Calif). Genomic DNA and RNA were obtained from peripheral blood, cultured T cells, or sorted CD3εhigh-expressing cells. Primers for CD3G and CD3E and CD3D have previously been described in Recio et alE2Recio M.J. Moreno-Pelayo M.A. Kilic S.S. Guardo A.C. Sanal O. Allende L.M. et al.Differential biological role of CD3 chains revealed by human immunodeficiencies.J Immunol. 2007; 178: 2556-2564Crossref PubMed Scopus (48) Google Scholar and Gil et al.E3Gil J. Busto E.M. Garcillan B. Chean C. Garcia-Rodriguez M.C. Diaz-Alderete A. et al.A leaky mutation in CD3D differentially affects alphabeta and gammadelta T cells and leads to a Talphabeta-Tgammadelta+B+NK+ human SCID.J Clin Invest. 2011; 121: 3872-3876Crossref PubMed Scopus (40) Google Scholar CD247 cDNA was amplified using specific exon 1–flanking primers (Forward: 5′ ACACCCCAAACCCTCAAACCTC 3′; Reverse: 5′ AGGAGGGCAGGATTTGAAGGAG 3′) and PCR products were sequenced. For CD247 cloning, cDNA was amplified by PCR using specific primers (Forward: 5′ GGAGATCTCCACAGTCCTCCACTTCCTG 3′; Reverse: 5′ GATCCGCGGCCGCA TAGGAAGGCTTTAGCATGCC 3′). DNA fragments were cloned into pJET 1.2 plasmid (CloneJET PCR Cloning Kit, Life Technologies) and transformed into DH5α Escherichia coli strain. Colonies containing recombinant plasmids were also sequenced. CD247 haplotypes were determined by analysis of 4 Sequence Tag Sites in the genetic interval that contains the CD247 gene on chromosome 1q24.2, essentially as described in Recio et al.E2Recio M.J. Moreno-Pelayo M.A. Kilic S.S. Guardo A.C. Sanal O. Allende L.M. et al.Differential biological role of CD3 chains revealed by human immunodeficiencies.J Immunol. 2007; 178: 2556-2564Crossref PubMed Scopus (48) Google Scholar Cells were lysed in buffer containing 0.5% Brij96v; 50 μg of cell lysate was resolved by SDS-PAGE, transferred into polyvinylidene fluoride membranes, and developed with anti–α-tubulin (B5-1-2 clone, Sigma Aldrich) and the rabbit anti-CD247 448 antiserum (specific for the last 34 amino acids of its C-terminal region), kindly provided by Balbino Alarcón, Centro de Biología Molecular Severo Ochoa, UAM-CSIC, Madrid, Spain, and previously described in San Jose et al.E4San Jose E. Sahuquillo A.G. Bragado R. Alarcon B. Assembly of the TCR/CD3 complex: CD3 epsilon/delta and CD3 epsilon/gamma dimers associate indistinctly with both TCR alpha and TCR beta chains: evidence for a double TCR heterodimer model.Eur J Immunol. 1998; 28: 12-21Crossref PubMed Scopus (87) Google Scholar Blots were visualized using an Odyssey infrared imaging system and quantified using Image Studio software (both from LI-COR Biosciences, Lincoln, Neb). To assess statistical significance, the 2-tailed Student t test or 1-way ANOVA with Bonferroni multiple comparison test was performed (*P ≤ .05; **P ≤ .01; ***P ≤ .001). Error bars represent SEM.Fig E2CD247 deficiency due to a homozygous mutation. A, CD247 gene and protein, including the germline mutation (NCBI/ClinVar: rs672601318, NM_000734.3:c.2T>C and NG_007384.1:g.5146T>C in exon 1) and the next in-frame ATG. B, Top, CD247 mutation and haplotypes based on the indicated microsatellite markers (black = disease-associated chromosome). Bottom, pedigree with haplotypes for studied individuals. Circles, squares, and diamonds indicate females, males, or unknown sex, respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3In vitro T-cell growth and phenotype. Surface CD3ε expression in cultured T cells with gates and % for CD3εneg, CD3εlow, and CD3εhigh subpopulations at different time points. SSC, Side scatter.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E4Summary of CD247 germline and somatic mutations. Molecular basis of the 3 reported CD247-deficient patients, 1 patient/box: Exon 2,E6Rieux-Laucat F. Hivroz C. Lim A. Mateo V. Pellier I. Selz F. et al.Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency.N Engl J Med. 2006; 354: 1913-1921Crossref PubMed Scopus (98) Google Scholar Exon 4,E7Roberts J.L. Lauritsen J.P. Cooney M. Parrott R.E. Sajaroff E.O. Win C.M. et al.T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the T-cell antigen receptor complex.Blood. 