Determinants of pH profile and acyl chain selectivity in lysosomal phospholipase A2 [S]
2018; Elsevier BV; Volume: 59; Issue: 7 Linguagem: Inglês
10.1194/jlr.m084012
ISSN1539-7262
AutoresVania Hinkovska‐Galcheva, Robert J. Kelly, Kelly A. Manthei, Renee A. Bouley, Wenmin Yuan, Anna Schwendeman, J.J.G. Tesmer, James A. Shayman,
Tópico(s)Lysosomal Storage Disorders Research
ResumoLysosomal phospholipase A2 (LPLA2) is characterized by broad substrate recognition, peak activity at acidic pH, and the transacylation of lipophilic alcohols, especially N-acetyl-sphingosine. Prior structural analysis of LPLA2 revealed the presence of an atypical acidic residue, Asp13, in the otherwise hydrophobic active site cleft. We hypothesized that Asp13 contributed to the pH profile and/or substrate preference of LPLA2 for unsaturated acyl chains. To test this hypothesis, we substituted Asp13 for alanine, cysteine, or phenylalanine; then, we monitored the formation of 1-O-acyl-N-acetylsphingosine to measure the hydrolysis of sn-1 versus sn-2 acyl groups on a variety of glycerophospholipids. Substitutions with Asp13 yielded significant enzyme activity at neutral pH (7.4) and perturbed the selectivity for mono- and double-unsaturated acyl chains. However, this position played no apparent role in selecting for either the acyl acceptor or the head group of the glycerophospholipid. Our modeling indicates that Asp13 and its substitutions contribute to the pH activity profile of LPLA2 and to acyl chain selectivity by forming part of a hydrophobic track occupied by the scissile acyl chain. Lysosomal phospholipase A2 (LPLA2) is characterized by broad substrate recognition, peak activity at acidic pH, and the transacylation of lipophilic alcohols, especially N-acetyl-sphingosine. Prior structural analysis of LPLA2 revealed the presence of an atypical acidic residue, Asp13, in the otherwise hydrophobic active site cleft. We hypothesized that Asp13 contributed to the pH profile and/or substrate preference of LPLA2 for unsaturated acyl chains. To test this hypothesis, we substituted Asp13 for alanine, cysteine, or phenylalanine; then, we monitored the formation of 1-O-acyl-N-acetylsphingosine to measure the hydrolysis of sn-1 versus sn-2 acyl groups on a variety of glycerophospholipids. Substitutions with Asp13 yielded significant enzyme activity at neutral pH (7.4) and perturbed the selectivity for mono- and double-unsaturated acyl chains. However, this position played no apparent role in selecting for either the acyl acceptor or the head group of the glycerophospholipid. Our modeling indicates that Asp13 and its substitutions contribute to the pH activity profile of LPLA2 and to acyl chain selectivity by forming part of a hydrophobic track occupied by the scissile acyl chain. Lysosomal phospholipase A2 (LPLA2, PLA2GXV) is characterized by both calcium-independent phospholipase A2 and ceramide acyltransferase activities (1.Shayman J.A. Abe A. Radin N.S. A new pathway for ceramide metabolism: the catalytic esterification of ceramide to form 1-O-acylceramide by a novel phospholipase A2.J. Am. Soc. Nephrol. 