Portal de Periódicos da CAPES

Association of rhinovirus species with common cold and asthma symptoms and bacterial pathogens

2017; Elsevier BV; Volume: 141; Issue: 2 Linguagem: Inglês

10.1016/j.jaci.2017.09.027

1097-6825

Hiba Bashir, Kristine Grindle, Rose F. Vrtis, Fue Vang, Teresa Kang, L.E.P. Salazar, Élizabeth Anderson, Tressa Pappas, Ronald E. Gangnon, Michael D. Evans, Daniel J. Jackson, Robert F. Lemanske, Yury A. Bochkov, James E. Gern,

Respiratory and Cough-Related Research

Most exacerbations of asthma in children are initiated by viral infections, most commonly due to rhinoviruses (RVs). RV-A and RV-C species are more likely to cause moderate to severe illnesses and wheezing in infants, and exacerbations of asthma leading to hospitalization.1Lee W.M. Lemanske Jr., R.F. Evans M.D. Vang F. Pappas T. Gangnon R. et al.Human rhinovirus species and season of infection determine illness severity.Am J Respir Crit Care Med. 2012; 186: 886-891Crossref PubMed Scopus (230) Google Scholar, 2Bizzintino J. Lee W.M. Laing I.A. Vang F. Pappas T. Zhang G. et al.Association between human rhinovirus C and severity of acute asthma in children.Eur Respir J. 2011; 37: 1037-1042Crossref PubMed Scopus (289) Google Scholar Bacterial pathogens such as Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis have also been linked to acute wheezing illnesses and exacerbations of asthma in young children.3Bisgaard H. Hermansen M.N. Bonnelykke K. Stokholm J. Baty F. Skytt N.L. et al.Association of bacteria and viruses with wheezy episodes in young children: prospective birth cohort study.BMJ. 2010; 341: c4978Crossref PubMed Scopus (239) Google Scholar, 4Teo S.M. Mok D. Pham K. Kusel M. Serralha M. Troy N. et al.The infant nasopharyngeal microbiome impacts severity of lower respiratory infection and risk of asthma development.Cell Host Microbe. 2015; 17: 704-715Abstract Full Text Full Text PDF PubMed Scopus (557) Google Scholar In a prospective study of school-aged children during peak RV season in September ("RhinoGen"), we previously reported that viral infections often precede increased detection of these bacteria.5Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar Furthermore, viral infections with concurrent or subsequent detection of bacterial pathogens were more likely to be associated with symptomatic illnesses and exacerbations of asthma.5Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar These studies suggest that RV-A and RV-C infections could lead to more severe wheezing illnesses by promoting the proliferation of bacterial pathogens. To test this hypothesis, we obtained weekly nasal mucus samples during both September and April as part of the RhinoGen study, and analyzed them for RV species (RT-PCR and partial sequencing)6Bochkov Y.A. Grindle K. Vang F. Evans M.D. Gern J.E. Improved molecular typing assay for rhinovirus species A, B, and C.J Clin Microbiol. 2014; 52: 2461-2471Crossref PubMed Scopus (65) Google Scholar and the bacterial pathogens S pneumoniae, M catarrhalis, and H influenzae (quantitative PCR; see full details in this article's Methods section in the Online Repository at www.jacionline.org).5Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar Children with the help of their parents were instructed to record daily common cold and asthma symptoms, morning peak expiratory flow, and albuterol use on calendars during their enrollment in the study. This study was approved by the University of Wisconsin Human Subjects Committee, written informed consent was obtained from the parents, and written assent was obtained from children aged 7 years and older. The study population consisted of 167 outpatient children with asthma and 143 children without asthma aged 4 to 12 years (see Table E1 and text in this article's Online Repository at www.jacionline.org). Children scored cold and asthma symptom severity on the basis of a 4-point scoring system (see Table E2 in this article's Online Repository at www.jacionline.org),5Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar and moderate asthma exacerbations were defined in accordance with the American Thoracic Society and the National Heart, Lung, and Blood Institute guidelines (see this article's Online Repository at www.jacionline.org). During the 2-month monitoring period, there were 755 respiratory illnesses reported in the 310 children. In the 3028 nasal mucus samples, RV