Novel GPIHBP1-independent pathway for clearance of plasma TGs in Angptl4−/−Gpihbp1−/− mice
2018; Elsevier BV; Volume: 59; Issue: 7 Linguagem: Inglês
10.1194/jlr.m084749
ISSN1539-7262
AutoresEmily M. Cushing, Kelli L. Sylvers, Xun Chi, Shwetha K. Shetty, Brandon S.J. Davies,
Tópico(s)Diabetes, Cardiovascular Risks, and Lipoproteins
ResumoMice lacking glycosylphosphatidylinositol-anchored HDL-binding protein 1 (GPIHBP1) are unable to traffic LPL to the vascular lumen. Thus, triglyceride (TG) clearance is severely blunted, and mice are extremely hypertriglyceridemic. Paradoxically, mice lacking both GPIHBP1 and the LPL regulator, angiopoietin-like 4 (ANGPTL4), are far less hypertriglyceridemic. We sought to determine the mechanism by which Angptl4−/−Gpihbp1−/− double-knockout mice clear plasma TGs. We confirmed that, on a normal chow diet, plasma TG levels were lower in Angptl4−/−Gpihbp1−/− mice than in Gpihbp1−/− mice; however, the difference disappeared with administration of a high-fat diet. Although LPL remained mislocalized in double-knockout mice, plasma TG clearance in brown adipose tissue (BAT) increased compared with Gpihbp1−/− mice. Whole lipoprotein uptake was observed in the BAT of both Gpihbp1−/− and Angptl4−/−Gpihbp1−/− mice, but BAT lipase activity was significantly higher in the double-knockout mice. We conclude that Angptl4−/−Gpihbp1−/− mice clear plasma TGs primarily through a slow and noncanonical pathway that includes the uptake of whole lipoprotein particles. Mice lacking glycosylphosphatidylinositol-anchored HDL-binding protein 1 (GPIHBP1) are unable to traffic LPL to the vascular lumen. Thus, triglyceride (TG) clearance is severely blunted, and mice are extremely hypertriglyceridemic. Paradoxically, mice lacking both GPIHBP1 and the LPL regulator, angiopoietin-like 4 (ANGPTL4), are far less hypertriglyceridemic. We sought to determine the mechanism by which Angptl4−/−Gpihbp1−/− double-knockout mice clear plasma TGs. We confirmed that, on a normal chow diet, plasma TG levels were lower in Angptl4−/−Gpihbp1−/− mice than in Gpihbp1−/− mice; however, the difference disappeared with administration of a high-fat diet. Although LPL remained mislocalized in double-knockout mice, plasma TG clearance in brown adipose tissue (BAT) increased compared with Gpihbp1−/− mice. Whole lipoprotein uptake was observed in the BAT of both Gpihbp1−/− and Angptl4−/−Gpihbp1−/− mice, but BAT lipase activity was significantly higher in the double-knockout mice. We conclude that Angptl4−/−Gpihbp1−/− mice clear plasma TGs primarily through a slow and noncanonical pathway that includes the uptake of whole lipoprotein particles. Misregulation of plasma triglyceride (TG) clearance is associated with a number of disease states, including diabetes mellitus, atherosclerosis, and hypertension (1.Chahil T.J. Ginsberg H.N. Diabetic dyslipidemia.Endocrinol. Metab. Clin. North Am. 2006; 35: 491-510Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar, 2.De Man F.H. Cabezas M.C. Van Barlingen H.H. Erkelens D.W. de Bruin T.W. Triglyceride-rich lipoproteins in non-insulin-dependent diabetes mellitus: post-prandial metabolism and relation to premature atherosclerosis.Eur. J. Clin. Invest. 1996; 26: 89-108Crossref PubMed Scopus (109) Google Scholar). Clearance of plasma TGs is primarily mediated by LPL, which hydrolyzes lipoprotein TGs, liberating fatty acids for tissue uptake (3.Olivecrona T. Olivecrona G. The ins and outs of adipose tissue.in: Ehnholm C. Cellular Lipid Metabolism. Springer Berlin, Heidelberg2009: 315-369Crossref Scopus (23) Google Scholar, 4.Wang H. Eckel R.H. Lipoprotein lipase: from gene to obesity.Am. J. Physiol. Endocrinol. Metab. 