1996; 7: A2196Google Scholar, 2.Abe A. Shayman J.A. Purification and characterization of 1-O-acylceramide synthase, a novel phospholipase A(2) with transacylase activity.J. Biol. Chem. 1998; 273: 8467-8474Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 3.Hiraoka M. Abe A. Shayman J.A. Cloning and characterization of a lysosomal phospholipase A(2), 1-O-acylceramide synthase.J. Biol. Chem. 2002; 277: 10090-10099Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 4.Shayman J.A. Kelly R. Kollmeyer J. He Y. Abe A. Group XV phospholipase A(2), a lysosomal phospholipase A(2).Prog. Lipid Res. 2011; 50: 1-13Crossref PubMed Scopus (57) Google Scholar). It has broad substrate specificity, recognizing several glycerophospholipids, including phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, and phosphatidylserine. In the presence of lipophilic alcohols, such as N-acetyl-sphingosine (NAS), LPLA2 acts as an acyltransferase, generating O-linked acyl alcohols. If no acceptor other than water is present, LPLA2 acts as a phospholipase and only a lysophospholipid and a free fatty acid are formed. LPLA2 is localized to late endosomes and lysosomes and, like other lysosomal hydrolases, has an acidic pH optimum. LPLA2 null mice are characterized by the early development of increased surfactant phospholipid levels and alveolar macrophage foam cells, similar to that observed in drug-induced phospholipidosis (5.Hiraoka M. Abe A. Lu Y. Yang K. Han X. Gross R.W. Shayman J.A. Lysosomal phospholipase A2 and phospholipidosis.Mol. Cell. Biol. 2006; 26: 6139-6148Crossref PubMed Scopus (99) Google Scholar). Other studies have identified a role for LPLA2 in host defense (6.Paduraru C. Bezbradica J.S. Kunte A. Kelly R. Shayman J.A. Veerapen N. Cox L.R. Besra G.S. Cresswell P. Role for lysosomal phospholipase A2 in iNKT cell-mediated CD1d recognition.Proc. Natl. Acad. Sci. USA. 2013; 110: 5097-5102Crossref PubMed Scopus (28) Google Scholar, 7.Schneider B.E. Behrends J. Hagens K. Harmel N. Shayman J.A. Schaible U.E. Lysosomal phospholipase A2: a novel player in host immunity to Mycobacterium tuberculosis.Eur. J. Immunol. 2014; 44: 2394-2404Crossref PubMed Scopus (22) Google Scholar). The acidic pH is important for the binding of the enzyme to liposomes or membranes and is mediated through a distinct membrane binding domain (8.Abe A. Shayman J.A. The role of negatively charged lipids in lysosomal phospholipase A2 function.J. Lipid Res. 2009; 50: 2027-2035Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar). This binding domain may be the basis by which LPLA2 mediates amiodarone-associated phospholipidosis (10.Abe A. Hiraoka M. Shayman J.A. A role for lysosomal phospholipase A2 in drug induced phospholipidosis.Drug Metab. Lett. 2007; 1: 49-53Crossref PubMed Scopus (39) Google Scholar). However, the enzyme is active against water-soluble truncated oxidized phospholipids at neutral pH (11.Abe A. Hiraoka M. Ohguro H. Tesmer J.J. Shayman J.A. Preferential hydrolysis of truncated oxidized glycerophospholipids by lysosomal phospholipase A2.J. Lipid Res. 2017; 58: 339-349Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar), suggesting that some substrates may directly access the catalytic domain, and that there may be a biological role for secreted LPLA2 (12.Abe A. Kelly R. Kollmeyer J. Hiraoka M. Lu Y. Shayman J.A. The secretion and uptake of lysosomal phospholipase A2 by alveolar macrophages.J. Immunol. 2008; 181: 7873-7881Crossref PubMed Scopus (22) Google Scholar). In an earlier study, the specificities of LPLA2 toward sn-1 versus sn-2 fatty acyl groups were evaluated by separating and identifying distinct species of 1-O-acyl-ceramides formed as the product of its lipase and transacylase reactions (13.Abe A. Hiraoka M. Shayman J.A. Positional specificity of lysosomal phospholipase A(2).J. Lipid Res. 2006; 47: 2268-2279Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). We reported that both sn-1 and sn-2 fatty acyl groups of phosphatidylcholine were subject to hydrolysis depending on the fatty acyl species present, with preference for unsaturated acyl