was the virus most commonly detected and RV-A (n = 566 solo, 674 total) was detected over twice as often as either RV-B (n = 203 solo, 250 total) or RV-C (n = 195 solo, 251 total). RV-B was detected more frequently in September, whereas RV-A and RV-C were detected more often in April (see Table E3 in this article's Online Repository at www.jacionline.org). For each RV species, we also determined the number of infections (1 or more consecutive weeks with detection of the same viral type; see Table E4 in this article's Online Repository at www.jacionline.org). The mean duration of viral infection varied by species (P < .001); RV-B was longest (mean, 2.09 weeks; 95% CI, 1.92-2.25), followed by RV-A (1.77 weeks; 95% CI, 1.68-1.86) and then RV-C (1.37 weeks; 95% CI, 1.23-1.50). Compared with weeks with no virus detected, weeks that were positive for any RV species had significantly greater cold symptom scores (Fig 1, A). Both RV-A and RV-C were associated with increased cold symptoms compared with RV-B (P < .02). Similarly, RV-A and RV-C were associated with greater asthma symptoms (Fig 1, B) and a greater probability of exacerbation (Fig 1, C) compared with RV-B. Relative to no virus detection, RV-B detection was not associated with increased cold or asthma symptoms or exacerbations of asthma. Of the 310 participating children, 276 had at least 1 clinically defined respiratory illness (for criteria, see this article's Online Repository at www.jacionline.org) during the study period, with a total of 755 illnesses. Compared with periods with no virus detected, RV-A, RV-C, and multiple RV were each associated with increased risk for illness (odds ratio [OR] = 2.35, 2.61, and 2.41; P < .0005) whereas RV-B was not (OR = 0.99; P = .95; see Fig E1 in this article's Online Repository at www.jacionline.org). We next tested whether the detection of bacterial pathogens was differentially related to infection with specific RV species. S pneumoniae, H influenzae, and M catarrhalis were detected in 45%, 21%, and 19% of samples, respectively, and were more often detected in younger children (see Fig E2 in this article's Online Repository at www.jacionline.org). RV-C was associated with increased detection and quantity of H influenzae (detection: OR, 2.36; 95% CI, 1.65-3.38; quantity: ordinal OR, 2.48; 95% CI, 1.64-3.75) and M catarrhalis (OR, 1.52; 95% CI, 1.04-2.22; ordinal OR, 1.52; 95% CI, 1.01-2.30), RV-A was associated with increased H influenzae (OR, 2.43; 95% CI, 1.90-3.10; ordinal OR, 2.60; 95% CI, 1.96-3.45) and S pneumoniae (OR, 1.52; 95% CI, 1.23-1.89; ordinal OR, 1.97; 95% CI, 1.59- 2.43), whereas RV-B was not associated with increased bacterial detection (Fig 2). We previously reported that during sampling of nasal mucus obtained in September, detection of both RVs and bacteria contributed to the probability of respiratory illness.5Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar In an analysis including samples from April and September (see Table E5 in this article's Online Repository at www.jacionline.org), detection of RV together with either M catarrhalis (OR, 1.79; 95% CI, 1.16-2.78) or H Influenzae (OR, 1.44; 95% CI, 1.01-2.05), but not S pneumoniae (OR, 1.22; 95% CI, 0.78-1.62), significantly increased the probability of respiratory illness compared with infection with RV alone. When detected in the absence of virus, none of the bacterial pathogens were significantly associated with respiratory illness. The results of this study verify that infections with RV-A and RV-C species cause more severe illnesses and are more likely associated with exacerbations of asthma than are infections with RV-B. We also demonstrated that RV-A and RV-C are more likely than RV-B to be associated with detection of bacterial respiratory pathogens. Strengths of this study include the large sample size, inclusion of children with and without asthma, and prospective collection of samples during periods of illness and health. Limitations include sample collection for only 2 months out of the year; however, these months were selected for the highest prevalence of RV infections and asthma morbidity. In addition, there may be effects of other seasonal factors such as allergens that were not measured in this study. These findings suggest that RV virulence could be partly related to secondary effects on the overgrowth of bacterial pathogens. This relationship