2009; 297: E271-E288Crossref PubMed Scopus (574) Google Scholar, 5.Havel R.J. Triglyceride-rich lipoproteins and plasma lipid transport.Arterioscler. Thromb. Vasc. Biol. 2010; 30: 9-19Crossref PubMed Scopus (42) Google Scholar). LPL must localize to the vascular lumen to hydrolyze plasma TGs. The endothelial transport protein, glycosylphosphatidylinositol-anchored HDL-binding protein 1 (GPIHBP1), is required for this localization, transporting LPL across capillary endothelial cells and then anchoring LPL to the capillary wall during the lipolysis of serum TGs (6.Davies B.S.J. Beigneux A.P. Barnes II, R.H. Tu Y. Gin P. Weinstein M.M. Nobumori C. Nyrén R. Goldberg I. Olivecrona G. et al.GPIHBP1 is responsible for the entry of lipoprotein lipase into capillaries.Cell Metab. 2010; 12: 42-52Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar, 7.Beigneux A.P. Davies B.S.J. Gin P. Weinstein M.M. Farber E. Qiao X. Peale F. Bunting S. Walzem R.L. Wong J.S. et al.Glycosylphosphatidylinositol-anchored high density lipoprotein–binding protein 1 plays a critical role in the lipolytic processing of chylomicrons.Cell Metab. 2007; 5: 279-291Abstract Full Text Full Text PDF PubMed Scopus (366) Google Scholar, 8.Goulbourne C.N. Gin P. Tatar A. Nobumori C. Hoenger A. Jiang H. Grovenor C.R.M. Adeyo O. Esko J.D. Goldberg I.J. et al.The GPIHBP1-LPL complex is responsible for the margination of triglyceride-rich lipoproteins in capillaries.Cell Metab. 2014; 19: 849-860Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). In the absence of GPIHBP1, LPL is trapped in the interstitial spaces and is unable to access TG-rich lipoproteins in the circulation (6.Davies B.S.J. Beigneux A.P. Barnes II, R.H. Tu Y. Gin P. Weinstein M.M. Nobumori C. Nyrén R. Goldberg I. Olivecrona G. et al.GPIHBP1 is responsible for the entry of lipoprotein lipase into capillaries.Cell Metab. 2010; 12: 42-52Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar, 8.Goulbourne C.N. Gin P. Tatar A. Nobumori C. Hoenger A. Jiang H. Grovenor C.R.M. Adeyo O. Esko J.D. Goldberg I.J. et al.The GPIHBP1-LPL complex is responsible for the margination of triglyceride-rich lipoproteins in capillaries.Cell Metab. 2014; 19: 849-860Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). As a result, plasma TG levels in GPIHBP1-deficient mice and humans are dramatically elevated, despite normal production of LPL (7.Beigneux A.P. Davies B.S.J. Gin P. Weinstein M.M. Farber E. Qiao X. Peale F. Bunting S. Walzem R.L. Wong J.S. et al.Glycosylphosphatidylinositol-anchored high density lipoprotein–binding protein 1 plays a critical role in the lipolytic processing of chylomicrons.Cell Metab. 2007; 5: 279-291Abstract Full Text Full Text PDF PubMed Scopus (366) Google Scholar, 9.Rios J.J. Shastry S. Jasso J. Hauser N. Garg A. Bensadoun A. Cohen J.C. Hobbs H.H. Deletion of GPIHBP1 causing severe chylomicronemia.J. Inherit. Metab. Dis. 2012; 35: 531-540Crossref PubMed Scopus (76) Google Scholar). Angiopoietin-like 4 (ANGPTL4) is a fasting-induced inhibitor of LPL (10.Shan L. Yu X-C. Liu Z. Hu Y. Sturgis L.T. Miranda M.L. Liu Q. The angiopoietin-like proteins ANGPTL3 and ANGPTL4 inhibit lipoprotein lipase activity through distinct mechanisms.J. Biol. Chem. 2009; 284: 1419-1424Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 11.Köster A. Chao Y.B. Mosior M. Ford A. Gonzalez-DeWhitt P.A. Hale J.E. Li D. Qiu Y. Fraser C.C. Yang D.D. et al.Transgenic angiopoietin-like (angptl)4 overexpression and targeted disruption of angptl4 and angptl3: regulation of triglyceride metabolism.Endocrinology. 2005; 146: 4943-4950Crossref PubMed Scopus (349) Google Scholar). ANGPTL4 deficiency leads to lower TG levels in mice and humans (11.Köster A. Chao Y.B. Mosior M. Ford A. Gonzalez-DeWhitt P.A. Hale J.E. Li D. Qiu Y. Fraser C.C. Yang D.D. et al.Transgenic angiopoietin-like (angptl)4 overexpression and targeted disruption of angptl4 and angptl3: regulation of triglyceride metabolism.Endocrinology. 