chains, which are typically found at the sn-2 position of phospholipids. However, at the time of that study, the structure of LPLA2 had not yet been discovered and thus, the molecular basis for fatty acid selectivity was unknown. Recently, our groups reported the structure of LPLA2 and LCAT, a structurally related phospholipase A2 with transacylase activity (9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar, 14.Manthei K.A. Ahn J. Glukhova A. Yuan W. Larkin C. Manett T.D. Chang L. Shayman J.A. Axley M.J. Schwendeman A. et al.A retractable lid in lecithin:cholesterol acyltransferase provides a structural mechanism for activation by apolipoprotein A-I.J. Biol. Chem. 2017; 292: 20313-20327Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). The crystal structure confirmed that the catalytic core of LPLA2 is an α/β hydrolase domain but with distinct membrane binding and "cap" domains (Fig. 1A). The catalytic triad and adjacent oxyanion hole are found at the base of a largely hydrophobic bowl that is at least partially shielded from solvent by a loop that extends from the cap domain, and is the binding site for glycerophospholipids and lipophilic alcohols (Fig. 1B). Both the lipase and acyltransferase reactions of LPLA2 proceed sequentially with the transient acylation of the catalytic serine by the scissile fatty acyl group. The same lipid binding pocket is anticipated to be used for the departing lysophospholipid product and the ultimate lipophilic alcohol that serves as an acyl group acceptor. Based on these structures, substrate modeling, and the position of disease-causing mutations in LCAT (9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar, 15.Kuivenhoven J.A. Pritchard H. Hill J. Frohlich J. Assmann G. Kastelein J. The molecular pathology of lecithin:cholesterol acyltransferase (LCAT) deficiency syndromes.J. Lipid Res. 1997; 38: 191-205Abstract Full Text PDF PubMed Google Scholar), we proposed that the orientation of the bound phospholipid in the active site underlies the specificity of LPLA2 for fatty acids in the sn-2 vs. the sn-1 position. We further proposed that the observed acyl chain length preference of LPLA2 is determined by two hydrophobic grooves, termed the A and B tracks, leading away from the catalytic triad of the enzyme, with the A track likely to be that occupied by the scissile acyl chain. Asp13 is a conspicuous residue located next to the oxyanion hole and contributes to the A track in a position typically conserved as hydrophobic residue (M/V/L) in type I lipases (16.Ollis D.L. Cheah E. Cygler M. Dijkstra B. Frolow F. Franken S.M. Harel M. Remington S.J. Silman I. Schrag J. et al.The alpha/beta hydrolase fold.Protein Eng. 1992; 5: 197-211Crossref PubMed Scopus (1843) Google Scholar, 17.Jauhiainen M. Stevenson K.J. Dolphin P.J. Human plasma lecithin-cholesterol acyltransferase. The vicinal nature of cysteine 31 and cysteine 184 in the catalytic site.J. Biol. Chem. 1988; 263: 6525-6533Abstract Full Text PDF PubMed Google Scholar, 18.Francone O.L. Fielding C.J. Effects of site-directed mutagenesis at residues cysteine-31 and cysteine-184 on lecithin-cholesterol acyltransferase activity.Proc. Natl. Acad. Sci. USA. 1991; 88: 1716-1720Crossref PubMed Scopus (61) Google Scholar). The analogous residue in LCAT is Cys31, which is also atypical. We hypothesized that the pH 4.5 optimum of LPLA2 in part reflects the requirement for protonation of this side chain at low pH, resulting in its neutralization, and allowing acyl chains to bind in this track. We further hypothesized that Asp13 contributes to substrate preference for unsaturated