is plausible, because these bacteria can stimulate inflammatory responses that might lead to airway narrowing and acute exacerbations.7Parker D. Prince A. Innate immunity in the respiratory epithelium.Am J Respir Cell Mol Biol. 2011; 45: 189-201Crossref PubMed Scopus (308) Google Scholar Accordingly, 2 randomized studies have demonstrated that treatment with azithromycin improves outcomes of wheezing illnesses in high-risk preschool children.8Bacharier L.B. Guilbert T.W. Mauger D.T. Boehmer S. Beigelman A. Fitzpatrick A.M. et al.Early administration of azithromycin and prevention of severe lower respiratory tract illnesses in preschool children with a history of such illnesses: a randomized clinical trial.JAMA. 2015; 314: 2034-2044Crossref PubMed Scopus (198) Google Scholar, 9Stokholm J. Chawes B.L. Vissing N.H. Bjarnadottir E. Pedersen T.M. Vinding R.K. et al.Azithromycin for episodes with asthma-like symptoms in young children aged 1-3 years: a randomised, double-blind, placebo-controlled trial.Lancet Respir Med. 2016; 4: 19-26Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar Mechanisms for these effects are unclear, however, and use of antibiotics for respiratory illnesses could have unintended adverse effects including selecting for drug-resistant organisms, and killing beneficial microbes. Additional studies are needed to test whether other types of treatments (eg, vaccines and probiotics) can prevent the overgrowth of bacterial pathogens during viral respiratory infections and reduce the risk of more severe illnesses and exacerbations of asthma. Children included in this analysis were enrolled to determine asthma-specific rates of RV infections and illness ("RhinoGen"). The study population was recruited from Madison, Wisconsin, and surrounding areas via primary care physicians, allergy and asthma specialists, and advertisements in the community. Any child with or without asthma, aged 4 to 12 years, was considered eligible for the study provided they did not have a history of prematurity, respiratory problems at birth, or any other significant medical illness. Admission to RhinoGen occurred on a rolling basis between 2007 and 2010. Nasal samples were collected weekly for a total of 5 weeks during the fall (beginning in September) and 5 weeks in the spring (beginning in April). The samples were collected using a nasal blow technique, mixed with viral transport medium, and then kept in a home freezer pending pickup by the study team.E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar Children with the help of their parents were instructed to record daily upper respiratory infection and asthma symptoms, morning peak expiratory flow, and albuterol use on calendars during their enrollment in the study. Of the 478 children and families who expressed interest in the study, 422 subjects passed the initial screening process, provided consent, and were enrolled in the study. Reasons for failing the initial screen included not being comfortable with procedures, family issues such as an illness or parental schedules, being outside the set age parameters, being born prematurely, or a respiratory complication at birth. Children who collected 6 of 8 weekly nasal specimens and were missing less than 20% of diary card data were included in the analyses (n = 310). Nasal samples from the September samples were analyzed for Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis by multiplexed quantitative real-time PCR as previously described.E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar DNA was extracted using the BiOstic Bacteremia DNA Isolation Kit (Mo Bio laboratories, Carlsbad, Calif). Samples that tested positive for bacterial DNA on multiplex PCR were retested with single-target quantitative PCRs specific for each bacteria to exclude false positives (primers and probes listed in Table E6). The April samples were tested only with the 3 single-plex quantitative PCR tests. Current asthma was defined at the end of the 2 monitoring periods on the basis of previously reported criteria.E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar Children scored cold and asthma symptom severity on the basis of a 4-point scoring system (Table E2).E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar Infection was defined as viral detection in the nasal secretions, whether or not symptoms were present. If the same virus type was