First Report of Hibiscus-infecting cilevirus in Citrus sinensis in Meta and Casanare, Colombia
2018; American Phytopathological Society; Volume: 102; Issue: 8 Linguagem: Inglês
10.1094/pdis-01-18-0150-pdn
ISSN1943-7692
AutoresAvijit Roy, Andrew L. Stone, Guillermo Leon Martínez, John S. Hartung, Gang Wei, Vessela Mavrodieva, Mark K. Nakhla, William L. Schneider, R. H. Brlansky,
Tópico(s)Insect and Pesticide Research
ResumoHomePlant DiseaseVol. 102, No. 8First Report of Hibiscus-infecting cilevirus in Citrus sinensis in Meta and Casanare, Colombia PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Hibiscus-infecting cilevirus in Citrus sinensis in Meta and Casanare, ColombiaAvijit Roy, A. L. Stone, G. León Martínez, J. S. Hartung, G. Wei, V. A. Mavrodieva, M. K. Nakhla, W. L. Schneider, and R. H. BrlanskyAvijit Roy†Corresponding author: A. Roy; E-mail: E-mail Address: Avijit.Roy@aphis.usda.govhttp://orcid.org/0000-0002-2268-9713, A. L. Stone, G. León Martínez, J. S. Hartung, G. Wei, V. A. Mavrodieva, M. K. Nakhla, W. L. Schneider, and R. H. BrlanskyAffiliationsAuthors and Affiliations Avijit Roy † , USDA-APHIS-PPQ-S&T, Beltsville, MD 20705 A. L. Stone , USDA-ARS, FDWSRU, Fort Detrick, MD 21702 G. León Martínez , Centro de Investigación La Libertad, CORPOICA, Villavicencio, Colombia J. S. Hartung , USDA-ARS, MPPL, Beltsville, MD 20705 G. Wei V. A. Mavrodieva M. K. Nakhla , USDA-APHIS-PPQ-S&T, Beltsville, MD 20705 W. L. Schneider , USDA-ARS, FDWSRU, Fort Detrick, MD 21702 R. H. Brlansky , University of Florida, CREC, Lake Alfred, 33850. Published Online:15 Jun 2018https://doi.org/10.1094/PDIS-01-18-0150-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Cilevirus infection in ornamental hibiscus was previously reported from Hawaii (Melzer et al. 2013) and Florida (Roy et al. 2018). According to the guidelines of the International Committee on Taxonomy of Viruses, Hibiscus-infecting cilevirus is described as a hibiscus strain of Citrus leprosis virus C2 (CiLV-C2H) because it shares a 92% amino acid identity with CiLV-C2. Natural infection of hibiscus by CiLV-C2 was reported in Colombia (Roy et al. 2015), but there was no report of CiLV-C2H infection in Citrus spp. In February 2015, two sweet orange (Citrus sinensis L.) samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia. Samples were assayed to validate a newly developed multiplex reverse-transcription polymerase chain reaction (RT-PCR) assay for detection of Cilevirus (CiLV-C, -C2, and -C2H), Dichorhavirus (CiLV-N), and Higrevirus (hibiscus green spot virus 2 [HGSV-2]) associated with CiL disease (Roy et al. 2015). CiL-infected samples from Colombia tested positive with CiLV-C2 and -C2H specific primers in a RT-PCR assay (Roy et al. 2013a, 2018), but not with the primers specific for CiLV-C, CiLV-N, and HGSV-2 (Roy et al. 2015). The incidence and distribution of CiLV-C2H in Colombia were determined with primers specific to the putative coat protein gene (CPG) of CiLV-C2H (accession MG253805) (CiLV-C2H-F, 5′TCAAGCACCTCGTCAACGTGTTAA3′; and CiLV-C2H-R, 5′ATGTTTACTCTCCCTGCTCTTCTGC3′) in a RT-PCR assay. The newly developed primer pair successfully amplified 626 nt of CPG sequence from both samples. In addition, 14 sweet orange samples that were archived in 2012 from the same location of Meta and Casanare were tested. The species-specific RT-PCR assays yielded CiLV-C2 specific 795-nt amplicon from all 14 samples and 