acyl chains. These hypotheses were tested by substituting Asp13 for Ala (D13A), Cys (D13C), or Phe (D13F) and by the measurement of transacylase and lipase activities as a function of pH. We observed that the D13F variant exhibits significantly less pH dependence with an observed augmention of phosholipase A activity at pH 7.4. We also observed a role for Asp13 in acceptor specificity with regard to unsaturated fatty acyl groups independent of their sn-1 vs. sn-2 positions. These studies further confirmed that the scissile fatty acyl group resides in track A and confers either phospholipase A1 or A2 activity based on the affinity of the fatty acyl group for this track. 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1-oleoyl-2-myristoyl-sn-glycero-3-phosphocholine (OMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine (PLPC), 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (PAPC), 1-palmitoyl-2-docosahexanoyl-sn-glycero-3-phosphocholine (PDPC), 1-oleoyl-2-palmitoyl-sn-glycero-3-phosphocholine (OPPC), 1-oleoyl-2-steraroyl-sn-glycero-3-phosphocholine (OSPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1′rac-rlycero) Na salt (POPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (POPS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphate (POPA), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), 1- oleoyl -2-stearoyl-sn-glycero-3-phosphocholine (OSPC), 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphocholine (SLPC), 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphate (SLPA), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (SOPE), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (SOPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphate (SOPA), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-(1′rac-glycerol) (SOPG), 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphate (SLPA), 1-stearoyl-2-linoleoyl-sn-glycero-3-phospho-(1′rac-glycerol) (SLPG), 1-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (SLPS), 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine (SLPE), 1-palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine (PSPC), N-acetyl-D-erythro-sphingosine (NAS), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (DODPC), 1-O-hexadecyl-2-acetyl-sn-glycerol (HAG) were purchased from Avanti (Alabaster, AL). Purified recombinant mouse LPLA2 was obtained from Proteos Inc. (Kalamazoo, MI). Monoclonal antibodies against LPLA2 were developed from cloned recombinant protein, and purified from Maine Biotechnology Services (Portland, ME). Anti-His-antibody, BCA protein assay reagent, 1-O-hexadecyl-rac-glycerol (HG), oleoylethanolamide (OEA), and anandamide (AEA) were from Sigma (Rockford, IL). Goat anti-rat IgG-HRP was from Santa Cruz Biotechnology (Dallas, TX). Dicetyl phosphate and polyethylenimine (average MW 25 kDa, and degree of polymerization 580) were from Sigma (St. Louis, MO). HPTLC silica gel plates (10 × 20 cm) were from Merck KGaA (Darmstadt, Germany). LPLA2 variants were expressed and purified as previously described (9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar). The pcDNA4 plasmid containing the human LPLA2 gene with codons optimized for expression in HEK293F cells was employed. The construct encodes the LPLA2 signal sequence, followed by a 6xHis tag and tobacco etch virus protease cleavage site, and then the sequence corresponding to mature LPLA2 (pcDNA4-LPLA2). For expression of LPLA2, HEK293F cells were grown in suspension in Gibco FreeStyle media supplemented with 0.5% fetal bovine serum (Fisher Scientific, Pittsburgh, PA). Upon attaining a cell density of 