Portal de Periódicos da CAPES

First Report of Beet curly top virus -PeYD Associated With a New Disease in Chile Pepper Plants in Zacatecas, Mexico

2016; American Phytopathological Society; Volume: 101; Issue: 3 Linguagem: Inglês

10.1094/pdis-09-16-1277-pdn

1943-7692

J. A. Mauricio-Castillo, Luís Roberto Reveles-Torres, Jaime Mena-Covarrubias, Gerardo R. Argüello‐Astorga, Rebecca Creamer, Ambrosio Franco-Bañuelos, S. Salas-Muñoz,

Insect-Plant Interactions and Control

HomePlant DiseaseVol. 101, No. 3First Report of Beet curly top virus-PeYD Associated With a New Disease in Chile Pepper Plants in Zacatecas, Mexico PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Beet curly top virus-PeYD Associated With a New Disease in Chile Pepper Plants in Zacatecas, MexicoJ. A. Mauricio-Castillo, L. R. Reveles-Torres, J. Mena-Covarrubias, G. R. Argüello-Astorga, R. Creamer, A. Franco-Bañuelos, and S. Salas-MuñozJ. A. Mauricio-CastilloSearch for more papers by this author, L. R. Reveles-TorresSearch for more papers by this author, J. Mena-CovarrubiasSearch for more papers by this author, G. R. Argüello-AstorgaSearch for more papers by this author, R. CreamerSearch for more papers by this author, A. Franco-BañuelosSearch for more papers by this author, and S. Salas-MuñozSearch for more papers by this authorAffiliationsAuthors and Affiliations J. A. Mauricio-Castillo , Unidad Academica de Agronomia de la Universidad Autonoma de Zacatecas, Mexico L. R. Reveles-Torres J. Mena-Covarrubias , Campo Experimental Zacatecas-INIFAP, Zacatecas, Mexico G. R. Argüello-Astorga , Instituto Potosino de Investigación Cientifica y Tecnológica, San Luis Potosi, Mexico R. Creamer , New Mexico State University, Las Cruces, NM A. Franco-Bañuelos , Unidad Academica de Agronomia de la Universidad Autonoma de Zacatecas, Mexico S. Salas-Muñoz , CONACYT-Campo Experimental Zacatecas-INIFAP, Calera de VR, Zacatecas, México. Published Online:28 Dec 2016https://doi.org/10.1094/PDIS-09-16-1277-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Geminiviruses in the genus Curtovirus are vectored by the beet leafhopper (Circulifer tenellus Baker) and infect a wide range of dicotyledonous plants. During summer 2014, symptoms of upwardly rolled leaves, yellowing, and stunted growth were observed in ∼14% of chile pepper plants (Capsicum annuum L. var. Pasilla) from 40 ha of commercial fields in the municipality of Villa de Cos, Zacatecas (23°29′30″ N, 102°8′0″ W). Total DNA was extracted from nine symptomatic and four symptomless chile pepper plants and subjected to PCR analysis using two pairs of degenerate primers specific for curtoviruses (Velasquez-Valle et al. 2012): RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). All symptomatic plants produced amplicons of the expected size (1.75 and 1.8 kb, respectively). No PCR products were obtained from the symptomless plants. All the PCR amplicons were cloned separately and directly sequenced. The overlapping DNA fragments isolated from each extract were assembled into a complete genome sequence (2,971 bp). BLAST analysis of all the viral sequences revealed that they shared 99.9% sequence identity to each other and 96% sequence identity with Beet curly top virus (BCTV)-PeYD (GenBank accession no. EU921828). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, Ren, C4, V1, V2, and V3) encoded by the curtovirus detected in chile pepper plants (KX529650) shared 95.3, 97.3, 97.1, 91.8, 94.1, 86.5, and 92% sequence identity, respectively, with the homologous proteins of BCTV-PeYD. Finally, beet leafhoppers were collected from one of the sampled fields and total DNA was isolated from a pool of 25 insects. Amplification of viral DNA using the primers RepQEW-for and CP450-rev and further sequencing of the amplicons confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99.9%) with the virus sequence detected in symptomatic chile pepper plants. Previously, BCTV-PeYD has been reported affecting chile pepper plants in New Mexico (Lam et al. 2009) and spinach and common beet in Arizona (Nischwitz and Olsen 2010). To our knowledge, this is the first report of BCTV-PeYD associated with symptomatic chile peppers in Mexico. The presence of BCTV-PeYD in chile pepper may impose epidemiological constrains to the cultivation of this economically important crop in Mexico.References:Lam, N., et al. 2009. Arch. Virol. 154:429. https://doi.org/10.1007/s00705-009-0320-1 Crossref, ISI, Google ScholarNischwitz, C., and Olsen, M. 2010. Plant Health Prog. Online publication. https://doi.org/10.1094/PHP-2010-0216-02-BR Google ScholarVelasquez-Valle, R., et al. 2012. Plant Dis. 96:771. https://doi.org/10.1094/PDIS-02-12-0122-PDN Link, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 101, No. 3 March 2017SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 9 Feb 2017Published: 28 Dec 2016First Look: 14 Nov 2016Accepted: 10 Nov 2016 Page: 513 Information© 2017 The American Phytopathological SocietyCited byBeet curly top virus (curly top)CABI Compendium, Vol. CABI CompendiumCirculifer tenellus (beet leafhopper)CABI Compendium, Vol. CABI CompendiumA Multiyear Survey and Identification of Pepper- and Tomato-Infecting Viruses in Yunnan Province, China26 February 2021 | Frontiers in Microbiology, Vol. 12Beet curly top virus transmission, epidemiology, and managementCapsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020