626-nt amplicon specific to CiLV-C2H sequences from 12 samples. RT-PCR products were purified, cloned, and sequenced. BLAST analysis of CiLV-C2H amplicon sequence (MG637133) shared 98% nucleotide identity with CiLV-C2H Hawaiian isolate (KC626783) but only 86% with CiLV-C2 (JX000024). CiLV-C2 specific amplicon showed 99% nucleotide identity with CiLV-C2 (MG637132). These results confirmed the presence of CiLV-C2H in mixed infection with CiLV-C2 prior to 2012. This is not only the first report of natural infection of CiLV-C2H in Citrus but also the first report of CiLV-C2H in Colombia. To thoroughly identify the viruses associated with leprosis symptomatic samples, total RNA was extracted from a healthy and a RT-PCR positive mixed-infected sample and sent for next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer (Roy et al. 2013a). Small RNA libraries generated 34,407,866 and 36,485,310 single-end reads from healthy and CiL-infected leaf samples, respectively. A subtractive approach was applied with the Bowtie aligner and Velvet assembler following the protocol described by Roy et al. (2013b). The assembled contigs were analyzed using BLASTn against the CiLV-C2 and -C2H reference genomes in GenBank. The NGS results confirmed the presence of both CiLV-C2 and -C2H sequences in the infected sRNA library, but no virus sequence was identified in the sRNA library generated from healthy leaves. NGS assay derived sequences were confirmed by the conventional species-specific RT-PCR assay followed by Sanger sequencing. Further studies are necessary to determine if CiLV-C2H alone can produce leprosis-like symptoms in Citrus spp. or if present symptoms are owing to the synergistic effects of the viruses in dual infection.References:Melzer, M. J., et al. 2013. Arch. Virol. 158:2421. https://doi.org/10.1007/s00705-013-1745-0 Crossref, ISI, Google ScholarRoy, A., et al. 2013a. Phytopathology 103:488. https://doi.org/10.1094/PHYTO-07-12-0177-R Link, ISI, Google ScholarRoy, A., et al. 2013b. J. Data Mining Genomics Proteomics 4:2. https://doi.org/10.4172/2153-0602.1000129 Google ScholarRoy, A., et al. 2015. Phytopathology 105:1013. https://doi.org/10.1094/PHYTO-12-14-0375-FI Link, ISI, Google ScholarRoy, A., et al. 2018. Plant Dis. 102:1181. https://doi.org/10.1094/PDIS-11-17-1699-PDN Link, ISI, Google ScholarFunding: Funding was provided by the Citrus Research Board (grant no. 5300-172).DetailsFiguresLiterature CitedRelated Vol. 102, No. 8 August 2018SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 18 Jul 2018Published: 15 Jun 2018First Look: 16 Mar 2018Accepted: 14 Mar 2018 Pages: 1675-1675 Information© 2018 The American Phytopathological SocietyFundingCitrus Research BoardGrant/Award Number: 5300-172Cited byHigh-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex24 January 2023 | Frontiers in Plant Science, Vol. 13First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, ColombiaAvijit Roy, Leon M. Guillermo, Schyler Nunziata, Chellappan Padmanabhan, Yazmin Rivera, Ronald H. Brlansky, and John Hartung5 December 2022 | Plant Disease, Vol. 0, No. jaFirst Report of the Hibiscus Strain of Citrus Leprosis Virus C2 Infecting Passionfruit (Passiflora edulis)Alejandro Olmedo-Velarde, Avijit Roy, Adriana Larrea-Sarmiento, Xupeng Wang, Chellappan Padmanabhan, Schyler Nunziata, Mark K. Nakhla, John Hu, and Michael J. Melzer3 August 2022 | Plant Disease, Vol. 106, No. 9
Referência(s)