Produção Nacional
Revisado por pares
First Report of Macrophomina phaseolina Causing Charcoal Rot in Lima Bean ( Phaseolus lunatus ) in Brazil
2017; American Phytopathological Society; Volume: 101; Issue: 8 Linguagem: Inglês
10.1094/pdis-11-16-1661-pdn
ISSN1943-7692
AutoresEnayra Silva Sousa, Maruzanete Pereira de Melo, Larissa Leandro Pires, Bruno Arcanjo Silva, Matheus Esnel Garcia, Ediones M. Sousa, J. M. Mota, José Evando Aguiar Beserra,
Tópico(s)Plant Pathogenic Bacteria Studies
ResumoHomePlant DiseaseVol. 101, No. 8First Report of Macrophomina phaseolina Causing Charcoal Rot in Lima Bean (Phaseolus lunatus) in Brazil PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Macrophomina phaseolina Causing Charcoal Rot in Lima Bean (Phaseolus lunatus) in BrazilE. S. Sousa, M. P. Melo, L. L. Pires, B. A. Silva, M. E. M. García, E. M. J. Sousa, J. M. Mota, and J. E. A. Beserra Jr.E. S. Sousa, M. P. Melo, L. L. Pires, B. A. Silva, M. E. M. García, E. M. J. Sousa, J. M. Mota, and J. E. A. Beserra Jr.AffiliationsAuthors and Affiliations E. S. Sousa M. P. Melo L. L. Pires B. A. Silva M. E. M. García E. M. J. Sousa J. M. Mota J. E. A. Beserra Jr. , Department of Plant Science, Federal University of Piauí, 64049-550, Teresina, Piauí, Brazil. Published Online:25 May 2017https://doi.org/10.1094/PDIS-11-16-1661-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Lima bean is an important legume grown by family farmers, especially in northeast Brazil (Lopes et al. 2015). In February 2015, in the municipalities of Esperantina, Piauí State, and Assaré, Ceará State, Brazil, charcoal rot-like symptoms were observed in lima bean plant and seedlings, which showed brown discoloration at the soil line extending up the stem which turned dark brown to black. Adult plant pods were seen covered with mycelia. The disease incidence was 7.5% (avg. of two fields). Fragments of stems were surface-disinfested with 2% sodium hypochlorite. Samples were plated in potato dextrose agar (PDA) growth medium and incubated at 25 ± 1°C, with a 12-h photoperiod. Direct isolation was made from mycelium in pods. Fungal colonies were initially white, which became gray with a black reverse, with abundant aerial mycelia and production of microsclerodia. The cultures were deposited in the Culture Collection of Phytopathogenic Fungi of the Federal Rural University of Pernambuco, Recife, Brazil (CMM3540 and CMM3543). Pycnidia were not observed to form in the culture medium, but pycnidia were abundant on the symptomatic leaves and stems. The pycnidia had a globular shape and ranged in size from 121.0 to 205.3 (avg. 163.1 µm), while the microconidia formed were hyaline and ovoid, measuring 26.0 to 31.7 (avg. 28.8 µm) × 10.0 to 12.4 (avg. 11.2 µm). After 4 days of incubation in PDA, black microsclerotia (50.0 to 96.4 µm) were observed. Total DNA of isolates was extracted using a Wizard Genomic DNA Purification kit (Promega). The elongation factor (EF-1α) gene was amplified with EF1-728F (CATCGAGAAGTTCGAGAAGG) (Carbone and Kohn 1999) and Ef-2 (GGAAGTACCAGTGATCATGTT) (O'Donnell et al. 1998) primers and sequenced (KX898440 and KX890093). The sequences showed 100% identity (CMM3540) and 99% (CMM3543) similarity with Macrophomina phaseolina (KF952001 and KF553897). Based on morphological and phylogenetic analysis, the isolates were identified as M. phaseolina. The pathogenicity of the two sequenced isolates was confirmed in lima bean plants under greenhouse conditions. Lima bean seeds were surface-disinfested in 2% sodium hypochlorite. The seeds were planted in 2.8-liter plastic pots containing autoclaved soil. Deposition of rice grains infested with the fungus was carried out in the sowing furrows. Design was completely randomized, with seven pots with three plants. The experiment was conducted twice, with seven repetitions. Plants were assessed for 30 days. Both isolates were pathogenic to lima bean. Symptoms included seed rot, the presence of dark lesions on the hypocotyl and epicotyl, and drying and death of seedlings. A red-to-dark brown spot was observed in the region of the cotyledonary nodes. Abundant microsclerotia were noted on the stems, as well as seedlings with reduced root systems. No symptoms were observed in the control plants. The fungi were successfully reisolated from infected stems but not from the control plants. The fungi were identified by morphological markers and by sequencing of the EF-1α gene. M. phaseolina has been detected in the world's most important cultivated legumes (Gupta et al. 2012). However, there are only two reports of its natural occurrence in lima bean, in India and the United States (Farr and Rossman 2016). To our knowledge, this is the first record of M. phaseolina causing charcoal rot in lima bean in Brazil. This result paves the way for the development of management strategies for the disease.References:Carbone, I., and Kohn, L. M. 1999. Mycologia 91:553. https://doi.org/10.2307/3761358 Crossref, ISI, Google ScholarFarr, D. F., and Rossman, A. Y. 2016. Syst. Mycol. Microbiol. Lab., ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/. Accessed 6 May 2016. Google ScholarGupta, G. K., et al. 2012. J. Phytopathol. 160:167. https://doi.org/10.1111/j.1439-0434.2012.01884.x Crossref, ISI, Google ScholarLopes, A. C. A., et al. 2015. Phaseolus lunatus. Diversity, Growth and Production. Nova Science Inc., New York. Google ScholarO'Donnell, K., et al. 1998. Proc Natl Acad Sci 95:2044. https://doi.org/10.1073/pnas.95.5.2044 Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 101, No. 8 August 2017SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 12 Jul 2017Published: 25 May 2017First Look: 5 May 2017Accepted: 3 May 2017 Pages: 1551-1551 Information© 2017 The American Phytopathological SocietyCited byAssociação entre resistência de Phaseolus lunatus a Colletotrichum truncatum e caracteres morfoagronômicos1 June 2022 | Summa Phytopathologica, Vol. 48, No. 2Macrophomina phaseolina (charcoal rot of bean/tobacco)CABI Compendium, Vol. CABI CompendiumHistone H3 gene is not a suitable marker to distinguish Alternaria tenuissima from A. alternata affecting potato23 April 2020 | PLOS ONE, Vol. 15, No. 4A novel Arabidopsis pathosystem reveals cooperation of multiple hormonal response-pathways in host resistance against the global crop destroyer Macrophomina phaseolina27 December 2019 | Scientific Reports, Vol. 9, No. 1Identification and Characterization of Macrophomina phaseolina Causing Leaf Blight on White Spider Lilies ( Crinum asiaticum and Hymenocallis littoralis ) in Malaysia4 November 2019 | Mycobiology, Vol. 47, No. 4Reaction of lima bean genotypes to Macrophomina phaseolina1 March 2019 | Summa Phytopathologica, Vol. 45, No. 1Single Nucleotide Polymorphism‐Based Haplotypes Associated with Charcoal Rot Resistance in Brazilian Soybean Germplasm1 January 2019 | Agronomy Journal, Vol. 111, No. 1Isolation and identification of pathogenic fungi and oomycetes associated with beans and cowpea root diseases in Oman13 December 2018 | PeerJ, Vol. 6
Referência(s)