Portal de Periódicos da CAPES

Mas-Related G-Protein Coupled Receptors and Cowhage-Induced Itch

2017; Elsevier BV; Volume: 138; Issue: 2 Linguagem: Inglês

10.1016/j.jid.2017.05.042

1523-1747

Vemuri B. Reddy, Ehsan Azimi, Lei Chu, Ethan A. Lerner,

Allergic Rhinitis and Sensitization

Cowhage is routinely used in human studies of histamine-independent itch. As such, it is of interest to understand its mechanism of action. The active component of cowhage is a cysteine protease called mucunain. As serine proteases can activate members of the protease-activated receptor (PAR) family to induce itch and pain, the mechanism of action of mucunain and cathepsin S, a human cysteine protease, was likewise thought to be through the activation of PARs. The demonstration that cathepsin S activates members of the Mas-related G-protein coupled receptor (Mrgpr) family to induce itch led us to evaluate the activity of mucunain on these receptors. We find that mucunain activates the human receptors MRPGRX1 and MRGPRX2 and induces degranulation of human mast cells. These findings indicate that Mrgprs may be involved in itch induced by cowhage. Cowhage is the term applied to the itch-inducing spicules or trichomes that cover the seedpods of the tropical plant Mucuna pruriens. Botany purists often prefer the term Stizolobium pruriens. There are numerous terms, based on the local customs and language, equivalent to cowhage. Itching powder is one of the colloquial terms in the English language that refers to the spicules. Cowhage can also refer to the active component in the spicules, a protease, also known as mucunain. Cowhage and histamine are the two most widely used substances employed to measure itch in human psychophysical studies. Cowhage activates mechanically sensitive sensory nerve fibers, whereas histamine activates mechanically insensitive (Schmelz et al., 2000Schmelz M. Michael K. Weidner C. Schmidt R. Torebjork H.E. Handwerker H.O. Which nerve fibers mediate the axon reflex flare in human skin?.Neuroreport. 2000; 11: 645-648Crossref PubMed Scopus (257) Google Scholar). The intensity of cowhage-induced itch is significantly higher than histamine-induced itch (Papoiu et al., 2011Papoiu A.D. Tey H.L. Coghill R.C. Wang H. Yosipovitch G. Cowhage-induced itch as an experimental model for pruritus. A comparative study with histamine-induced itch.PLoS One. 2011; 6e17786Crossref PubMed Scopus (72) Google Scholar). Cowhage-induced itch is mediated by pathways that are independent of histamine (Davidson et al., 2007Davidson S. Zhang X. Yoon C.H. Khasabov S.G. Simone D.A. Giesler Jr., G.J. The itch-producing agents histamine and cowhage activate separate populations of primate spinothalamic tract neurons.J Neurosci. 2007; 27: 10007-10014Crossref PubMed Scopus (208) Google Scholar, Kosteletzky et al., 2009Kosteletzky F. Namer B. Forster C. Handwerker H.O. Impact of scratching on itch and sympathetic reflexes induced by cowhage (Mucuna pruriens) and histamine.Acta Derm Venereol. 2009; 89: 271-277Crossref PubMed Scopus (43) Google Scholar). The majority of itches encountered in the clinic have a limited response to antihistamines, highlighting the importance of histamine-independent pathways. The molecular mechanism of cowhage-induced itch is thus of interest and importance with respect to understanding itch and the development of therapeutics. In the mid-1950s, proteins, not genes, were the rage in biomedical research. Proteases, which are proteins with the capacity to cut molecules, were part of this phenomenon. Consistent with the times, it was suggested in 1955 that a protease may be the active pruritogen in cowhage, and it was given the name mucunain (Shelley and Arthur, 1955Shelley W.B. Arthur R.P. Mucunain, the active pruritogenic proteinase of cowhage.Science. 1955; 122: 469-470Crossref PubMed Scopus (66) Google Scholar). This prescient observation was confirmed in 2008 with the isolation and identification of a cysteine protease from cowhage (Reddy et al., 2008Reddy V.B. Iuga A.O. Shimada S.G. LaMotte R.H. Lerner E.A. Cowhage-evoked itch is mediated by a novel cysteine protease: a ligand of protease-activated receptors.J Neurosci. 