Profiling Subcellular Protein Phosphatase Responses to Coxsackievirus B3 Infection of Cardiomyocytes
2017; Elsevier BV; Volume: 16; Issue: 4 Linguagem: Inglês
10.1074/mcp.o116.063487
ISSN1535-9484
AutoresMillie Shah, Christian Smolko, Sarah Kinicki, Zachary D. Chapman, David L. Brautigan, Kevin A. Janes,
Tópico(s)Cardiomyopathy and Myosin Studies
ResumoCellular responses to stimuli involve dynamic and localized changes in protein kinases and phosphatases. Here, we report a generalized functional assay for high-throughput profiling of multiple protein phosphatases with subcellular resolution and apply it to analyze coxsackievirus B3 (CVB3) infection counteracted by interferon signaling. Using on-plate cell fractionation optimized for adherent cells, we isolate protein extracts containing active endogenous phosphatases from cell membranes, the cytoplasm, and the nucleus. The extracts contain all major classes of protein phosphatases and catalyze dephosphorylation of plate-bound phosphosubstrates in a microtiter format, with cellular activity quantified at the end point by phosphospecific ELISA. The platform is optimized for six phosphosubstrates (ERK2, JNK1, p38α, MK2, CREB, and STAT1) and measures specific activities from extracts of fewer than 50,000 cells. The assay was exploited to examine viral and antiviral signaling in AC16 cardiomyocytes, which we show can be engineered to serve as susceptible and permissive hosts for CVB3. Phosphatase responses were profiled in these cells by completing a full-factorial experiment for CVB3 infection and type I/II interferon signaling. Over 850 functional measurements revealed several independent, subcellular changes in specific phosphatase activities. During CVB3 infection, we found that type I interferon signaling increases subcellular JNK1 phosphatase activity, inhibiting nuclear JNK1 activity that otherwise promotes viral protein synthesis in the infected host cell. Our assay provides a high-throughput way to capture perturbations in important negative regulators of intracellular signal-transduction networks. Cellular responses to stimuli involve dynamic and localized changes in protein kinases and phosphatases. Here, we report a generalized functional assay for high-throughput profiling of multiple protein phosphatases with subcellular resolution and apply it to analyze coxsackievirus B3 (CVB3) infection counteracted by interferon signaling. Using on-plate cell fractionation optimized for adherent cells, we isolate protein extracts containing active endogenous phosphatases from cell membranes, the cytoplasm, and the nucleus. The extracts contain all major classes of protein phosphatases and catalyze dephosphorylation of plate-bound phosphosubstrates in a microtiter format, with cellular activity quantified at the end point by phosphospecific ELISA. The platform is optimized for six phosphosubstrates (ERK2, JNK1, p38α, MK2, CREB, and STAT1) and measures specific activities from extracts of fewer than 50,000 cells. The assay was exploited to examine viral and antiviral signaling in AC16 cardiomyocytes, which we show can be engineered to serve as susceptible and permissive hosts for CVB3. Phosphatase responses were profiled in these cells by completing a full-factorial experiment for CVB3 infection and type I/II interferon signaling. Over 850 functional measurements revealed several independent, subcellular changes in specific phosphatase activities. During CVB3 infection, we found that type I interferon signaling increases subcellular JNK1 phosphatase activity, inhibiting nuclear JNK1 activity that otherwise promotes viral protein synthesis in the infected host cell. Our assay provides a high-throughput way to capture perturbations in important negative regulators of intracellular signal-transduction networks. Protein phosphorylation is a critical component of cellular signal transduction (1.Downward J. The ins and outs of signalling.Nature. 