2007; 109: 3198-3206Crossref PubMed Scopus (61) Google Scholar and Exon 1 (present report). EC, Extracellular; IC, intracellular; LP, leader peptide; TM, transmembrane; WT, wild-type.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Immunologic phenotypeParameterPatient (11 mo)Normal range (11-15 mo)Lymphocytes (cells/mm3), (%)3,0003,200-12,300CD3εlowCD3εhighT (CD3+)1315 (44)5 (0.16)2,400-8,300 (56-87) CD4+66 (5)3 (57)1,300-7,100 (25-86) CD8+1183 (90)2 (29)400-4,100 (7-58) DN (CD4−CD8−)66 (5)0.7 (14)12-140 (0.42-2) TCRγδ+7 (0.5)0 (0)70-630 (1-10) CD4/CD8 ratio0.061.51.7-3.2B (CD19+)∗B cells and eosinophils were determined at 13 and 15 months, respectively. Normal range updated from Ikinciogullari et al,E8 Schatorje et al,E5 Morbach et al,E9 and Aksu et al.E1075 (3)110-7,700 (3-77) CD27− IgD+68 (91)100-7,407 (91-96) CD27+ IgD+0.8 (1)2-316 (1.6-4.1) CD27+ IgD−1.5 (2)0-154 (0.1-1.9) CD27− IgD−4.5 (6)1-185 (0.9-2.1)NK (CD56+ CD16+)1,020 (34)71-3,500 (1-64)Neutrophils (cell/mm3)1,5001,500-8,000Eosinophils∗B cells and eosinophils were determined at 13 and 15 months, respectively. Normal range updated from Ikinciogullari et al,E8 Schatorje et al,E5 Morbach et al,E9 and Aksu et al.E10 (cell/mm3)20040-800Serum Ig (mg/dL) IgG1,260421-1,100 IgA4018-154 IgM13824-180Boldface values indicate out of range.∗ B cells and eosinophils were determined at 13 and 15 months, respectively. Normal range updated from Ikinciogullari et al,E8Ikinciogullari A. Kendirli T. Dogu F. Egin Y. Reisli I. Cin S. et al.Peripheral blood lymphocyte subsets in healthy Turkish children.Turk J Pediatr. 2004; 46: 125-130PubMed Google Scholar Schatorje et al,E5Schatorje E.J. Gemen E.F. Driessen G.J. Leuvenink J. van Hout R.W. de Vries E. Paediatric reference values for the peripheral T cell compartment.Scand J Immunol. 2012; 75: 436-444Crossref PubMed Scopus (130) Google Scholar Morbach et al,E9Morbach H. Eichhorn E.M. Liese J.G. Girschick H.J. Reference values for B cell subpopulations from infancy to adulthood.Clin Exp Immunol. 2010; 162: 271-279Crossref PubMed Scopus (256) Google Scholar and Aksu et al.E10Aksu G. Genel F. Koturoglu G. Kurugol Z. Kutukculer N. Serum immunoglobulin (IgG, IgM, IgA) and IgG subclass concentrations in healthy children: a study using nephelometric technique.Turk J Pediatr. 2006; 48: 19-24PubMed Google Scholar Open table in a new tab Table E2Comparative clinical and immunologic features of CD247-deficient patientsFeaturePresent reportRieux-Laucat et alE6Rieux-Laucat F. Hivroz C. Lim A. Mateo V. Pellier I. Selz F. et al.Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency.N Engl J Med. 2006; 354: 1913-1921Crossref PubMed Scopus (98) Google ScholarRoberts et alE7Roberts J.L. Lauritsen J.P. Cooney M. Parrott R.E. Sajaroff E.O. Win C.M. et al.T-B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3zeta subunit of the T-cell antigen receptor complex.Blood. 2007; 109: 3198-3206Crossref PubMed Scopus (61) Google ScholarSexFemaleMaleFemaleOnset2 mo4 mo4 moAge at diagnosis (mo)111011HSCT (mo)Haploidentical (19)Haploidentical (30)Haploidentical (12, 16)Present age33 mo†Exitus at.13 y∗Alain Fischer, Paris Descartes University, and Rebecca Buckley and Joseph Roberts, Duke University (personal communication, 2015).4 y∗Alain Fischer, Paris Descartes University, and Rebecca Buckley and Joseph Roberts, Duke University (personal communication, 2015).†Exitus at.Cytomegalovirus+−+Germline mutation TypeTruncationTruncationInsertion cDNAc.2T>Cc.208C>Tc.411insC Proteinp.M1Tp.Q70Xp.D138fsX272Serum immunoglobulin levelsHigh (IgG)High (IgG, -A, -M, -E)High (IgG,‡Receiving IVIG. -A, -M)T-cell lymphopeniaMildMildMildCD3εhigh % of T cells0.36100.6 LineageCD4 and CD8CD4CD4 and CD8 Somatic mutationsYes (2)Yes (3)NARevertantYesNoNASecond siteYesYesNA FunctionalYes (= carriers)NoNACD3εlow % of T cells99.690.099.4 CD4/CD8 ratioInverted (0.06)Inverted (0.23)Inverted (0.85) FunctionalNoNoNoIVIG, Intravenous immunoglobulin; NA, not analyzed.∗ Alain Fischer, Paris Descartes University, and Rebecca Buckley and Joseph Roberts, Duke University (personal communication, 2015).† Exitus at.‡ Receiving IVIG. Open table in a new tab Boldface values indicate out of range. IVIG, Intravenous immunoglobulin; NA, not analyzed.