detected in serial specimens, it was considered a single infection. Illnesses were defined as 2 or more consecutive days of cold or asthma symptoms of at least mild severity, whether or not a virus was detected. If an illness occurred within 3 days of a positive viral sample, the infection was designated a viral illness.E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar Moderate asthma exacerbations were defined in accordance with the American Thoracic Society and National Heart, Lung and Blood Institute guidelinesE2National Asthma Education and Prevention Program National Heart, Lung, and Blood Institute. Expert Panel Report 3: Guidelines for the diagnosis and management of asthma. U.S. Department of Health and Human Services, Bethesda2007Google Scholar, E3Reddel H.K. Taylor D.R. Bateman E.D. Boulet L.P. Boushey H.A. Busse W.W. et al.An official American Thoracic Society/European Respiratory Society statement: asthma control and exacerbations: standardizing endpoints for clinical asthma trials and clinical practice.Am J Respir Crit Care Med. 2009; 180: 59-99Crossref PubMed Scopus (1467) Google Scholar to consist of at least moderate asthma symptoms and either a decrease of at least 20% in peak expiratory flow or use of albuterol 2 or more days per week.E1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar Demographic characteristics were compared by asthma status using the Wilcoxon rank-sum test and the chi-square test for association. Factors influencing viral detection rates were examined using multivariate logistic regression models with covariates for season, age, sex, race, atopy, and asthma. Similar models that also included covariates for virus detection were used to examine factors influencing bacterial detection rates. To compare weekly virology data to concurrent symptoms, cold and asthma symptoms from diaries were analyzed in 7-day increments (date of nasal specimen ± 3 days) and symptom scores were summed over this 7-day period. Generalized linear mixed effect models were used to compare cold symptom burdens and asthma symptom burdens (quasi-Poisson regression) and occurrence of asthma exacerbations (logistic regression) among viruses. Illness and exacerbation rates during solo RV infections were analyzed using logistic regression models with covariates for species and duration of infection. To examine the relationships between clinical illnesses and detection of viruses and bacteria, a matching algorithm was developed to uniquely pair each participant with a second participant who was asymptomatic on the same days that the first subject exhibited respiratory symptoms. Illnesses and matched asymptomatic control periods of the same duration were then analyzed using a matched-pairs conditional logistic regression model. The presence and quantity of bacteria were compared among viruses using mixed effect logistic and ordinal logistic regression models. For all analyses, a 2-sided P value of less than .05 was regarded as statistically significant.Fig E2Effects of age on the prevalence of bacterial pathogen detection.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Subject demographic characteristicsCharacteristicAsthmaP valueNo (n = 143)Yes (n = 167)Sex: male55%67%.03Age (y)8.2 (8.0, 9.2)8.2 (6.8, 9.4).25Ethnicity∗Study subjects were asked to choose 1 or more categories. White95%88%.03 Black2%13%.0006 Asian3%4%.96 Native American3%1%.31 Pacific Islander1%1%.91 Hispanic3%7%.08Maternal asthma28%40%.04Maternal allergic disease54%60%.27Paternal asthma22%33%.05Paternal allergic disease49%66%.004Total IgE39 (18, 148)129 (37, 384)<.0001Any aeroallergen positive sIgE43%64%.0002Feno8.7 (6.5, 13.5)13.2 (8.0, 29.2)<.0001PEF Pre-BD3.45 (2.75, 4.02)3.53 (2.84, 4.22).87FEV1 Pre-BD1.67 (1.48, 1.99)1.75 (1.41, 1.97).28FEV1/FVC Pre-BD0.84 (0.80, 0.88)0.82 (0.77, 0.86).10Continuous measures summarized as median (25th, 75th).BD, Bronchodilation; Feno, fraction of exhaled nitric oxide; PEF, peak expiratory flow.∗ Study subjects were asked to choose 1 or more categories. Open table in a new tab Table E2Definition of common cold and asthma scoresE1Kloepfer K.M. Lee W.M. Pappas T.E. Kang T.J. Vrtis R.F. Evans M.D. et al.Detection of pathogenic bacteria during rhinovirus infection is associated with increased respiratory symptoms and asthma exacerbations.J Allergy Clin Immunol. 