2001; 411: 759-762Crossref PubMed Scopus (154) Google Scholar, 2.Hunter T. Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling.Cell. 1995; 80: 225-236Abstract Full Text PDF PubMed Scopus (2480) Google Scholar). In response to extracellular stimulation by cytokines, hormones, and environmental stresses, protein kinases catalyze phosphorylation events that alter substrate activity, protein localization, gene expression, and cell phenotype (Fig. 1). To reverse these events and return the cell to a resting state, protein phosphatases dephosphorylate many phosphoprotein substrates (3.Tonks N.K. Protein tyrosine phosphatases: from genes, to function, to disease.Nat. Rev. Mol. Cell Biol. 2006; 7: 833-846Crossref PubMed Scopus (1116) Google Scholar, 4.Cohen P.T.W. Protein phosphatase 1 – targeted in many directions.J. Cell Sci. 2002; 115: 241-256Crossref PubMed Google Scholar, 5.Owens D.M. Keyse S.M. Differential regulation of MAP kinase signalling by dual-specificity protein phosphatases.Oncogene. 2007; 26: 3203-3213Crossref PubMed Scopus (579) Google Scholar). Phosphatase abundance and activity determine the extent of constitutive signaling (6.Heinrich R. Neel B.G. Rapoport T.A. Mathematical models of protein kinase signal transduction.Mol. Cell. 2002; 9: 957-970Abstract Full Text Full Text PDF PubMed Scopus (384) Google Scholar) as well as the magnitude and duration of pathway stimulation (7.Bhalla U.S. Ram P.T. Iyengar R. MAP kinase phosphatase as a locus of flexibility in a mitogen-activated protein kinase signaling network.Science. 2002; 297: 1018-1023Crossref PubMed Scopus (504) Google Scholar). Accordingly, misregulated protein phosphatases have been implicated in many diseases, including cardiomyopathy, cancer, and inflammatory conditions (8.Auger-Messier M. Accornero F. Goonasekera S.A. Bueno O.F. Lorenz J.N. van Berlo J.H. Willette R.N. Molkentin J.D. Unrestrained p38 MAPK activation in Dusp1/4 double-null mice induces cardiomyopathy.Circ. Res. 2013; 112: 48-56Crossref PubMed Scopus (54) Google Scholar, 9.Keyse S.M. Dual-specificity MAP kinase phosphatases (MKPs) and cancer.Cancer Metastasis Rev. 2008; 27: 253-261Crossref PubMed Scopus (325) Google Scholar, 10.Zhao Q. Wang X. Nelin L.D. Yao Y. Matta R. Manson M.E. Baliga R.S. Meng X. Smith C.V. Bauer J.A. Chang C.-H. Liu Y. MAP kinase phosphatase 1 controls innate immune responses and suppresses endotoxic shock.J. Exp. Med. 2006; 203: 131-140Crossref PubMed Scopus (310) Google Scholar, 11.Brewis N. Ohst K. Fields K. Rapacciuolo A. Chou D. Bloor C. Dillmann W. Rockman H. Walter G. Dilated cardiomyopathy in transgenic mice expressing a mutant A subunit of protein phosphatase 2A.Am. J. Physiol. 2000; 279: SH1307-SH1318Google Scholar). There are ∼500 protein kinases and ∼180 protein phosphatases in the human genome, indicating that phosphatases must target a larger breadth of substrates (12.Arena S. Benvenuti S. Bardelli A. Genetic analysis of the kinome and phosphatome in cancer.Cell. Mol. Life Sci. 2005; 62: 2092-2099Crossref PubMed Scopus (57) Google Scholar). The catalytic subunits of the protein phosphatases PP1 and PP2A dephosphorylate most phospho-Ser/Thr-containing proteins, with selectivity conferred by regulatory subunits and subcellular localization (13.Shi Y. Serine/threonine phosphatases: Mechanism through structure.Cell. 2009; 139: 468-484Abstract Full Text Full Text PDF PubMed Scopus (891) Google Scholar). In contrast, dual-specificity phosphatases (DUSPs) 1The abbreviations used are: DUSP, dual specificity phosphatase; ANOVA, analysis of