1.5×106/ml, the cells were transiently transfected using a pcDNA4-LPLA2:polyethylenimine molar ratio of 1:2. Conditioned media was harvested 5 d later, supplemented with HEPES pH 7.5 to a final concentration of 50 mM, and then loaded on a 3 ml Ni-NTA column. The column was washed with 10 ml buffer containing 20 mM HEPES pH 7.4, 300 mM NaCl, and 10 mM imidazole pH 8, and eluted using the same buffer containing 200 mM imidazole pH 8. The eluate was dialyzed overnight at 4°C against 20 mM HEPES pH 7.5, 100 mM NaCl, and 1 mM DTT using a dialysis cassette G2 20,000 MWCO (Thermos Scientific Rockford, IL). The protein was concentrated to 0.5–1 mg/ml using Amicon Ultra 4 centrifuge filters (Merck KGaA, Darmstadt Germany). Protein concentrations were determined by use of the Bradford reagent and confirmed by a NanoDrop spectrophotometer read at A280. Protein purity was monitored using SDS-PAGE and Western analysis with anti-LPLA2 and anti-His antibodies. Site-directed variants of pcDNA4-LPLA2 were made using a single primer for each substitution and Q5 Polymerase (New England Biolabs, Ipswich, MA): D13A,GGTCCTGGTGCCCGGCGCCCTGGGGAATCAGCTGG; D13C, GGTCCTGGTGCCCGGCTGTCTGGGGAATCAGCTGG; D13F, CCTGGTGCCCGGCTTCCTGGGGAATCAGC; L49F, GGCTGAACCTGGAACTGTTCCTGCCAGTCATCATTGAC; V101L, GACCCTTCCAAAAGCTCCGTGGGATCTTACTTCCACACTATG; N213Q/R214G, CTGGCTAGTGGCGATAACCAGGGCATCCCAGTCATTGGGCC; I360L, CCAGGAAGCGAACATCTGGAAATGCTGGCTAACGC. In selected experiments, multiple substitutions were made. The "total LCAT D13C variant" (ToLCC) denotes D13C, L49F, V101L, N213Q, R214G, and I360L substitutions. The "total LCAT D13F variant" (ToLCF) denotes D13F, L49F, V101L, N213Q, R214G, and I360L substitutions. Liposomes consisting of DOPC or DODPC and sulfatide (10:1, molar ratio, 127 µM total) were incubated with 5 µg of LPLA2 variants in 500 µl of 48 mM Na citrate pH 4.5, or 50 mM HEPES buffer pH 7.4 for 30 min on ice. The reaction mixture was then centrifuged for 1 h at 150,000 g at 4°C. The resulting precipitate was rinsed with cold 50 mM Na citrate pH 4.5/50 mM HEPES buffer (pH 7.4) and dissolved with 40 µl of SDS-PAGE sample buffer. The sample was separated by using 10% SDS-PAGE. After electrophoresis, LPLA2 was detected with Coomassie Brilliant Blue. Band quantification was performed with the ImageJ software I1.651j8 (9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar) (National Institutes of Health). p-Nitro-phenylbutyrate (pNPB) was used to measure directly the catalytic activity of LPLA2 on a soluble ester substrate (8.Abe A. Shayman J.A. The role of negatively charged lipids in lysosomal phospholipase A2 function.J. Lipid Res. 2009; 50: 2027-2035Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). pNPB (Sigma, St. Louis, MO) was diluted to 10 mM using the reaction buffer (20 mM HEPES pH 7.5, 150 mM NaCl) containing 10% DMSO, and the reaction was initiated by the addition of 60 µl of 0.1 µM LPLA2 to 10 µl of pNPB. Release of p-nitrophenoxide was monitored by increased absorbance at 400 nm on a Spectramax plate reader. The transacylase reaction is based on the ability of LPLA2 to transfer an acyl group from the sn-2 or sn-1 position of a glycerophospholipid to NAS. Formation of 1-O-acyl-NAS is unique to the LPLA2 reaction (19.Abe A. Shayman J.A. Radin N.S. A novel enzyme that catalyzes the esterification of N-acetylsphingosine. Metabolism of C-2-ceramides.J. Biol. Chem. 1996; 271: 14383-14389Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). The reaction mixture contained liposomes (127 μM of phospholipid), buffer (48 mM Na citrate buffer pH 4.5 or 50 mM HEPES pH 7.4), 10 μg/ml