2005; 146: 4943-4950Crossref PubMed Scopus (349) Google Scholar, 12.Romeo S. Pennacchio L.A. Fu Y. Boerwinkle E. Tybjaerg-Hansen A. Hobbs H.H. Cohen J.C. Population-based resequencing of ANGPTL4 uncovers variations that reduce triglycerides and increase HDL.Nat. Genet. 2007; 39: 513-516Crossref PubMed Scopus (425) Google Scholar, 13.Stitziel N.O. Stirrups K.E. Masca N.G. Erdmann J. Ferrario P.G. König I.R. Weeke P.E. Webb T.R. Auer P.L. Schick U.M. et al.Coding variation in ANGPTL4, LPL, and SVEP1 and the risk of coronary disease.N. Engl. J. Med. 2016; 374: 1134-1144Crossref PubMed Scopus (340) Google Scholar, 14.Dewey F.E. Gusarova V. O'Dushlaine C. Gottesman O. Trejos J. Hunt C. Van Hout C.V. Habegger L. Buckler D. Lai K.M. et al.Inactivating variants in ANGPTL4 and risk of coronary artery disease.N. Engl. J. Med. 2016; 374: 1123-1133Crossref PubMed Scopus (310) Google Scholar), and mice overexpressing ANGPTL4 have elevated TG levels (11.Köster A. Chao Y.B. Mosior M. Ford A. Gonzalez-DeWhitt P.A. Hale J.E. Li D. Qiu Y. Fraser C.C. Yang D.D. et al.Transgenic angiopoietin-like (angptl)4 overexpression and targeted disruption of angptl4 and angptl3: regulation of triglyceride metabolism.Endocrinology. 2005; 146: 4943-4950Crossref PubMed Scopus (349) Google Scholar). TG tracing experiments in Angptl4−/− mice suggest that one primary role of ANGPTL4 is to inhibit LPL in adipose tissue during fasting, thereby diverting plasma TGs away from adipose (15.Cushing E.M. Chi X. Sylvers K.L. Shetty S.K. Potthoff M.J. Davies B.S.J. Angiopoietin-like 4 directs uptake of dietary fat away from adipose during fasting.Mol. Metab. 2017; 6: 809-818Crossref PubMed Scopus (60) Google Scholar). Preclinical studies suggest that targeting ANGPTL4 can lower plasma TGs in primates (14.Dewey F.E. Gusarova V. O'Dushlaine C. Gottesman O. Trejos J. Hunt C. Van Hout C.V. Habegger L. Buckler D. Lai K.M. et al.Inactivating variants in ANGPTL4 and risk of coronary artery disease.N. Engl. J. Med. 2016; 374: 1123-1133Crossref PubMed Scopus (310) Google Scholar), and humans with homozygous deficiency in ANGPTL4 appear to be protected from cardiovascular disease (13.Stitziel N.O. Stirrups K.E. Masca N.G. Erdmann J. Ferrario P.G. König I.R. Weeke P.E. Webb T.R. Auer P.L. Schick U.M. et al.Coding variation in ANGPTL4, LPL, and SVEP1 and the risk of coronary disease.N. Engl. J. Med. 2016; 374: 1134-1144Crossref PubMed Scopus (340) Google Scholar, 14.Dewey F.E. Gusarova V. O'Dushlaine C. Gottesman O. Trejos J. Hunt C. Van Hout C.V. Habegger L. Buckler D. Lai K.M. et al.Inactivating variants in ANGPTL4 and risk of coronary artery disease.N. Engl. J. Med. 2016; 374: 1123-1133Crossref PubMed Scopus (310) Google Scholar). Although Angptl4−/− mice have increased LPL activity and reduced TG levels, the necessity of GPIHBP1-mediated trafficking would suggest that Angptl4−/−Gpihbp1−/− double-knockout mice share the same severe hypertriglyceridemia as Gpihbp1−/− mice. However, Angptl4−/−Gpihbp1−/− mice have substantially lower plasma TG levels than Gpihbp1−/− mice (16.Sonnenburg W.K. Yu D. Lee E-C. Xiong W. Gololobov G. Key B. Gay J. Wilganowski N. Hu Y. Zhao S. et al.GPIHBP1 stabilizes lipoprotein lipase and prevents its inhibition by angiopoietin-like 3 and angiopoietin-like 4.J. Lipid Res. 2009; 50: 2421-2429Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). The intriguing phenotype of these mice strongly suggests the existence of a GPIHBP1-independent mechanism capable of substantial TG clearance in the absence of vascular LPL. In this