variance; ARE, AU-rich element; CAR, coxsackievirus and adenovirus receptor; Clv, Casp3 cleaved caspase 3; CREB, CAMP responsive element binding protein; CV, coefficient of variation; CVB3, coxsackievirus B3; DAF, decay accelerating factor; EGF, epidermal growth factor; eIF4G, eukaryotic translation initiation factor 4 gamma; ERK2, extracellular signal-regulated kinase 2; G6P, glucose-6-phosphate; Gluc, glucose; HK, or Hexo hexokinase; HSP90, heat shock protein 90 kDa; HRP, horseradish peroxidase; IFN, interferon; JAK, Janus kinase; JNK1, JUN N-Terminal kinase; MAPK, mitogen-activated protein kinase; MAVS, mitochondrial antiviral signaling protein; MCLR, microcystin-LR; MK2, mitogen-activated protein kinase-activated protein kinase 2; MOI, multiplicity of infection; NaPP, sodium pyrophosphate; Na3VO4, sodium orthovanadate; NE, NP40 extract; NP40, Nonidet P-40; PFA, paraformaldehyde; PFU, plaque forming unit; PP1, protein phosphatase 1; PP2A, protein phosphatase 2A; PTP, protein tyrosine phosphatase; RIPA, radioimmunoprecipitation assay buffer; SDS, sodium dodecyl sulfate; SE, saponin extract; STAT1, signal transducer and activator of transcription 1; SV40, Simian virus 40; VP1, viral protein 1; WB, western blot.1The abbreviations used are: DUSP, dual specificity phosphatase; ANOVA, analysis of variance; ARE, AU-rich element; CAR, coxsackievirus and adenovirus receptor; Clv, Casp3 cleaved caspase 3; CREB, CAMP responsive element binding protein; CV, coefficient of variation; CVB3, coxsackievirus B3; DAF, decay accelerating factor; EGF, epidermal growth factor; eIF4G, eukaryotic translation initiation factor 4 gamma; ERK2, extracellular signal-regulated kinase 2; G6P, glucose-6-phosphate; Gluc, glucose; HK, or Hexo hexokinase; HSP90, heat shock protein 90 kDa; HRP, horseradish peroxidase; IFN, interferon; JAK, Janus kinase; JNK1, JUN N-Terminal kinase; MAPK, mitogen-activated protein kinase; MAVS, mitochondrial antiviral signaling protein; MCLR, microcystin-LR; MK2, mitogen-activated protein kinase-activated protein kinase 2; MOI, multiplicity of infection; NaPP, sodium pyrophosphate; Na3VO4, sodium orthovanadate; NE, NP40 extract; NP40, Nonidet P-40; PFA, paraformaldehyde; PFU, plaque forming unit; PP1, protein phosphatase 1; PP2A, protein phosphatase 2A; PTP, protein tyrosine phosphatase; RIPA, radioimmunoprecipitation assay buffer; SDS, sodium dodecyl sulfate; SE, saponin extract; STAT1, signal transducer and activator of transcription 1; SV40, Simian virus 40; VP1, viral protein 1; WB, western blot. hydrolyze phospho-Tyr residues paired with phospho-Ser/Thr sites, narrowly targeting bisphosphorylated MAP kinases (MAPKs) ERK, JNK, and p38 through kinase-interaction motifs (14.Zhang Y.Y. Wu J.W. Wang Z.X. A distinct interaction mode revealed by the crystal structure of the kinase p38alpha with the MAPK binding domain of the phosphatase MKP5.Sci. Signal. 2011; 4: era88Crossref Scopus (32) Google Scholar) (Fig. 1). DUSP targeting is further refined by subcellular localization and the nucleocytoplasmic shuttling characteristics of each MAPK (5.Owens D.M. Keyse S.M. Differential regulation of MAP kinase signalling by dual-specificity protein phosphatases.Oncogene. 2007; 26: 3203-3213Crossref PubMed Scopus (579) Google Scholar, 15.Wood C.D. Thornton T.M. Sabio G. Davis R.A. Rincon M. Nuclear localization of p38 MAPK in response to DNA damage.Int. J. Biol. Sci. 2009; 5: 428-437Crossref PubMed Google Scholar, 16.Gong X. Ming X. Deng P. Jiang Y. Mechanisms regulating the nuclear translocation of p38 MAP kinase.J. Cell. Biochem. 