Mesenchymal stromal cells induce a permissive state in the bone marrow that enhances G-CSF-induced hematopoietic stem cell mobilization in mice
2018; Elsevier BV; Volume: 64; Linguagem: Inglês
10.1016/j.exphem.2018.05.002
ISSN1873-2399
AutoresEvert-Jan F. M. de Kruijf, Rob Zuijderduijn, Marjolein C. Stip, Willem E. Fibbe, Melissa van Pel,
Tópico(s)Extracellular vesicles in disease
Resumo•Administration of MSC induces macrophage depletion and downregulation of niche factors•Co-administration of MSC and G-CSF induces a two-fold increase in HSPC mobilization•Administration of MSC-derived extracellular vesicles recapitulate the effects of MSC Mesenchymal stromal cells (MSCs) support hematopoietic stem cells (HSCs) in vivo and enhance HSC engraftment and hematopoietic recovery upon cotransplantation with HSCs. These data have led to the hypothesis that MSCs may affect the HSC niche, leading to changes in HSC retention and trafficking. We studied the effect of MSC administration on the HSC compartment in the bone marrow (BM) in mice. After injection of MSCs, HSC numbers in the BM were decreased coinciding with an increased cell cycle activity compared with phosphate-buffered saline (PBS)-injected controls. Furthermore, the frequency of macrophages was significantly reduced and niche factors including Cxcl12, Scf, and Vcam were downregulated in endosteal cells. These BM changes are reminiscent of events associated with granulocyte colony-stimulating factor (G-CSF)-induced hematopoietic stem and progenitor cell (HSPC) mobilization. Interestingly, coadministration of MSCs and G-CSF resulted in a twofold increase in peripheral blood HSPC release compared with injection of G-CSF alone, whereas injection of MSCs alone did not induce HSPC mobilization. After intravenous administration, MSCs were only observed in the lungs, suggesting that they exert their effect on the HSC niche through a soluble mediator. Therefore, we tested the hypothesis that MSC-derived extracellular vesicles (EVs) are responsible for the observed changes in the HSC niche. Indeed, administration of EVs resulted in downregulation of Cxcl12, Scf, and Vcam and enhanced G-CSF-induced HSPC mobilization at similar levels as MSCs and G-CSF. Together, these data indicate that MSCs induce a permissive state in the BM, enhancing HSPC mobilization through the release of EVs. Mesenchymal stromal cells (MSCs) support hematopoietic stem cells (HSCs) in vivo and enhance HSC engraftment and hematopoietic recovery upon cotransplantation with HSCs. These data have led to the hypothesis that MSCs may affect the HSC niche, leading to changes in HSC retention and trafficking. We studied the effect of MSC administration on the HSC compartment in the bone marrow (BM) in mice. After injection of MSCs, HSC numbers in the BM were decreased coinciding with an increased cell cycle activity compared with phosphate-buffered saline (PBS)-injected controls. Furthermore, the frequency of macrophages was significantly reduced and niche factors including Cxcl12, Scf, and Vcam were downregulated in endosteal cells. These BM changes are reminiscent of events associated with granulocyte colony-stimulating factor (G-CSF)-induced hematopoietic stem and progenitor cell (HSPC) mobilization. Interestingly, coadministration of MSCs and G-CSF resulted in a twofold increase in peripheral blood HSPC release compared with injection of G-CSF alone, whereas injection of MSCs alone did not induce HSPC mobilization. After intravenous administration, MSCs were only observed in the lungs, suggesting that they exert their effect on the HSC niche through a soluble mediator. Therefore, we tested the hypothesis that MSC-derived extracellular vesicles (EVs) are responsible for the observed changes in the HSC niche. Indeed, administration of EVs resulted in downregulation of Cxcl12, Scf, and Vcam and enhanced G-CSF-induced HSPC mobilization at similar levels as MSCs and G-CSF. Together, these data indicate that MSCs induce a permissive state in the BM, enhancing HSPC mobilization through the release of EVs. Hematopoietic stem cells (HSCs) replenish the peripheral blood (PB) cell pool throughout life. During homeostasis, the vast majority of HSCs reside in specialized niches located in the perivascular area of the trabeculated region of the bone marrow (BM). This HSC microenvironment regulates self-renewal, cell cycle entry, and differentiation of HSCs and consists of a complex network of hematopoietic and nonhematopoietic cells (see previous reviews [1Morrison SJ Scadden DT The bone marrow niche for haematopoietic stem cells.Nature. 