study, we investigated the GPIHBP1-independent mechanism by which plasma TGs are cleared in mice lacking both GPIHBP1 and ANGPTL4. All animal procedures were conducted in conformity with the Public Health Service Policy on Humane Care and Use of Laboratory Animals and were carried out according to guidelines approved by the Institutional Animal Care and Use Committee at the University of Iowa. Mice were group housed (up to 5 per cage) in a controlled environment with a 12/12 h light/dark cycle, with food and water provided ad libitum during nonfasting conditions. Mice were fed either normal chow diet (NCD) (Envigo, 7913) or high-fat diet (HFD) (Research Diets, D12451) containing 45% kcal/g from fat. Gpihbp1−/− mice were obtained from the Mutant Mouse Resource and Research Center (mmrrc.org, strain name: B6;129S5-Gpihbp1tm1Lex/Mmucd) (17.Tang T. Li L. Tang J. Li Y. Lin W.Y. Martin F. Grant D. Solloway M. Parker L. Ye W. et al.A mouse knockout library for secreted and transmembrane proteins.Nat. Biotechnol. 2010; 28: 749-755Crossref PubMed Scopus (262) Google Scholar, 18.Young S.G. Davies B.S.J. Voss C.V. Gin P. Weinstein M.M. Tontonoz P. Reue K. Bensadoun A. Fong L.G. Beigneux A.P. GPIHBP1, an endothelial cell transporter for lipoprotein lipase.J. Lipid Res. 2011; 52: 1869-1884Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Angptl4−/− mice were obtained from Mutant Mouse Resource and Research Center (mmrrc.org, strain name: B6;129S5-Angptl4Gt(OST352973)Lex/Mmucd) (17.Tang T. Li L. Tang J. Li Y. Lin W.Y. Martin F. Grant D. Solloway M. Parker L. Ye W. et al.A mouse knockout library for secreted and transmembrane proteins.Nat. Biotechnol. 2010; 28: 749-755Crossref PubMed Scopus (262) Google Scholar, 19.Sanderson L.M. Degenhardt T. Koppen A. Kalkhoven E. Desvergne B. Müller M. Kersten S. Peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) but not PPARalpha serves as a plasma free fatty acid sensor in liver.Mol. Cell. Biol. 2009; 29: 6257-6267Crossref PubMed Scopus (102) Google Scholar). Both strains were maintained on a mixed C57Bl/6J-129S5 background. The two strains were crossed to generate wild-type, Gpihbp1−/−, Angptl4−/−, and Angptl4−/−Gpihbp1−/− littermates. Littermate mice were fasted for 4 h (fasted group) or fasted for 6 h and then allowed to feed on NCD ad libitum for 2 h (refed group). Blood was collected via tail-nick. Glucose was assayed using a OneTouch UltraMini glucometer. For TG, insulin, and leptin measurements, blood was collected into EDTA-coated collection tubes (Sarstadt, 16.444.100) and centrifuged at 1,500 g for 15 min at 4°C to pellet the cells. For TG measurements, the plasma supernatant from each mouse was combined with Infinity™ TG reagent (Thermo Scientific, TR22421) according to the manufacturer's instructions. Samples were incubated at 37°C for 5 min and absorbance was measured at 500 nm. TG concentrations were determined by comparison to a standard curve prepared from a triolein standard (Nu-Chek Prep, Lot T-235-N13-Y). Plasma was also assayed for leptin using the Mouse and Rat Leptin ELISA (BioVendor, RD291001200R) and insulin using the Ultra Sensitive Mouse Insulin ELISA kit (CrystalChem, 90080). Plasma lipase assays were carried out as described below. Mouse tissues were frozen in liquid nitrogen and pulverized using a Bessman tissue pulverizer. Crushed tissue was resuspended in Trizol (Ambion, 15596-018) and processed according to the manufacturer's instructions. After assessing mRNA concentration and quality using a NanoDrop spectrophotometer (ThermoScientific, NanoDrop 2000), cDNA was prepared using a high capacity cDNA reverse transcription kit (Applied Biosystems, part number 4368813). Quantitative (q)PCR was performed (Invitrogen, SYBR GreenER qPCR Supermix, 11762100) according to the manufacturer's specifications using an Applied Biosystems 7900HT fast real-time PCR system (Iowa Institute of Human Genetics). Relative expression was calculated with the ΔΔCt method (20.Schmittgen T.D. Livak K.J. Analyzing real-time PCR data by the comparative C(T) method.Nat. Protoc. 