2010; 110: 1420-1429Crossref PubMed Scopus (56) Google Scholar, 17.Ben-Levy R. Hooper S. Wilson R. Paterson H.F. Marshall C.J. Nuclear export of the stress-activated protein kinase p38 mediated by its substrate MAPKAP kinase-2.Curr. Biol. 1998; 8: 1049-1057Abstract Full Text Full Text PDF PubMed Google Scholar, 18.Lenormand P. Sardet C. Pages G. L'Allemain G. Brunet A. Pouyssegur J. Growth factors induce nuclear translocation of MAP kinases (p42mapk and p44mapk) but not of their activator MAP kinase kinase (p45mapkk) in fibroblasts.J. Cell Biol. 1993; 122: 1079-1088Crossref PubMed Google Scholar, 19.Wang J. Tang R. Lv M. Wang Q. Zhang X. Guo Y. Chang H. Qiao C. Xiao H. Li X. Li Y. Shen B. Zhang J. Defective anchoring of JNK1 in the cytoplasm by MKK7 in Jurkat cells is associated with resistance to Fas-mediated apoptosis.Mol. Biol. Cell. 2011; 22: 117-127Crossref PubMed Scopus (11) Google Scholar). DUSPs comprise part of a larger family of protein tyrosine phosphatases (PTPs) that dephosphorylate phospho-Tyr exclusively (3.Tonks N.K. Protein tyrosine phosphatases: from genes, to function, to disease.Nat. Rev. Mol. Cell Biol. 2006; 7: 833-846Crossref PubMed Scopus (1116) Google Scholar). Receptor-like PTPs have access to substrates near cell membranes, whereas nontransmembrane PTPs act elsewhere within the cell (Fig. 1). Phosphatases can dephosphorylate a variety of substrates, but multiple phosphatases may also converge upon the same substrate. For example, the bisphosphorylated site in MAPKs is deactivated by DUSPs but also by the coordinate action of Ser/Thr phosphatases and PTPs (20.Alessi D.R. Gomez N. Moorhead G. Lewis T. Keyse S.M. Cohen P. Inactivation of p42 MAP kinase by protein phosphatase 2A and a protein tyrosine phosphatase, but not CL100, in various cell lines.Curr. Biol. 1995; 5: 283-295Abstract Full Text Full Text PDF PubMed Google Scholar). The extent of targeting is dictated by the abundance of protein phosphatase and phosphosubstrate along with their respective proximity in the cell (4.Cohen P.T.W. Protein phosphatase 1 – targeted in many directions.J. Cell Sci. 2002; 115: 241-256Crossref PubMed Google Scholar, 5.Owens D.M. Keyse S.M. Differential regulation of MAP kinase signalling by dual-specificity protein phosphatases.Oncogene. 2007; 26: 3203-3213Crossref PubMed Scopus (579) Google Scholar, 21.Scott J.D. Pawson T. Cell signaling in space and time: Where proteins come together and when they're apart.Science. 2009; 326: 1220-1224Crossref PubMed Scopus (415) Google Scholar, 22.Moorhead G.B. Trinkle-Mulcahy L. Ulke-Lemee A. Emerging roles of nuclear protein phosphatases.Nat. Rev. Mol. Cell Biol. 2007; 8: 234-244Crossref PubMed Scopus (271) Google Scholar). The redundancy, promiscuity, and multi-layered regulation of protein phosphatases make it challenging to define their specific roles in intracellular signaling (23.Sacco F. Perfetto L. Castagnoli L. Cesareni G. The human phosphatase interactome: An intricate family portrait.Febs Letters. 2012; 586: 2732-2739Crossref PubMed Scopus (0) Google Scholar). Monitoring cellular protein dephosphorylation events would be greatly aided by high-throughput methods that capture multiple mechanisms of phosphatase regulation. In typical activity assays, phosphatases are purified from extracts and measured using a synthetic phosphopeptide substrate (24.Kameshita I. Baba H. Umeda Y. Sueyoshi N. In-gel protein phosphatase assay using fluorogenic substrates.Anal. Biochem. 2010; 400: 118-122Crossref PubMed Scopus (21) Google Scholar, 25.Burridge K. Nelson A. An in-gel assay for protein tyrosine phosphatase activity: detection of widespread distribution in cells and tissues.Anal. Biochem. 1995; 232: 56-64Crossref PubMed Scopus (85) Google Scholar, 26.McAvoy T. Nairn A.C. Serine/threonine protein phosphatase assays.Curr. Protoc. Mol. Biol. 2010; (CHAPTER, Unit 18.18)Crossref PubMed Scopus (33) Google Scholar, 27.Montalibet J. Skorey K.I. Kennedy B.P. Protein tyrosine phosphatase: enzymatic assays.Methods. 