2008; 28: 4331-4335Crossref PubMed Scopus (193) Google Scholar). Heat-inactivated spicules reconstituted with the plant protease induced itch in humans akin to native cowhage spicules. In addition, an irreversible inhibitor of cysteine proteases, E64, blocked the sensations induced both by native cowhage and the spicules reconstituted with mucunain (Reddy et al., 2008Reddy V.B. Iuga A.O. Shimada S.G. LaMotte R.H. Lerner E.A. Cowhage-evoked itch is mediated by a novel cysteine protease: a ligand of protease-activated receptors.J Neurosci. 2008; 28: 4331-4335Crossref PubMed Scopus (193) Google Scholar). Mucunain was shown to activate the PAR2 and 4, implicated previously in itch and pain (Reddy et al., 2008Reddy V.B. Iuga A.O. Shimada S.G. LaMotte R.H. Lerner E.A. Cowhage-evoked itch is mediated by a novel cysteine protease: a ligand of protease-activated receptors.J Neurosci. 2008; 28: 4331-4335Crossref PubMed Scopus (193) Google Scholar). Further studies revealed that additional plant proteases known to induce itch are also cysteine proteases and activate PAR2 and 4 (Reddy and Lerner, 2010Reddy V.B. Lerner E.A. Plant cysteine proteases that evoke itch activate protease-activated receptors.Br J Dermatol. 2010; 163: 532-535Crossref PubMed Scopus (41) Google Scholar). An endogenous cysteine protease, cathepsin S, that shares active site sequence homology with mucunain (Reddy et al., 2010Reddy V.B. Shimada S.G. Sikand P. LaMotte R.H. Lerner E.A. Cathepsin S elicits itch and signals via protease-activated receptors.J Invest Dermatol. 2010; 130: 1468-1470Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar) was also found to activate PARs and induce itch, pricking, and burning sensations similar to cowhage (Reddy et al., 2010Reddy V.B. Shimada S.G. Sikand P. LaMotte R.H. Lerner E.A. Cathepsin S elicits itch and signals via protease-activated receptors.J Invest Dermatol. 2010; 130: 1468-1470Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Transgenic mice in which cathepsin S was overexpressed spontaneously developed an intensely pruritic disorder resembling atopic dermatitis (Kim et al., 2012Kim N. Bae K.B. Kim M.O. Yu D.H. Kim H.J. Yuh H.S. et al.Overexpression of cathepsin S induces chronic atopic dermatitis in mice.J Invest Dermatol. 2012; 132: 1169-1176Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Cathepsin S levels were also found to be elevated in psoriatic keratinocytes, consistent with its disease association with itch (Schonefuss et al., 2010Schonefuss A. Wendt W. Schattling B. Schulten R. Hoffmann K. Stuecker M. et al.Upregulation of cathepsin S in psoriatic keratinocytes.Exp Dermatol. 2010; 19: e80-e88Crossref PubMed Scopus (47) Google Scholar). There was, however, an inconsistency. The data on the role of PAR4 in itch are limited and contradictory (Asfaha et al., 2007Asfaha S. Cenac N. Houle S. Altier C. Papez M.D. Nguyen C. et al.Protease-activated receptor-4: a novel mechanism of inflammatory pain modulation.Br J Pharmacol. 2007; 150: 176-185Crossref PubMed Scopus (102) Google Scholar, Tsujii et al., 2008Tsujii K. Andoh T. Lee J.B. Kuraishi Y. Activation of proteinase-activated receptors induces itch-associated response through histamine-dependent and -independent pathways in mice.J Pharmacol Sci. 2008; 108: 385-388Crossref PubMed Scopus (44) Google Scholar). On one hand, the expression of PAR2 on keratinocytes and dorsal root ganglion neurons, and the previously proposed roles for this receptor in itch and pain (Steinhoff et al., 2003Steinhoff M. Neisius U. Ikoma A. Fartasch M. Heyer G. Skov P.S. et al.Proteinase-activated receptor-2 mediates itch: a novel pathway for pruritus in human skin.J Neurosci. 2003; 23: 6176-6180Crossref PubMed Google Scholar), supported a role for PAR2 in cathepsin S and cowhage-induced itch. On the other hand, cathepsin S-induced itch remains intact in PAR2 knockout mice (Reddy et al., 2015Reddy V.B. Sun S. Azimi E. Elmariah S.B. Dong X. Lerner E.A. Redefining the concept of protease-activated receptors: cathepsin S evokes itch via activation of Mrgprs.Nat Commun. 