2008; 3: 1101-1108Crossref PubMed Scopus (17280) Google Scholar) using cyclophilin A (CycloA) as the reference gene. Primers used were as follows: TGGCAAGACCAGCAAGAA and CTCCTGAGCTACAGAAGGAATG for CycloA, AGCAGGGACAGAGCACCTCT and AGACGAGCGTGATGCAGAAG for mouse Gpihbp1, CAACTAGCTGGGCCCTTAAT and ATCCACAGCACCTACAACAG for mouse Angptl4, and AGCAGGAAGTCTGACCAATAAG and ATCAGCGTCATCAGGAGAAAG for mouse Lpl. Mouse tissues were frozen in liquid nitrogen, pulverized using a Bessman tissue pulverizer, and resuspended in LPL assay buffer [25 mM NH4Cl, 5 mM EDTA, 0.01% SDS, 45 U/ml heparin, 0.05% 3-(N,N-dimethylmyristylammonio) propanesulfonate zwittergent detergent (Acros Organics, 427740050)] containing Mammalian ProteaseArrest protease inhibitors (GBiosciences, catalog number 786–331). The tissue suspension was mixed by vortexing and incubated on ice for 30 min, with intermittent disruption with surgical scissors. The resulting lysate was centrifuged at 15,000 g for 15 min at 4°C to pellet cellular debris. Lipase activity assays were performed on supernatant as previously described (15.Cushing E.M. Chi X. Sylvers K.L. Shetty S.K. Potthoff M.J. Davies B.S.J. Angiopoietin-like 4 directs uptake of dietary fat away from adipose during fasting.Mol. Metab. 2017; 6: 809-818Crossref PubMed Scopus (60) Google Scholar, 21.Chi X. Shetty S.K. Shows H.W. Hjelmaas A.J. Malcolm E.K. Davies B.S.J. Angiopoietin-like 4 modifies the interactions between lipoprotein lipase and its endothelial cell transporter GPIHBP1.J. Biol. Chem. 2015; 290: 11865-11877Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar); samples were combined with a working buffer composed of 0.6 M NaCl, 80 mM Tris-HCl (pH 8), 6% fatty-acid free BSA, and an EnzChek lipase fluorescent substrate (Molecular Probes, E33955). Fluorescence was measured over 30 min at 37°C on a SpectraMax i3 plate reader (Molecular Devices). Relative lipase activity was calculated by subtracting background (calculated by reading fluorescence of a sample with no LPL) and then calculating the slope of the curve between the 5 and 13 min reads. The data were graphed as the average of slopes for each group. Plasma was collected and prepared as described above. Plasma or recombinant human LPL (21.Chi X. Shetty S.K. Shows H.W. Hjelmaas A.J. Malcolm E.K. Davies B.S.J. Angiopoietin-like 4 modifies the interactions between lipoprotein lipase and its endothelial cell transporter GPIHBP1.J. Biol. Chem. 2015; 290: 11865-11877Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) was combined with molecular grade water (Research Products International) or with 2 M NaCl, then incubated on ice for 2 h. Samples were then combined with working buffer (as described above) alone or in combination with 10 μM tetrahydrolipstatin (THL). Fluorescence was measured as above using the EnzChek lipase fluorescent substrate. Relative lipase activity was calculated by calculating the slope of the curve between the 1 and 20 min reads, then subtracting background (activity of THL treated sample). The data were graphed as the average of slopes for each group normalized to plasma from wild-type mice. Gpihbp1−/− mice were fasted 4 h and then gavaged with 100 μCi of [9,10-3H(N)]triolein (Perkin Elmer, NET431001MC) or 100 μCi of [9,10-3H(N)]triolein, 2 μCi [4-14C]cholesterol (Perkin Elmer, NEC018050UC) and 20 mg/ml of cholesterol (Chem-Impex International, 50-493-426) suspended