2005; 35: 2-8Crossref PubMed Scopus (117) Google Scholar). This strategy captures changes in protein phosphatase abundance, but the enzyme may lose endogenous regulators during the purification, and subcellular localization is usually homogenized. It is also doubtful that short, unstructured phosphopeptides accurately reflect phosphatase activity in the same way as full-length phosphoproteins. Endogenous phosphatase activity measurements are possible by incubating total cell extracts with 32P-radiolabeled phosphoproteins (28.Geladopoulos T.P. Sotiroudis T.G. Evangelopoulos A.E. A malachite green colorimetric assay for protein phosphatase activity.Anal. Biochem. 1991; 192: 112-116Crossref PubMed Scopus (311) Google Scholar). However, robust protein phosphatase activities or heavily labeled substrates are required; thus, the approach does not scale well to dozens or hundreds of samples. We previously developed a substrate-focused protein phosphatase activity assay using phosphorylated MAPKs and homogenized cellular extracts in a phospho-ELISA format (29.Bose A.K. Janes K.A. A high-throughput assay for phosphoprotein-specific phosphatase activity in cellular extracts.Mol. Cell. Proteomics. 2013; 12: 797-806Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). Phosphatase activity in the extract was measured as the decrease in phosphorylated full-length recombinant MAPK substrates adsorbed to a 96-well plate. Although this approach captured substrate-phosphatase interactions, it could not characterize subcellular regulation of protein phosphatase activity and only included MAPKs. A true multi-pathway protein phosphatase assay with subcellular resolution would provide a better systems-level view of how signal transduction is negatively regulated. Here, we introduce a high-throughput assay that now measures substrate dephosphorylation by all major classes of protein phosphatases in different biochemically defined subcellular compartments. We begin with a high-throughput, scalable lysis procedure that collects paired saponin- and detergent-soluble extracts containing active protein phosphatases from adherent cells. The activity of subcellular phosphatases is then quantified by phospho-ELISA using a panel of recognized full-length phosphoproteins. Building upon our past success with phosphorylated MAPKs (29.Bose A.K. Janes K.A. A high-throughput assay for phosphoprotein-specific phosphatase activity in cellular extracts.Mol. Cell. Proteomics. 2013; 12: 797-806Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar), we add three new phosphosubstrates—phospho-MK2 (Thr334), phospho-CREB (Ser133), and phospho-STAT1 (Tyr701)—each with distinct patterns of localization and targeting by protein phosphatase enzymes (Fig. 1). Together, these substrates provide a subcellular phosphatase activity signature for the cellular response to growth factors, cytokines, and environmental stress. As a prototypical cellular stress that engages several host-cell signaling pathways, we investigated changes in protein phosphatase activities during acute viral infection. Coxsackievirus B3 (CVB3) is a cardiotropic picornavirus that causes myocarditis in infants and young children (30.Burch G.E. Sun S.C. Chu K.C. Sohal R.S. Colcolough H.L. Interstitial and coxsackievirus B myocarditis in infants and children. A comparative histologic and immunofluorescent study of 50 autopsied hearts.JAMA. 1968; 203: 1-8Crossref PubMed Google Scholar, 31.Cooper Jr., L.T. Myocarditis. N. Engl. J. Med. 2009; 360: 1526-1538Crossref PubMed Scopus (741) Google Scholar). The CVB3 genome encodes neither protein kinases nor phosphatases but widely alters the phosphorylation