2014; 505: 327-334Crossref PubMed Scopus (1459) Google Scholar, 2van Pel M Fibbe WE Schepers K The human and murine hematopoietic stem cell niches: are they comparable?.Ann N Y Acad Sci. 2016; 1370: 55-64Crossref PubMed Scopus (13) Google Scholar]). In the BM, the majority of HSCs are found in close proximity to mesenchymal stromal cells (MSCs) surrounding arterioles and sinusoids [3Kunisaki Y Bruns I Scheiermann C et al.Arteriolar niches maintain haematopoietic stem cell quiescence.Nature. 2013; 502: 637-643Crossref PubMed Scopus (792) Google Scholar, 4Mendez-Ferrer S Michurina TV Ferraro F et al.Mesenchymal and haematopoietic stem cells form a unique bone marrow niche.Nature. 2010; 466: 829-834Crossref PubMed Scopus (2372) Google Scholar, 5Pinho S Lacombe J Hanoun M et al.PDGFRalpha and CD51 mark human nestin+ sphere-forming mesenchymal stem cells capable of hematopoietic progenitor cell expansion.J Exp Med. 2013; 210: 1351-1367Crossref PubMed Scopus (327) Google Scholar, 6Zhou BO Yue R Murphy MM Peyer JG Morrison SJ Leptin-receptor-expressing mesenchymal stromal cells represent the main source of bone formed by adult bone marrow.Cell Stem Cell. 2014; 15: 154-168Abstract Full Text Full Text PDF PubMed Scopus (735) Google Scholar]. MSC-derived CXCL12 and stem cell factor (SCF) are indispensable for HSC maintenance because deletion of either CXCL12 or SCF leads to hematopoietic exhaustion [7Ding L Morrison SJ Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches.Nature. 2013; 495: 231-235Crossref PubMed Scopus (806) Google Scholar, 8Ding L Saunders TL Enikolopov G Morrison SJ Endothelial and perivascular cells maintain haematopoietic stem cells.Nature. 2012; 481: 457-462Crossref PubMed Scopus (1252) Google Scholar, 9Winkler IG Barbier V Wadley R Zannettino A Williams S Levesque JP Positioning of bone marrow hematopoietic and stromal cells relative to blood flow in vivo: Serially reconstituting hematopoietic stem cells reside in distinct non-perfused niches.Blood. 2010; 116: 375-385Crossref PubMed Scopus (186) Google Scholar, 10Greenbaum A Hsu YM Day RB et al.CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance.Nature. 2013; 495: 227-230Crossref PubMed Scopus (865) Google Scholar, 11Oguro H Ding L Morrison SJ SLAM family markers resolve functionally distinct subpopulations of hematopoietic stem cells and multipotent progenitors.Cell Stem Cell. 2013; 13: 102-116Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar]. HSCs are retained in the niche by adhesion molecules, including β1-integrins, interacting with extracellular matrix components and with vascular cell adhesion molecule (VCAM), which is expressed on stromal cells [12Pruijt JF van Kooyk Y Figdor CG Willemze R Fibbe WE Murine hematopoietic progenitor cells with colony-forming or radioprotective capacity lack expression of the beta 2-integrin LFA-1.Blood. 1999; 93: 107-112PubMed Google Scholar]. The endosteal region of the BM contains a population of resident macrophages (osteal macrophages or osteomacs) supporting osteoblast differentiation and mineralization and contributing to the maintenance of HSC niches [13Chang MK Raggatt LJ Alexander KA et al.Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo.J Immunol. 2008; 181: 1232-1244Crossref PubMed Scopus (455) Google Scholar]. Another BM-resident macrophage population, expressing CD169, supports the retention of HSCs by acting on stromal cells in the niche [14Winkler IG Sims NA Pettit AR et al.Bone marrow macrophages maintain hematopoietic stem cell (HSCs) niches and their depletion mobilizes HSCss.Blood. 2010; 116: 4815-4828Crossref PubMed Scopus (575) Google Scholar]. Depletion of osteomacs or CD169+ macrophages results in downregulation of Cxcl12, Vcam, Ang-1, and Scf and results in subsequent hematopoietic stem and progenitor cell (HSPC) mobilization [13Chang MK Raggatt LJ Alexander KA et al.Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo.J Immunol. 2008; 181: 1232-1244Crossref PubMed Scopus (455) Google Scholar, 14Winkler IG Sims NA Pettit AR et al.Bone marrow macrophages maintain hematopoietic stem cell (HSCs) niches and their depletion mobilizes HSCss.Blood. 2010; 116: 4815-4828Crossref PubMed Scopus (575) Google Scholar, 15Chow A Lucas D Hidalgo A et al.Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche.J Exp Med. 2011; 208: 261-271Crossref PubMed Scopus (573) Google Scholar]. Through administration of exogenous cytokines, HSPCs can be induced to leave the niche and migrate toward the PB in a process called mobilization. Granulocyte-colony stimulating factor (G-CSF) is most commonly applied as a mobilizing agent. The administration of G-CSF is accompanied by neutrophil expansion and a proteolytic BM milieu coinciding with decreased levels of the protease inhibitor alpha-1-antitrypsin (AAT) [16Kuiperij HB van Pel M de Rooij KE Hoeben RC Fibbe WE Serpina1 (alpha1-AT) is synthesized in the osteoblastic stem cell niche.Exp Hematol. 2009; 37: 641-647Abstract Full Text Full Text PDF PubMed Scopus (9) Google Scholar, 17Winkler IG Hendy J Coughlin P Horvath A Levesque JP Serine protease inhibitors serpina1 and serpina3 are down-regulated in bone marrow during hematopoietic progenitor mobilization.J Exp Med. 2005; 201: 1077-1088Crossref PubMed Scopus (91) Google Scholar]. Simultaneously with neutrophil expansion, G-CSF administration leads to depletion of macrophages, resulting in decreased expression of Cxcl12, Vcam, and Scf by BM stromal cells and in decreased osteoblast numbers [14Winkler IG Sims NA Pettit AR et al.Bone marrow macrophages maintain hematopoietic stem cell (HSCs) niches and their depletion mobilizes HSCss.Blood. 2010; 116: 4815-4828Crossref PubMed Scopus (575) Google Scholar, 15Chow A Lucas D Hidalgo A et al.Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche.J Exp Med. 2011; 208: 261-271Crossref PubMed Scopus (573) Google Scholar]. Together, these events result in decreased adhesion of HSPCs to their niche and, as a consequence, HSPCs migrate toward the PB. MSCs are a nonhematopoietic population of cells that form fibroblast colony-forming units and have the capacity to differentiate into osteoblasts, adipocytes, and chondrocytes. MSCs can be isolated from the BM, where they are an essential part of the HSC niche [2van Pel M Fibbe WE Schepers K The human and murine hematopoietic stem cell niches: are they comparable?.Ann N Y Acad Sci. 2016; 1370: 55-64Crossref PubMed Scopus (13) Google Scholar]. When cotransplanted with CD34+ umbilical cord blood-derived HSPCs, MSCs enhance both HSC engraftment and hematopoietic recovery [18van der Garde M van Pel M Millan Rivero JE et al.Direct comparison of Wharton's jelly and bone marrow-derived mesenchymal stromal cells to enhance engraftment of cord blood CD34(+) transplants.Stem Cells Dev. 2015; 24: 2649-2659Crossref PubMed Scopus (19) Google Scholar, 19Noort WA Kruisselbrink AB in't Anker PS et al.Mesenchymal stem cells promote engraftment of human umbilical cord blood-derived CD34(+) cells in NOD/SCID mice.Exp Hematol. 2002; 30: 870-878Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. Although the underlying mechanisms are not fully understood, it was suggested that HSC homeostasis is altered indirectly through factors released by the injected MSCs because intravenously injected MSCs could not be detected in the BM after administration [19Noort WA Kruisselbrink AB in't Anker PS et al.Mesenchymal stem cells promote engraftment of human umbilical cord blood-derived CD34(+) cells in NOD/SCID mice.Exp Hematol. 2002; 30: 870-878Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. Given the key role of MSCs in the HSC microenvironment and their effect on HSC engraftment and hematopoietic recovery, we have investigated the effect of MSC administration on the hematopoietic BM compartment. Here, we show that intravenous administration of MSCs results in changes in the BM that are reminiscent of events that occur during G-CSF-induced HSPC mobilization. Furthermore, coinjection of MSCs and G-CSF synergistically enhanced HSPC mobilization compared with G-CSF alone. MSCs retained in the lung exerted their effects on the BM through the secretion of extracellular vesicles (EVs). Administration of EVs alone resulted in downregulation of Cxcl12, Scf, and Vcam and enhanced G-CSF-induced HSPC mobilization at similar levels as MSCs. Together, these data indicate that MSC administration induces a permissive state in the BM through the release of EVs, promoting HSPC mobilization. Eight- to 12-week-old male C57BL/6-Ly5.2 and C57BL/6-Ly5.1 mice were obtained from Charles River Laboratories (Maastricht, The Netherlands). The animals were fed commercial rodent chow and acidified water ad libitum and were maintained in the animal facility of the Leiden University Medical Center (LUMC) under conventional conditions. All experimental protocols were approved by the institutional ethics committee on animal experiments. MSCs were obtained by culturing bone chips in a 75 cm2 flask in MSC medium containing α-minimum essential