in olive oil. After 4 h, mice were anesthetized and blood was collected by cardiac puncture. Blood was diluted 1:10 with 0.5 M EDTA (pH 8.0) and centrifuged at 1,500 g for 15 min at 4°C to pellet blood cells. The plasma was then transferred to ultracentrifuge tubes and mixed 1:1 with PBS. After centrifugation at 424,000 g for 2 h at 10°C, the chylomicrons formed an upper layer. The chylomicron layer was resuspended in fresh PBS and the centrifugation was repeated. Following the second centrifugation, the chylomicron layer was resuspended in PBS to the original plasma volume. Radioactivity was determined in BioSafe II scintillation fluid (RPI, 111195) on a Beckman-Coulter liquid scintillation counter (BCLSC6500). Littermate mice were fasted for 4 h. Mice were anesthetized with isoflurane and injected retro-orbitally with 100 μl of the radiolabeled chylomicron suspension (see above). Proparacaine hydrochloride ophthalmic solution, USP 0.5% (AKORN, 17478-263-12) was used to minimize discomfort both during and after injection. Blood samples were taken via tail-nick at 1, 5, 10, and 15 min (for short-term uptake analysis) or at 1, 5, 15, 30, and 60 min after injection (for long-term uptake analysis). Blood samples were assayed in BioSafe II scintillation fluid on a Beckman-Coulter scintillation counter. After the last blood draw, the mice were anesthetized with isoflurane, and perfused with 20 ml of cold 0.5% tyloxapol in PBS. Tissues were harvested and weighed. Approximately 50 mg of each tissue was then weighed and placed in 2 ml of 2:1 chloroform:methanol overnight at 4°C. One milliliter of 2 M CaCl2 was then added to each sample to separate organic and aqueous layers. The samples were centrifuged for 10 min at 400 g, and the upper aqueous layer was mixed with BioSafe II scintillation fluid and assayed on a Beckman-Coulter scintillation counter. The lower organic layer was evaporated overnight to remove chloroform, and the remaining sample was resuspended in scintillation fluid and assayed in BioSafe II scintillation fluid on a Beckman-Coulter liquid scintillation counter. Cpm counts from aqueous and organic fractions were combined to obtain the total uptake cpm. Cpm were also measured for an aliquot representing 10% (by volume) of the chylomicrons injected into each mouse. This value was used to normalize the radiolabel data across mice. Littermate mice were fasted for 4 h and gavaged with 2 μCi of [9,10-3H(N)]triolein (Perkin Elmer, NET431001MC) suspended in olive oil. Mice were anesthetized with isoflurane and injected retro-orbitally with 500 mg/kg body weight of Triton WR1339 in PBS (n = 5–6), or PBS alone for control mice (n = 3). Proparacaine hydrochloride ophthalmic solution, USP 0.5% (AKORN, 17478-263-12) was used to minimize discomfort both during and after injection. Blood samples were taken via tail-nick at 30 min and 1, 2, 3, and 4 h following gavage. Blood samples were assayed in BioSafe II scintillation fluid on a Beckman-Coulter scintillation counter. Littermate mice were fasted for 4 h and injected via tail-vein with 0.5% Evans Blue in PBS (Fisher, S-13852). After 1 h, the mice were anesthetized with isoflurane and perfused with 20 ml of PBS to remove unbound dye. Tissues were harvested, snap-frozen in liquid nitrogen, and pulverized using a Bessman tissue pulverizer. Fifty milligrams of pulverized tissue was then added to 0.5 ml of formamide (Sigma, F9037) and heated at 55°C for 2 h to extract dye. Samples were centrifuged briefly to pellet cells and supernatant absorbance was measured at 610 nm. Dye concentration was determined by comparison to a standard curve prepared in formamide from a stock Evans Blue solution. The concentration of dye per milligram