state of the infected host cell (32.Liu P. Aitken K. Kong Y.Y. Opavsky M.A. Martino T. Dawood F. Wen W.H. Kozieradzki I. Bachmaier K. Straus D. Mak T.W. Penninger J.M. The tyrosine kinase p56lck is essential in coxsackievirus B3-mediated heart disease.Nat. Med. 2000; 6: 429-434Crossref PubMed Scopus (120) Google Scholar, 33.Shenoy-Scaria A.M. Kwong J. Fujita T. Olszowy M.W. Shaw A.S. Lublin D.M. Signal transduction through decay-accelerating factor. Interaction of glycosyl-phosphatidylinositol anchor and protein tyrosine kinases p56lck and p59fyn 1.J. Immunol. 1992; 149: 3535-3541PubMed Google Scholar, 34.Coyne C.B. Bergelson J.M. Virus-induced Abl and Fyn kinase signals permit coxsackievirus entry through epithelial tight junctions.Cell. 2006; 124: 119-131Abstract Full Text Full Text PDF PubMed Scopus (404) Google Scholar, 35.Garmaroudi F.S. Marchant D. Si X. Khalili A. Bashashati A. Wong B.W. Tabet A. Ng R.T. Murphy K. Luo H. Janes K.A. McManus B.M. Pairwise network mechanisms in the host signaling response to coxsackievirus B3 infection.Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 17053-17058Crossref PubMed Scopus (0) Google Scholar, 36.Jensen E.C. Quantitative analysis of histological staining and fluorescence using ImageJ.Anat. Rec. 2013; 296: 378-381Crossref Scopus (373) Google Scholar). For example, CVB3 infection cleaves a negative regulator of Ras, which gives rise to ERK phosphorylation that is important for viral replication (37.Huber M. Watson K.A. Selinka H.C. Carthy C.M. Klingel K. McManus B.M. Kandolf R. Cleavage of RasGAP and phosphorylation of mitogen-activated protein kinase in the course of coxsackievirus B3 replication.J. Virol. 1999; 73: 3587-3594Crossref PubMed Google Scholar, 38.Si X. Luo H. Morgan A. Zhang J. Wong J. Yuan J. Esfandiarei M. Gao G. Cheung C. McManus B.M. Stress-activated protein kinases are involved in coxsackievirus B3 viral progeny release.J. Virol. 2005; 79: 13875-13881Crossref PubMed Scopus (0) Google Scholar, 39.Jensen Karin J. Garmaroudi Farshid S. Zhang J. Lin J. Boroomand S. Zhang M. Luo Z. Yang D. Luo H. McManus Bruce M. Janes Kevin A. An ERK-p38 subnetwork coordinates host cell apoptosis and necrosis during Coxsackievirus B3 infection.Cell Host Microbe. 2013; 13: 67-76Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 40.Luo H. Yanagawa B. Zhang J. Luo Z. Zhang M. Esfandiarei M. Carthy C. Wilson J.E. Yang D. McManus B.M. Coxsackievirus B3 replication is reduced by inhibition of the extracellular signal-regulated kinase (ERK) signaling pathway.J. Virol. 2002; 76: 3365-3373Crossref PubMed Scopus (172) Google Scholar). Various protein phosphatases are required for early CVB3 infection (41.Coyne C.B. Bozym R. Morosky S.A. Hanna S.L. Mukherjee A. Tudor M. Kim K.S. Cherry S. Comparative RNAi screening reveals host factors involved in enterovirus infection of polarized endothelial monolayers.Cell Host Microbe. 2011; 9: 70-82Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), and CVB3-encoded proteins can also modify host phosphatase activity directly. For example, viral protein 2C forms a complex with PP1 to inhibit IKKβ phosphorylation and NF-κB signaling (42.Li Q. Zheng Z. Liu Y. Zhang Z. Liu Q. Meng J. Ke X. Hu Q. Wang H. 2C Proteins of enteroviruses suppress IKKbeta phosphorylation by recruiting protein phosphatase 1.J. Virol. 2016; 90: 5141-5151Crossref PubMed Scopus (20) Google Scholar). Furthermore, CVB3 infection induces expression of proinflammatory and antiviral cytokines, such as TNF, IL-1, and interferons, in both cardiomyocytes and infiltrating immune cells (43.Seko Y. Takahashi N. Yagita H. Okumura K. Yazaki Y. Expression of cytokine mRNAs in murine hearts with acute myocarditis caused by coxsackievirus b3.J. Pathol. 