2015; 6: 7864Crossref PubMed Scopus (72) Google Scholar). The key to solving the problem of cowhage and cathepsin S-induced itch, and potentially conditions associated with histamine-independent itch, is a family of receptors known as Mas-related G-protein-coupled receptors or Mrgprs. Mrgprs were identified in 2001 and their role in histamine-independent itch is now clear (Dong et al., 2001Dong X. Han S. Zylka M.J. Simon M.I. Anderson D.J. A diverse family of GPCRs expressed in specific subsets of nociceptive sensory neurons.Cell. 2001; 106: 619-632Abstract Full Text Full Text PDF PubMed Scopus (507) Google Scholar). Further studies revealed that cathepsin S activates human MRGPRX2 and, as opposed to PAR2 knockout mice, cathepsin S-induced itch is significantly decreased in Mrgpr cluster knockout mice (Reddy et al., 2015Reddy V.B. Sun S. Azimi E. Elmariah S.B. Dong X. Lerner E.A. Redefining the concept of protease-activated receptors: cathepsin S evokes itch via activation of Mrgprs.Nat Commun. 2015; 6: 7864Crossref PubMed Scopus (72) Google Scholar). Here we report that mucunain activates human MRGPRX1 and MRGPRX2 (Figure 1). The mechanism of cowhage-induced itch may now be explained as follows: MRGPRX1 is expressed on human dorsal root ganglion neurons. Chloroquine and BAM8-22, in addition to cowhage, activate this receptor to induce histamine-independent itch (Liu et al., 2009Liu Q. Tang Z. Surdenikova L. Kim S. Patel K.N. Kim A. et al.Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus.Cell. 2009; 139: 1353-1365Abstract Full Text Full Text PDF PubMed Scopus (559) Google Scholar, Sikand et al., 2011Sikand P. Dong X. LaMotte R.H. BAM8-22 peptide produces itch and nociceptive sensations in humans independent of histamine release.J Neurosci. 2011; 31: 7563-7567Crossref PubMed Scopus (140) Google Scholar). MRGPRX2 is expressed on human mast cells (McNeil et al., 2014McNeil B.D. Pundir P. Meeker S. Han L. Undem B.J. Kulka M. et al.Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions.Nature. 2015; 519: 237-241Crossref PubMed Scopus (735) Google Scholar) and mediates IgE-independent mast cell degranulation induced by a number of medications and basic secretagogues (Azimi et al., 2016Azimi E. Reddy V.B. Shade K.C. Anthony R.M. Talbot S. Pereira P.J. et al.Dual action of neurokinin-1 antagonists on Mas-related GPCRs.JCI Insight. 2016; 1e89362Crossref PubMed Scopus (96) Google Scholar, McNeil et al., 2014McNeil B.D. Pundir P. Meeker S. Han L. Undem B.J. Kulka M. et al.Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions.Nature. 2015; 519: 237-241Crossref PubMed Scopus (735) Google Scholar). Mucunain induces mast cell degranulation (Figure 2), likely via activation of MRGPRX2, and may release histamine (McNeil et al., 2014McNeil B.D. Pundir P. Meeker S. Han L. Undem B.J. Kulka M. et al.Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions.Nature. 2015; 519: 237-241Crossref PubMed Scopus (735) Google Scholar). MRGPRX2, in addition to MRGPRX1, is transcribed (Figure 3) in and found on human dorsal root ganglion neurons (Robas et al., 2003Robas N. Mead E. Fidock M. MrgX2 is a high potency cortistatin receptor expressed in dorsal root ganglion.J Biol Chem. 2003; 278: 44400-44404Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, Tatemoto et al., 2006Tatemoto K. Nozaki Y. Tsuda R. Konno S. Tomura K. Furuno M. et al.Immunoglobulin E-independent activation of mast cell is mediated by Mrg receptors.Biochem Biophys Res Commun. 2006; 349: 1322-1328Crossref PubMed Scopus (237) Google Scholar, Zhang et al., 2005Zhang L. Taylor N. Xie Y. Ford R. Johnson J. Paulsen J.E. et al.Cloning and expression of MRG receptors in macaque, mouse, and human.Brain Res Mol Brain Res. 2005; 133: 187-197Crossref PubMed Scopus (63) Google Scholar) allowing for cowhage to induce itch by multiple mechanisms. We acknowledge as a possible limitation that MRGPRX2 expression on neurons could result from mast cell contamination. We are also aware of the report in which transcriptional profiling from human dorsal root ganglion neurons did not identify MRGPRX2 (Flegel et al., 2015Flegel C. Schobel N. Altmuller J. Becker C. Tannapfel A. Hatt H. et al.RNA-Seq analysis of human trigeminal and dorsal root ganglia with a focus on