
First Report of Meloidogyne arenaria on Lisianthus ( Eustoma grandiflorum ) in Brazil
2016; American Phytopathological Society; Volume: 101; Issue: 3 Linguagem: Inglês
10.1094/pdis-09-16-1352-pdn
ISSN1943-7692
AutoresC. G. Neves, Cristiano Bellé, Monique Bezerra Nascimento, Paulo Roberto Grolli, C. B. Gomes, Danielle Ribeiro de Barros,
Tópico(s)Nematode management and characterization studies
ResumoHomePlant DiseaseVol. 101, No. 3First Report of Meloidogyne arenaria on Lisianthus (Eustoma grandiflorum) in Brazil PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Meloidogyne arenaria on Lisianthus (Eustoma grandiflorum) in BrazilC. G. Neves, C. Bellé, M. B. Nascimento, P. R. Grolli, C. B. Gomes, and D. R. BarrosC. G. NevesSearch for more papers by this author, C. Belléhttp://orcid.org/0000-0003-2247-3207Search for more papers by this author, M. B. NascimentoSearch for more papers by this author, P. R. GrolliSearch for more papers by this author, C. B. GomesSearch for more papers by this author, and D. R. BarrosSearch for more papers by this authorAffiliationsAuthors and Affiliations C. G. Neves C. Bellé M. B. Nascimento P. R. Grolli , Universidade Federal de Pelotas - UFPel, Pelotas - 96010-900, RS, Brazil C. B. Gomes , Embrapa Clima Temperado, 96010-971, Pelotas, RS, Brazil D. R. Barros , Universidade Federal de Pelotas - UFPel, Pelotas - 96010-900, RS, Brazil. Published Online:23 Dec 2016https://doi.org/10.1094/PDIS-09-16-1352-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Lisianthus (Eustoma grandiflorum) is an ornamental species cultivated in pots or as cut-flower and it has been growing in Brazil since the 1990s. During summer 2015, lisianthus plants (cv. Mariachi Blue) exhibiting symptoms of stunting, leaf wilting, and multiple galls in the roots associated with root-knot nematode (Meloidogyne sp.) were detected in a commercial field in the municipality of Dois Irmãos (29°35′ S, 51°06′ W), Rio Grande do Sul State, Brazil. Subsequently, individual females (n = 40) were extracted from root samples and submitted to Meloidogyne species identification by α-esterase phenotypes (Carneiro and Almeida 2001), perineal pattern morphological analysis (n = 20), morphometric measurements of second stage juveniles (J2) (n = 20), and amplification of the D2/D3 fragments of the 28S rRNA using universal primers D2A (5′ACAAGTACCGTGAGGGAAAGTTG3′) and D3B (5′TCGGAAGGAACCAGCTACTA3′). In addition, root and soil samples were processed to determine the number of eggs and J2. The nematode population density was 534 eggs and J2 per gram of fresh root and 250 J2 per 100 cm3 of soil. The analyze of polymorphisms of α-esterase phenotypes revealed the A2 phenotype (Rm = 1.26, 1.36) typical of Meloidogyne arenaria (Carneiro et al. 2008). Perineal patterns of females showed a low dorsal arch, with lateral field marked by forked and broken striae; phasmids apart 30.08 μm (27.67 to 33.23 μm). No punctate markings between anus and tail terminus were observed, similar to the M. arenaria description. The measured M. arenaria J2 showed the following morphometric characters: body length = 483.05 ± 21.33 µm; body width = 15.04 ± 0,96 µm; a = 32.25 ± 2.6; c = 8.65 ± 0.67; DGO = 3.02 ± 0.43 µm; stylet = 13.14 ± 1.24 µm; tail length = 56.20 ± 5.27 µm; hyaline tail terminus = 9.70 ± 0.87 µm. The DNA fragment obtained showed a 754 bp length (GenBank accession no. KX151138) that was sequenced and analyzed, revealing more than 99.9% homology with M. arenaria sequence data from United States (EU364889) and South Africa (KC287191, KC287192, and JX987332) populations. The confirmation of nematode species identification was done by PCR species-specific SCAR using the primer set Far (5′-TCGGCGATAGAGGTAAATGAC-3′) and Rar (5′-TCGGCGATAGACACTACAAACT-3′). The PCR product of SCAR was ∼420 bp, which was identical to that previously reported for M. arenaria (Zijlstra et al. 2000). To verify the nematode pathogenicity on lisianthus plants, individual plantlets of cv. Mariachi Blue, maintained in pots with sterilized soil (10 replicates), were inoculated with 5,000 eggs plus J2 of a pure population of M. arenaria under greenhouse conditions. A noninoculated control was included in the test (10 replicates). After 70 days, all inoculated plants showed reduced growth compared with control. In addition, root-galling symptoms were similar to those observed in the field, and the mean nematode reproduction factor (final population/initial population) was 9.6. M. arenaria is one of the most important root-knot nematodes and causes great losses in many crops around the world (Perry et al. 2009). Although other Meloidogyne species, including M. javanica, M. incognita, and M. hapla, have already been described infecting lisianthus (Schochow et al. 2004), this is the first report of M. arenaria parasitizing this plant around the world. This finding has great importance to Brazilian flower growers to establish management measures for this nematode in lisianthus.References:Carneiro, R. M. D. G., et al. 2008. Nematology 10:819. https://doi.org/10.1163/156854108786161526 Crossref, ISI, Google ScholarCarneiro, R. M. D. G., and Almeida, M. R. A. 2001. Nematologia Bras. 25:35. Google ScholarPerry, R. N., et al. 2009. Root-Knot Nematodes. CABI, Wallingford, UK. https://doi.org/10.1079/9781845934927.0000 Crossref, Google ScholarSchochow, M., et al. 2004. HortScience 39:120. Crossref, ISI, Google ScholarZijlstra, C., et al. 2000. Nematology 2:847. https://doi.org/10.1163/156854100750112798 Crossref, ISI, Google ScholarC. G. Neves and C. Bellé contributed equally to this work.DetailsFiguresLiterature CitedRelated Vol. 101, No. 3 March 2017SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 9 Feb 2017Published: 23 Dec 2016First Look: 14 Nov 2016Accepted: 10 Nov 2016 Pages: 511-511 Information© 2017 The American Phytopathological SocietyCited byQuality of floral stems of lisianthus (Eustoma grandiflorum Raf.) inoculated with Bacillus subtilis and Glomus intraradices1 December 2022 | Ornamental Horticulture, Vol. 28, No. 4Meloidogyne arenaria (peanut root-knot nematode)CABI Compendium, Vol. CABI CompendiumFirst Report of Meloidogyne arenaria Infecting Maidong (Ophiopogon japonicus) in ChinaWen-tao Wu, Kun-hao Ye, Shao-fang Zhou, Zhu-hua Wang, Li-wei Guo, Shu-sheng Zhu, You-yong Zhu, Yang Wang, and Xia-hong He3 December 2021 | Plant Disease, Vol. 105, No. 12Identification of plant-parasitic nematodes associated with cut flowers7 June 2019 | Journal of Plant Diseases and Protection, Vol. 126, No. 5Root and stem rot on lisianthus ( Eustoma grandiflorum ) in China caused by Fusarium solani1 October 2018 | Canadian Journal of Plant Pathology, Vol. 40, No. 3
Referência(s)