2014; 133: 1301-1307.e3Abstract Full Text Full Text PDF PubMed Scopus (200) Google ScholarScoreCold symptomsAsthma symptoms0AbsentNoneNone1MildMild stuffy or runny nose but does not affect daily activityOccasional cough or wheeze but does not affect daily activity2ModerateModerate stuffy or runny nose and reduced activity but does not affect sleepFrequent cough or wheeze with some shortness of breath and reduced activity but not affecting sleep3SevereCannot breathe through the nose and not able to sleep well because of symptomsUnable to sleep well because of symptoms Open table in a new tab Table E3Factors influencing detection of RV speciesPredictorOR (95% CI)RV-ARV-BRV-CApril vs September1.21 (1.03-1.42)0.12 (0.09-0.15)1.56 (1.26-1.92)Age (1 SD change)0.84 (0.74-0.97)0.84 (0.65-1.09)0.72 (0.60-0.87)Male sex0.87 (0.66-1.15)1.10 (0.66-1.86)1.14 (0.78-1.66)Black1.13 (0.77-1.65)0.52 (0.24-1.15)1.28 (0.78-2.12)Atopy1.05 (0.79-1.39)1.11 (0.65-1.89)1.05 (0.71-1.54)Asthma1.05 (0.80-1.39)0.70 (0.42-1.18)1.28 (0.88-1.88)Boldface represents significant associations with RV species. Open table in a new tab Table E4Number of viral infections, n (%)∗Same virus detected in consecutive weeks was considered 1 infection. Of the 723 total RV infections, 649 were nonoverlapping infections with a single RV type.VirusInfectionsSeptemberAprilTotalRV-A199 (41)208 (46)407 (43)RV-B107 (22)19 (4)126 (13)RV-C80 (16)110 (24)190 (20)Other virus100 (21)113 (25)213 (23)Total486450936∗ Same virus detected in consecutive weeks was considered 1 infection. Of the 723 total RV infections, 649 were nonoverlapping infections with a single RV type. Open table in a new tab Table E5Effects of virus, bacteria, or both on risk of respiratory illnessPathogenSeptember onlyApril onlySeptember and April combinedOR∗OR for A vs B refers to (odds of B)/(odds of A). This analysis excludes illnesses associated with non-RVs.95% CIP valueOR95% CIP valueOR95% CIP valueRV & H flu V−B− vs V−B+0.990.54-1.82.981.470.83-2.60.191.210.80-1.83.37 V−B− vs V+B−1.771.22-2.56.0032.461.58-3.83<.00012.041.53-2.70<.0001 V−B− vs V+B+2.761.69-4.53<.00013.181.83-5.52<.00012.932.03-4.23<.0001 V+B− vs V+B+1.560.97-2.53.071.290.77-2.17.331.441.01-2.05.04RV & Morax V−B− vs V−B+0.900.43-1.87.781.270.72-2.23.411.090.71-1.69.69 V−B− vs V+B−1.811.28-2.56.00072.491.58-3.91<.00012.031.54-2.67<.0001 V−B− vs V+B+4.372.23-8.56<.00013.281.72-6.27.00033.642.30-5.76<.0001 V+B− vs V+B+2.411.27-4.58.0071.320.72-2.43.371.791.16-2.78.009RV & Strep V−B− vs V−B+0.690.42-1.11.131.190.69-2.07.530.860.60-1.24.43 V−B− vs V+B−1.480.90-2.46.122.671.54-4.64.00051.931.34-2.78.0004 V−B− vs V+B+1.911.25-2.92.0032.681.56-4.61.00042.161.55-3.01<.0001 V+B− vs V+B+1.290.76-2.17.341.000.59-1.70.991.120.78-1.62.55B, Bacteria; V, virus.∗ OR for A vs B refers to (odds of B)/(odds of A). This analysis excludes illnesses associated with non-RVs. Open table in a new tab Table E6Sources and identities of primers, probe, and standardsMaterialSequence or sourceS pneumoniaeE4Gouveia E.L. Reis J.N. Flannery B. Cordeiro S.M. Lima J.B. Pinheiro R.M. et al.Clinical outcome of pneumococcal meningitis during the emergence of pencillin-resistant Streptococcus pneumoniae: an observational study.BMC Infect Dis. 2011; 11: 323Crossref PubMed Scopus (24) Google Scholar LytA forwardACGCAATCTAGCAGATGAAGCA LytA reverseTCGTGCGTTTTAATTCCAGCT LytA TaqMan probeFAM-TGCCGAAAACGCTTGATACAGGGAG-MGB-NFQ S pneumoniae standardATCC 49619H influenzaeE5Wang X. Mair R. Hatcher C. Theodore M.J. Edmond K. Wu H.M. et al.Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae.Int J Med Microbiol. 2011; 301: 303-309Crossref PubMed Scopus (88) Google Scholar hpdF822 forwardGGTTAAATATGCCGATGGTGTTG hpdR952 reverseTGCATCTTTACGCACGGTGTA hpdPb896 modified for MGBVIC–TTACCAACGGAGTGTACACAA-MGB-NFQ H influenzae standardATCC 49144M catarrhalisE6Greiner O. Day P.J. Altwegg M. Nadal D. Quantitative detection of Moraxella catarrhalis in nasopharyngeal secretions by real-time PCR.J Clin Microbiol. 2003; 41: 1386-1390Crossref PubMed Scopus (57) Google Scholar copB forwardGTGAGTGCCGCTTTTACAACC copB reverseTGTATCGCCTGCCAAGACAA copB TaqMan probeNED-TGCTTTTGCAGCTGTTAGCCAGCCTAA-MGB-NFQ M catarrhalis standardPatient isolate Open table in a new tab Continuous measures summarized as median (25th, 75th). BD, Bronchodilation; Feno, fraction of exhaled nitric oxide; PEF, peak expiratory flow. Boldface represents significant associations with RV species. B, Bacteria; V, virus.