chemoreceptors.PLoS One. 2015; 10e0128951Crossref Scopus (123) Google Scholar), but these data were generated without amplification and do not take into account the possibility that pruritogenic or inflammatory stimuli could contribute to expression.Figure 3Mas-related G-protein coupled receptor (MRGPRX2) appears to be transcribed in human dorsal root ganglia (DRG). PCR was performed using forward and reverse primers (F+R) from the coding region (lane 2) as well as two sets of intron spanning primers (X2INTF1+X2INTR1 and X2INTF2+X2INTR2) (lanes 3 and 4) from cDNA prepared from DRG RNA (Clontech, Mountain View, CA). The solid band at 408 bp in lane 2 is consistent with MRGPRX2 being transcribed in DRGs although the possibility of contaminating mast cell RNA is acknowledged. The faint band at 383 bp in lane 3 suggests that a small amount of genomic DNA may be present in the RNA although no band was present in lane 4. Lanes 5, 6, and 7 are from genomic DNA (Promega Madison, WI) amplified with the same primers as bands 2, 3, and 4. The entire gel is presented. The primers are as follows:F: TCAGCGGTCGTGTGTGTCCTGCTCTGGGR: GAAGAAGTAAATGATGGGGTTGGCACX2INTF1:AATTCTGCACCCCCATGGAGX2INTR1: GCCTGCATTTGAACCCACAGX2INTF2: ATTAGCCAGTCGTGGTGGTGX2INTR2: CTCCATGGGGGTGCAGAATTView Large Image Figure ViewerDownload Hi-res image Download (PPT) We propose that although cowhage primarily activates the histamine-independent pathway, it can also induce the release of histamine from mast cells. This component of cowhage-induced itch was not previously appreciated. A question then arises: If mucunain induces mast cell degranulation, why is cowhage only sometimes associated with the typical wheal and flare response of histamine injection (Sikand et al., 2009Sikand P. Shimada S.G. Green B.G. LaMotte R.H. Similar itch and nociceptive sensations evoked by punctate cutaneous application of capsaicin, histamine and cowhage.Pain. 2009; 144: 66-75Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar)? The likely answer is that the intraepidermal nature of skin penetration by cowhage spicules combined with the limited amount of mucunain that spicules can carry and deliver is consistent with mast cells not being activated on a regular basis. In contrast, intradermal administration of histamine would allow its diffusion to reach mast cells leading to their activation. Indeed, studies with histamine at concentrations equipotent to native cowhage spicules produce sensory qualities of similar magnitude and duration, and a cowhage spicule reconstituted by histamine is capable of inducing itch and nociceptive sensations in the absence of a visible flare (Sikand et al., 2009Sikand P. Shimada S.G. Green B.G. LaMotte R.H. Similar itch and nociceptive sensations evoked by punctate cutaneous application of capsaicin, histamine and cowhage.Pain. 2009; 144: 66-75Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). This explanation is consistent with a study performed with plant proteases on 75 healthy subjects from the 1950s in which a variable degree of erythema and wheal formation was noted at the site of intradermal injection (Arthur and Shelley, 1955Arthur R.P. Shelley W.B. The role of proteolytic enzymes in the production of pruritus in man.J Invest Dermatol. 1955; 25: 341-346Abstract Full Text PDF PubMed Scopus (46) Google Scholar). However, when a single spicule was inserted in the epidermis, itch was produced in the absence of visible skin change (Arthur and Shelley, 1955Arthur R.P. Shelley W.B. The role of proteolytic enzymes in the production of pruritus in man.J Invest Dermatol. 1955; 25: 341-346Abstract Full Text PDF PubMed Scopus (46) Google Scholar). In summary, we propose that MRGPRX1 and MRGPRX2 contribute to cowhage-induced itch. These receptors represent potential therapeutic targets for histamine-independent itch. The authors state no conflict of interest. EA is the recipient of a grant from the National Eczema Association. Research reported in this publication was supported by the National Institute of Arthritis and Musculoskeletal and Skin Diseases, R01AR057744 and R21AR067399 to EAL. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.