BSA, and LPLA2 protein (30 ng or 60 ng) in a total volume of 0.5 ml. Liposomes consisting of phospholipid substrate/sulfatide/NAS (10:1:3 molar ratio) were used. LPLA2 binds preferentially to negatively charged liposomes. Sulfatide was used in the liposomes as it is not itself a substrate and does not function as a cofactor for lysosomal hydrolases. The reaction was initiated by addition of LPLA2, carried out at 37°C for different periods of time (as shown in the figure legends), and terminated by the addition of 3 ml chloroform/methanol (2/1, v/v), followed by 0.3 ml of 9% (w/v) NaCl. After centrifugation for 7 min at 1800 g, the resulting lower layer was transferred to a new tube and dried under a stream of nitrogen gas. The dried lipid was dissolved in 40 μl chloroform/methanol (2/1, v/v) and applied to HPTLC plates. HPTLC plates were run in chloroform/acetic acid (9/1, v/v), chloroform/methanol/acetic acid (90/1/5, v/v/v), or chloroform/methanol/acetic acid (95/2/5, v/v/v) as designated. The plates were dried and soaked in 8% (w/v) CuSO4.5H2O, 6.8% (v/v) H3PO4, and 32% (v/v) methanol, and then charred for 15 min in a 150°C oven. For the argentation of HPTLC plates, 10% AgNO3 in acetonitrile was used. Plates were immersed for 10 min, dried, and then activated for 30 min at 100°C. To prevent the silica gel from peeling off during subsequent steps, the dried plate was incubated in 20% (v/v) methanol containing 0.5% (v/v) acetic acid to remove AgNO3. The plate was then soaked in CuSO4 solution, dried, and charred as described above. Scanned plates were analyzed by ImageJ 1.651j8 (National Institutes of Health). The assay was performed as previously described (11.Abe A. Hiraoka M. Ohguro H. Tesmer J.J. Shayman J.A. Preferential hydrolysis of truncated oxidized glycerophospholipids by lysosomal phospholipase A2.J. Lipid Res. 2017; 58: 339-349Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). The reaction mixture included liposomes consisting of DODPC and DOPC (molar ratio 2.4:1). Buffer containing 50 mM Na citrate pH 4.5 or 50 mM HEPES pH 7.4 were used. The reaction was initiated by the addition of LPLA2 variants (30 ng) in a final volume of 500 µl. The reaction proceeded at 37°C and was terminated by the addition of 3 ml of chloroform/methanol (2:1) and 0.3 ml of 0.9% (w/v) NaCl. The mixture was centrifuged at 800 g for 5 min at room temperature. The resultant lower organic layer was transferred into another glass tube and dried down under a stream of nitrogen gas. The dried lipid was dissolved in 40 µl chloroform/methanol (2:1), applied to an HPTLC plate, and developed in a solvent consisting of chloroform/methanol/pyridine (98/2/0.5, v/v/v). The plate was dried and soaked in 8% (w/v) CuSO4, 5H2O, 6.8% (v/v) H3PO4, and 32% (v/v) methanol. The uniformly wet plate was briefly dried with a hair dryer and then charred for 15 min in a 150°C oven. The plate was scanned and the content of the product fatty acid was estimated using ImageJ 1.651j8v software (National Institutes of Health). The sterol esterification activity of recombinant human LCAT (rhLCAT) or LPLA2 variants was measured using dehydroergosterol (DHE), a naturally occurring fluorescent sterol, as the substrate in combination with cholesterol oxidase (20.Homan R. Esmaeil N. Mendelsohn L. Kato G.J. A fluorescence method to detect and quantitate sterol esterification by lecithin:cholesterol acyltransferase.Anal. Biochem. 