of tissue was calculated for each sample and graphed as percent of wild-type. Littermate mice were fasted for 4 h and perfused with 10 ml of PBS and 10 ml of 0.4% paraformaldehyde in PBS (Fisher, O4042). Brown adipose tissue (BAT) was excised and placed in 10% formalin (FormylFixx, Thermo Scientific, 9990910) for 1 h at room temperature. The tissues were rinsed twice in 1× PBS, and placed in 30% sucrose overnight at 4°C. The tissues were then embedded in Tissue-Tek OCT compound (Sakura, 4583) and frozen. Ten micron sections were prepared from frozen tissues using a cryostat (Leica Microm Cryostat I HM505E), transferred to microscope slides, and stored at −80°C. For examination of LPL localization, slides were thawed, incubated in ice-cold methanol for 10 min, and then washed in 1× PBS three times for 10 min. Slides were then incubated with 0.2% Triton X-100 in PBS two times for 30 min, and then washed in 1× PBS three times for 5 min. After incubating in blocking buffer (10% FBS in 1× PBS with 0.2% Triton X-100) for 30 min, slides were incubated overnight at 4°C with Armenian hamster anti-mouse CD31 (1:10; Developmental Studies Hybridoma Bank, University of Iowa, 2H8) and goat anti-mouse LPL [1:50 (22.Weinstein M.M. Yin L. Beigneux A.P. Davies B.S.J. Gin P. Estrada K. Melford K. Bishop J.R. Esko J.D. Dallinga-Thie G.M. et al.Abnormal patterns of lipoprotein lipase release into the plasma in GPIHBP1-deficient mice.J. Biol. Chem. 2008; 283: 34511-34518Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar)] in blocking buffer. Slides were then washed once with 0.2% Triton X-100 in PBS for 10 min and two times for 10 min with 1× PBS. Slides were incubated with 1:500 goat anti-hamster-Alexa Fluor 488 (ThermoFisher Scientific, A-21110) and 1:500 donkey anti-goat-Alexa Fluor 555 in blocking buffer for 2 h. Finally, slides were washed three times for 10 min with 1× PBS, fixed with Prolong Gold Anti-Fade reagent (Molecular Probes, P36931), and sealed with a coverslip. Slides from three mice per genotype were imaged using a (Leica DM5000b, Leica LAS AF software, and 63× lens), and at least 10 capillary cross-sections from each mouse were examined for luminal LPL. For examination of macrophage infiltration, slides were thawed and rinsed briefly in 10× PBS. Slides were then incubated with 0.4% Triton X-100 (Fisher, BP151) in 10× PBS at room temperature for 1 h and rinsed for 2 min in 10× PBS. After incubating for 1 h in blocking solution (5% FBS, 0.4% Triton X-100, and 10× PBS), slides were incubated overnight at 4°C with rat anti-mouse FA-11 (1:200; BioLegend, 137001). Following this incubation, slides were washed in 10× PBS with 0.5% Tween20 (Fisher, BP337) three times for 10 min and then incubated with donkey anti-rat-Alexa Fluor 488 (1:500; Invitrogen, A-21208) in blocking buffer for 2 h at room temperature. The slides were then washed five times for 10 min in 10× PBS with 0.5% Tween20, fixed with Prolong Gold Antifade reagent, and sealed with a coverslip. Slides from three mice per genotype were imaged using a Leica DM5000b, Leica LAS AF software, and 20× lens. Ten images were taken of each slide, and both nuclei and macrophages were manually counted in ImageJ. Individuals counting were blinded to genotype. The average ratio of macrophages to nuclei was calculated for each slide (with each slide being from a different mouse). The average of the ratio from each mouse was graphed. Statistics and outlier identification were performed using GraphPad Prism. Statistical significance was tested using Student's t-test unless otherwise indicated. Outliers were identified using the ROUT test and were excluded from graphs and from statistical analysis. The number of mice analyzed for each experiment