1997; 183: 105-108Crossref PubMed Scopus (0) Google Scholar, 44.Huhn M.H. Hultcrantz M. Lind K. Ljunggren H.G. Malmberg K.J. Flodstrom-Tullberg M. IFN-gamma production dominates the early human natural killer cell response to Coxsackievirus infection.Cell Microbiol. 2008; 10: 426-436PubMed Google Scholar) (Fig. 1). Type I and Type II interferons activate STATs resulting in partially overlapping antiviral transcriptional responses that combat RNA viruses such as CVB3 (45.Platanias L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling.Nat. Rev. Immunol. 2005; 5: 375-386Crossref PubMed Scopus (1937) Google Scholar, 46.Weil J. Epstein C.J. Epstein L.B. Sedmak J.J. Sabran J.L. Grossberg S.E. A unique set of polypeptides is induced by gamma-interferon in addition to those induced in common with alpha-interferon and beta-interferon.Nature. 1983; 301: 437-439Crossref PubMed Google Scholar). Understanding the degree to which CVB3 infection intersects with interferons is important for more systematic profiling of protein phosphatase cross-regulation by combinations of cytokines and viral pathogens. For phosphosubstrate preparation and purification, pGEX-4T-1 3×FLAG-ERK2, pGEX-4T-1 3×FLAG-JNK1, pGEX-4T-1 3×FLAG-p38α, pGEX-4T-1 3×HA-MEK-DD, pGEX-4T-1 3×HA-MKK4-EE, pGEX-4T-1 3×HA-MKK7a1-EE, and pGEX-4T-1 3×HA-MKK6-EE were described previously (29.Bose A.K. Janes K.A. A high-throughput assay for phosphoprotein-specific phosphatase activity in cellular extracts.Mol. Cell. Proteomics. 2013; 12: 797-806Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). Human MKK6-EE (Addgene plasmid #13518) (47.Raingeaud J. Whitmarsh A.J. Barrett T. Derijard B. Davis R.J. MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway.Mol. Cell. Biol. 1996; 16: 1247-1255Crossref PubMed Google Scholar) was cloned into the BamHI and SalI sites of pCDFDuet-1 (Novagen, Madison, WI) by PCR with the primers gcgcagatctatgtctcagtcgaaaggcaag (forward) and gcgcgtcgacttagtctccaagaatcagttttac (reverse) followed by digestion with BglII and SalI to yield pCDFDuet-1 MKK6-EE. Murine p38α (Addgene plasmid #20351) (48.Enslen H. Raingeaud J. Davis R.J. Selective activation of p38 mitogen-activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6.J. Biol. Chem. 1998; 273: 1741-1748Abstract Full Text Full Text PDF PubMed Scopus (454) Google Scholar) was cloned into the BglII and XhoI sites of pCDFDuet-1 MKK6-EE by PCR with the primers gcgcggatccatgtcgcaggagaggccc (forward) and gcgcctcgagtcaggactccatttcttcttgg (reverse) followed by digestion with BamHI and XhoI to yield pCDFDuet-1 MKK6-EE p38α. Human MAPKAPK2 (MK2) (hORFeome V5.1 #10384) (49.Yang X. Boehm J.S. Yang X. Salehi-Ashtiani K. Hao T. Shen Y. Lubonja R. Thomas S.R. Alkan O. Bhimdi T. Green T.M. Johannessen C.M. Silver S.J. Nguyen C. Murray R.R. Hieronymus H. Balcha D. Fan C. Lin C. Ghamsari L. Vidal M. Hahn W.C. Hill D.E. Root D.E. A public genome-scale lentiviral expression library of human ORFs.Nat. Methods. 2011; 8: 659-661Crossref PubMed Scopus (308) Google Scholar) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3×FLAG) by PCR with the primers gcgcggatccatgctgtccaactcccaggg (forward) and gcgcctcgagtcagtgggccagagccg (reverse) followed by digestion with BamHI and EcoRI to yield pGEX-4T-1 3×FLAG-MK2. Human CREB (hORFeome V5.1 #3038) (49.Yang X. Boehm J.S. Yang X. Salehi-Ashtiani K. Hao T. Shen Y. Lubonja R. Thomas S.R. Alkan O. Bhimdi T. Green T.M. Johannessen C.M. Silver S.J. Nguyen C. Murray R.R. Hieronymus H. Balcha D. Fan C. Lin C. Ghamsari L. Vidal M. Hahn W.C. Hill D.E. Root D.E. A public genome-scale lentiviral expression library of human ORFs.Nat. Methods. 