2013; 441: 80-86Crossref PubMed Scopus (13) Google Scholar). Peptide-DHE-synthetic high density lipoprotein (sHDL) samples were prepared via the thin-film method. Briefly, DPPC, POPC, and DHE (molar ratio 9:9:2) were dissolved in chloroform. The ApoA1 22-mer peptide 22A, ESP24218, (sequence PVLDLFRELLNELLEALKQKLK) was dissolved in 1:1 (v/v) methanol/water, and then mixed with the lipid/chloroform solution (21.Li D. Gordon S. Remaley A.T. Apolipoprotein mimetic peptides for stimulating cholesterol efflux.in: Anantharamaiah G.M. Goldberg D. Apolipoprotein mimetics in management of human disease. Springer International Publishing, New York2015: 29-42Crossref Google Scholar). The solvent was removed under a flow of nitrogen for 2 h and then overnight in a vacuum oven. The lipid film was rehydrated with 20 mM phosphate buffer containing 1 mM EDTA (pH 7.4), followed by water bath sonication for 10 min, and probe sonication (2 min × 50 W) to obtain clear DHE-sHDL. All steps were performed at room temperature. The final DHE concentration in peptide-DHE-sHDL was 0.5 mM. The size of the peptide-DHE-sHDL was detected via dynamic light scattering. Briefly, the sHDL samples were diluted by PBS (pH 7.4) to a final peptide concentration of 1 mg/ml and then measured by Zetasizer Nano ZSP (Malvern Instruments, Malvern, UK). The volume size for the peptide-DHE-sHDL substrates was 9.5 ± 0.08 nm. The DHE assay was performed in 96-well white polystyrene plates in triplicate. Briefly, 100 μl of 0, 5, 10, 20, 40, 60, and 100 μM DHE-containing sHDL substrates in assay buffer (PBS pH 7.4 plus 1 mM EDTA, 5 mM β-mercaptoethanol, and 60 µM albumin) preheated to 37°C were incubated with 100 μl of 5 μg/ml rhLCAT or LPLA2 protein in assay buffer lacking β-mercaptoethanol preheated to 37°C. The plates were incubated at 37°C with shaking (80 rpm/min) for 0, 10, and 20 min. The reactions were stopped by addition of 50 μl of 3.75 U/ml cholesterol oxidase in PBS containing 1 mM EDTA and 7% Triton X-100. The plates were incubated at 37°C with shaking (80 rpm/min) for another 1 h to quench the fluorescence of unesterified DHE. The fluorescence was measured at an excitation wavelength of 325 nm and an emission wavelength of 425 nm using a SynergyTM NEO HTS Multi-Mode Microplate Reader. The initial velocity (Vo, μM DHE-ester/h) was taken to be the linear range of DHE-ester concentration versus time. The Vmax and Km were obtained by plotting Vo versus DHE concentration in GraphPad Prism 7 (nonlinear regression, Michaelis-Menten model). Docking was performed using chain A of the previously published apo-LPLA2 crystal structure (PDB entry 4X90), and a model of LPLA2 D13F generated based on the conformation of Tyr31 in the crystal structure of the C31Y mutant of LCAT (PDB entry 4XWG) (9.Glukhova A. Hinkovska-Galcheva V. Kelly R. Abe A. Shayman J.A. Tesmer J.J. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase.Nat. Commun. 2015; 6: 6250Crossref PubMed Scopus (54) Google Scholar, 22.Piper D.E. Romanow W.G. Gunawardane R.N. Fordstrom P. Masterman S. Pan O. Thibault S.T. Zhang R. Meininger D. Schwarz M. et al.The high-resolution crystal structure of human LCAT.J. Lipid Res. 2015; 56: 1711-1719Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). eLBOW (23.Adams P.D. Afonine P.V. Bunkoczi G. Chen V.B. Davis I.W. Echols N. Headd J.J. Hung L.W. Kapral G.J. Grosse-Kunstleve R.W. et al.PHENIX: a comprehensive Python-based system for macromolecular structure solution.Acta Crystallogr. D Biol. Crystallogr. 