is specified in each figure legend. Angptl4−/−Gpihbp1−/− mice were generated by crossing Gpihbp1−/− mice with Angptl4−/− mice. Angptl4+/−Gpihbp1+/− mice were then crossed to generate wild-type, Gpihbp1−/−, Angptl4−/−, and Angptl4−/−Gpihbp1−/− littermate mice. The expected genetic deficiencies were verified by measuring expression of Gpihbp1 and Angptl4 by qPCR (Fig. 1A, B). Consistent with previous reports (16.Sonnenburg W.K. Yu D. Lee E-C. Xiong W. Gololobov G. Key B. Gay J. Wilganowski N. Hu Y. Zhao S. et al.GPIHBP1 stabilizes lipoprotein lipase and prevents its inhibition by angiopoietin-like 3 and angiopoietin-like 4.J. Lipid Res. 2009; 50: 2421-2429Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar), male Angptl4−/−Gpihbp1−/− mice were far less hypertriglyceridemic than Gpihbp1−/− mice (Fig. 1C, D). Interestingly, Angptl4−/−Gpihbp1−/− mice had significantly higher plasma TGs after refeeding compared with mice fasted for 4 h (Fig. 1D). Female Angptl4−/−Gpihbp1−/− mice also had significantly less hypertriglyceridemia than female Gpihbp1−/− mice (Fig. 1E). Body weights for both male and female Angptl4−/−Gpihbp1−/− mice were normal (Fig. 2A, B). We also observed no significant differences in fasted or fed glucose levels (Fig. 2C), fasted or fed insulin levels (Fig. 2D), or leptin levels (Fig. 2E) when comparing Angptl4−/−Gpihbp1−/− mice with wild-type, Angptl4−/−, and Gpihbp1−/− mice. Interestingly, food intake was slightly lower for Angptl4−/−Gpihbp1−/− mice when compared with Gpihbp1−/− mice (Fig. 2E).Fig. 2Metabolic phenotypes of Angptl4−/−Gpihbp1−/− mice. A, B: Body weight over time for male (A) and female (B) wild-type, Angptl4−/−, Gpihbp1−/−, and Angptl4−/−Gpihbp1−/− mice (n = 5–8 for male, n = 10–18 for female). C, D: Plasma glucose (C) and insulin (D) levels of fasted (4 h) and refed (6 h fast, 2 h refeed) 15- to 19-week-old male mice (n = 6–8). E: Plasma leptin levels of fasted (4 h) 15- to 19-week-old male mice (n = 5). F: Average food intake of 15- to 19-week-old male wild-type, Angptl4−/−, Gpihbp1−/−, and Angptl4−/−Gpihbp1−/− mice as measured over 7 days (n = 6–7). *P < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We tested the possibility that Angptl4−/−Gpihbp1−/− mice have reduced plasma TG levels compared with Gpihbp1−/− mice because they absorb less dietary fat. In combination with the slight decrease in food intake (Fig. 2F), a decrease in fat absorption in the gut and the subsequent secretion of TGs into the circulation could explain the observed decrease in plasma TGs. To measure dietary fat absorption, fasted mice were gavaged with radiolabeled triolein after being injected intravenously with tyloxapol (Triton WR1339) to block LPL-mediated plasma TG clearance (23.Kellner A. Correll J.W. Ladd A.T. Sustained hyperlipemia induced in rabbits by means of intravenously injected surface-active agents.J. Exp. Med. 1951; 93: 373-384Crossref PubMed Scopus (74) Google Scholar). Appearance of radiolabel in the circulation was measured over the course of 4 h. Absorbance was similar in wild-type, Gpihbp1−/−, and Angptl4−/−Gpihbp1−/− mice. Interestingly, dietary fat absorption appeared to be reduced in Angptl4−/− single-knockout mice (Fig. 3A). Whether this was because these mice actually absorbed less dietary fat or because clearance from the circulation was not completely inhibited in these mice is not clear. As expected, when wild-type and Angptl4−/− mice were gavaged with radiolabel triolein without tyloxapol treatment, radiolabel was cleared from the plasma rapidly enough that little increase in circulating radiolabel was observed (Fig. 3B, C). However, the absence of tyloxapol did not result in any observable increase in clearance in Gpih
Referência(s)