2011; 8: 659-661Crossref PubMed Scopus (308) Google Scholar) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3×FLAG) by PCR with the primers gcgcggatccatgaccatggaatctggagc (forward) and gcgcgaattcttaatctgatttgtggcagtaaag (reverse) followed by digestion with BamHI and EcoRI to yield pGEX-4T-1 3×FLAG-CREB. Human STAT1 (hORFeome V5.1 #4126) (49.Yang X. Boehm J.S. Yang X. Salehi-Ashtiani K. Hao T. Shen Y. Lubonja R. Thomas S.R. Alkan O. Bhimdi T. Green T.M. Johannessen C.M. Silver S.J. Nguyen C. Murray R.R. Hieronymus H. Balcha D. Fan C. Lin C. Ghamsari L. Vidal M. Hahn W.C. Hill D.E. Root D.E. A public genome-scale lentiviral expression library of human ORFs.Nat. Methods. 2011; 8: 659-661Crossref PubMed Scopus (308) Google Scholar) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3×FLAG) by PCR with the primers gcgcggatccatgtctcagtggtacgaact (forward) and gcgcgaattcttacacttcagacacagaaatca (reverse) followed by digestion with BamHI and EcoRI to yield pGEX-4T-1 3×FLAG-STAT1. For constitutive lentiviral overexpression, human CXADR/CAR (hORFeome V5.1 #356) (49.Yang X. Boehm J.S. Yang X. Salehi-Ashtiani K. Hao T. Shen Y. Lubonja R. Thomas S.R. Alkan O. Bhimdi T. Green T.M. Johannessen C.M. Silver S.J. Nguyen C. Murray R.R. Hieronymus H. Balcha D. Fan C. Lin C. Ghamsari L. Vidal M. Hahn W.C. Hill D.E. Root D.E. A public genome-scale lentiviral expression library of human ORFs.Nat. Methods. 2011; 8: 659-661Crossref PubMed Scopus (308) Google Scholar) was recombined with pLX304 (Addgene plasmid #25890) (49.Yang X. Boehm J.S. Yang X. Salehi-Ashtiani K. Hao T. Shen Y. Lubonja R. Thomas S.R. Alkan O. Bhimdi T. Green T.M. Johannessen C.M. Silver S.J. Nguyen C. Murray R.R. Hieronymus H. Balcha D. Fan C. Lin C. Ghamsari L. Vidal M. Hahn W.C. Hill D.E. Root D.E. A public genome-scale lentiviral expression library of human ORFs.Nat. Methods. 2011; 8: 659-661Crossref PubMed Scopus (308) Google Scholar) using Gateway LR clonase (Invitrogen, Carlsbad, CA) to yield pLX304 CAR-V5. Human DUSP10/MKP5 (hORFeome V5.1 #8448), DUSP16/MKP7 (hORFeome V5.1 #11351), DUSP19 (hORFeome V5.1 #2039), DUSP22/JSP1 (hORFeome V5.1 #8622), PTPRR/PTP-SL (hORFeome V5.1 #56450), and PPP1R8/NIPP1 (hORFeome V5.1 #6578) were recombined with pLX302 (Addgene plasmid #25896) using Gateway LR clonase (Invitrogen) to yield pLX302 MKP5-V5, pLX302 MKP7-V5, pLX302 DUSP19-V5, pLX302 JSP1-V5, pLX302 PTP-SL-V5, and pLX302 NIPP1-V5. For inducible lentiviral expression, human MKK4-EE was cloned into the SpeI and MfeI sites of pEN_TTmiRc2 3×FLAG (50.Shin K.J. Wall E.A. Zavzavadjian J.R. Santat L.A. Liu J. Hwang J.I. Rebres R. Roach T. Seaman W. Simon M.I. Fraser I.D. A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression.Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13759-13764Crossref PubMed Scopus (246) Google Scholar) by PCR with the primers gcgcactagtggatccatgcagggtaaacg (forward) and gcgccaattgctacactttacgttttttcttcggaccagaaccaccatcgacatacatgg (reverse, adding a short linker and the monopartite NLS of SV40 large T antigen) followed by digestion with SpeI and MfeI to yield pEN_TTmiRc2 3×FLAG-MKK4-EE-NLS. Human MKK7a1-EE was cloned into the SpeI and MfeI sites of pEN_TTmiRc2 3×FLAG by PCR with the primers gcgctctagaggatccatgctggggctc (forward) and gcgccaattgctacactttacgttttttcttcggaccagaaccacccctgaagaagggca (reverse, adding a short linker and the monopartite NLS of SV40 large T antigen) followed by digestion with XbaI and MfeI to yield pEN_TTmiRc2 3×FLAG-MKK7-EE-NLS. EGFP was cloned into the SpeI and MfeI sites of pEN_TTmiRc2 3×FLAG by PCR with the primers gcgcactagtgtgagcaagggcgaggagct (forward) and gcgccaattgctacactttacgttttttcttcggaccagaaccaccgtcggcgcgcccac (reverse, adding a short linker and the monopartite NLS of SV40 large T antigen) followed by digestion with SpeI and MfeI to yield pEN_TTmiRc2 3×FLAG-EGFP-NLS. The pEN_TTmiRc2 donor vectors
Referência(s)