2010; 66: 213-221Crossref PubMed Scopus (16434) Google Scholar) was used to perform geometry optimization of each ligand, and subsequently docking was performed with AutoDock Vina (24.Trott O. Olson A.J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading.J. Comput. Chem. 2010; 31: 455-461Crossref PubMed Scopus (7925) Google Scholar). The thermal stability assay was employed to determine the melting point (Tm) of the expressed proteins as described (25.Semisotnov G.V. Rodionova N.A. Razgulyaev O.I. Uversky V.N. Gripas A.F. Gilmanshin R.I. Study of the "molten globule" intermediate state in protein folding by a hydrophobic fluorescent probe.Biopolymers. 1991; 31: 119-128Crossref PubMed Scopus (1231) Google Scholar). An incubation mixture consisting of 2.5 μl of 8x SYPRO Orange, 1 μg of LPLA2 variants, either 48 mM Na citrate pH 4.5 or 50 mM HEPES pH 7.4, and ddH2O in a final volume of 20 μl was added to wells of a 48-well thin-wall PCR plate. The plates were sealed with Optical-Quality Sealing Tape (Bio-Rad) and heated in a Real-Time PCR Detection System Life Technology from 20 to 90°C in steps of 0.2°C. Tm values were calculated as the inflection point of the melting curve using instrument software. Data from at least three independent experiments were analyzed with a paired t-test in GraphPad Prism 7 and expressed as mean ± SEM. The differences between control and treated samples were considered statistically significant at P < 0.05. The D13A, D13C, and D13F variants of LPLA2 were created to test the contribution of Asp13 to the pH profile and acyl chain selectivity of the enzyme. D13F restores the position to what it is commonly found in distantly related bacterial lipases. The ToLCC variant incorporates substitutions that alter side chains in the active site to those found in LCAT, which has a pH optimum of 8 (26.Bonelli F.S. Jonas A. Reaction of lecithin cholesterol acyltransferase with water-soluble substrates.J. Biol. Chem. 1989; 264: 14723-14728Abstract Full Text PDF PubMed Google Scholar), including a D13C substitution. ToLCF is the same set of mutations as in ToLCC except with D13F. WT and variant LPLA2 were secreted from mammalian cells and purified to homogeneity as confirmed by SDS-PAGE and Western blotting, using both anti-LPLA2 and anti-His antibodies (data not shown). To assess the structural integrity of the LPLA2 variants, the thermal stability of each variant was measured at both pH 4.5 and 7.4. At pH 4.5, the D13A, D13C, and D13F variants exhibited <2° decreased Tm relative to WT (Tm of 65.6 ± 1.4°C), indicating that global folding was not disrupted (Table 1). The ToLCC (Tm of 61.3 ± 2°C) and ToLCF (Tm of 57.3 ± 1.3°C) were, however, significantly less stable, exhibiting ΔTm values of 4.3 and 8.3°C, respectively, less than WT, suggesting significant structural perturbation.TABLE 1Thermal stability and membrane binding of LPLA2 variants at pH 4.5 and 7.4LPLA2 variantTm°CΔTmBinding at pH 4.5 (% WT)Binding at pH 7.4 (%WT at pH 4.5)WT65.6 ± 1.4—100 ± 6.59.5 ± 1.3D13A64.5 ± 1.0−1.186 ± 8.7*16.0 ± 3.0*D13C64.9 ± 2.5−0.769 ± 8.3*9.0 ± 1.8D13F63.3 ± 1.0−2.393 ± 1120.0 ± 1.6**To LCC61.3 ± 2.0−4.369 ± 5.0*9.0 ± 2.6To LCF57.3 ± 1.3−8.368 ± 22*10.0 ± 3.4Tm is defined as the inflection point of the melting curve and was calculated by the Boltzmann equation (32.Vivoli M. Novak H.R. Littlechild J.A. Harmer N.J. Determination of protein-ligand interactions using differential scanning fluorimetry.J. Vis. Exp. 2014; : 51809PubMed Google Scholar). Membrane binding was measured by the liposome pull-down assay as described in the Methods. The data represent the mean ± SD (n = 3) per measurement, *P < 0.05, **P < 0.001 using a t-test. Open table in a new tab Tm is defined as the inflection point of the melting curve and was calculated by the Boltzmann equation (32.Vivoli M. Novak H.R. Littlechild J.A. Harmer N.J. Det
Referência(s)