medium (Life Technologies), 10% fetal calf serum (FCS), penicillin/streptomycin, and L-glutamine. Plastic adherent MSCs were cultured to 95% confluency in a fully humidified atmosphere at 37°C and 5% CO2, harvested using trypsin, and further expanded until sufficient numbers were obtained. MSCs used throughout this study were of passage six to ten. MSCs were administered intravenously in 0.1% bovine serum albumin/PBS (0.1% BSA/PBS) at a dose of 200 × 103 cells per day for 3 consecutive days. Mice injected with 0.1% BSA/PBS served as controls. In indicated experiments, MSCs were cultured in the presence of recombinant murine interferon-gamma (IFN-γ) (20 ng/mL) or recombinant murine tumor necrosis factor-alpha (TNF-α) (20 ng/mL; both R&D Systems, Abingdon, UK) for 7days. Where indicated, MSCs were transduced with a lentiviral vector containing SFFV-DsRed-Firefly luciferase (SFFV-DsR-Fluc) as described previously [20.Perez-Galarza J Carlotti F Rabelink MJ et al.Optimizing reporter constructs for in vivo bioluminescence imaging of interferon-gamma stimulated mesenchymal stromal cells.Exp Hematol. 2014; 42 (e1): 793-803Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar]. Images were acquired and analyzed as described previously [20.Perez-Galarza J Carlotti F Rabelink MJ et al.Optimizing reporter constructs for in vivo bioluminescence imaging of interferon-gamma stimulated mesenchymal stromal cells.Exp Hematol. 2014; 42 (e1): 793-803Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar]. To obtain MSC culture supernatant, MSCs at a confluency of 70–80% were cultured for 1 week in StemSpan (STEMCELL Technologies, Köln, Germany). Subsequently, the medium was harvested, centrifuged to deplete for cell debris, and concentrated using Centriprep YM3 filters (Millipore, Amsterdam, the Netherlands) to obtain an ∼20-fold concentration. In indicated experiments, 200 μL of MSC culture supernatant was administered intraperitoneally twice daily for 3 consecutive days. RAW264.7 cells (gift from A. van Wengen, LUMC) were cultured in RPMI-1640 medium containing 10% FCS, penicillin, streptomycin and L-glutamine. S17 and MS-5 cells (gift from F.J.T. Staal, LUMC) were cultured in MSC medium and MSC medium with 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich, Zwijndrecht, The Netherlands), respectively. In coculture experiments, 35 × 103 stromal cells were cultured in their respective medium for 16hours and then medium was removed and RAW264.7 cells were added in a 1:1 ratio and cultured for 72hours in MSC medium. RAW264.7 cells were either added directly to the stromal cells or cultured in Transwells with a 0.4 µm pore size (Corning Costar). Stromal cells were harvested using Accumax (eBioscience). RAW264.7 cells were depleted using CD45 microbeads (Miltenyi, Leiden, The Netherlands) and MACS separation. Twenty-two to 24hours after the last MSC administration, mice were sacrificed by CO2 asphyxiation. PB was obtained by intracardiac puncture and cell counts were performed on a Sysmex XP-300 counter (Sysmex, Etten-Leur, The Netherlands). PB was centrifuged at 350 g and blood plasma was stored at –20°C. Erythrocytes were lysed using a specific lysis buffer (LUMC Pharmacy, Leiden, The Netherlands) before further analysis. BM and spleen cells were harvested as described previously [21de Kruijf EJ Hagoort H Velders GA Fibbe WE van PM Hematopoietic stem and progenitor cells are differentially mobilized depending on the duration of Flt3-ligand administration.Haematologica. 2010; 95: 1061-1067Crossref PubMed Scopus (15) Google Scholar]. BM extracellular extracts were obtained by flushing femurs with 250 μL of cold PBS. The cell suspension was centrifuged at 350 g for 7 minutes at 4°C. The supernatant was stored at –20°C. To enumerate osteoclasts, 1 × 105 BM cells were seeded in quintuplicate in a 96-well flat-bottomed plate and stained using the tartrate-resistant acid phosphatase (TRAP) staining kit (Sigma-Aldrich) according to the manufacturer's recommendations. All antibodies used are described in Table 1. Cells were analyzed on a FACSCanto II flow cytometer with Diva software (BD Biosciences, Erebodegem, Belgium).Table1Overview of the antibodies used in the studyAntibodyLabelCloneCompanyB220Fitc, PerCP-Cy5.5RA3-6B2BD PharmingenCD3Fitc145-2C11BD PharmingenCD3eFluor450145-2C11eBioscienceCD4FitcGK1.5BD PharmingenCD8Fitc53-6.7BD PharmingenCD11bbiotin, FitcM1/70BD PharmingenCD34Alexa Fluor 647RAM34BD PharmingenCD45.1PE, FITCA20BD PharmingenCD45.2PerCpCy5.5, Fitc104BD PharmingenCD68PerCP-Cy5.5FA-11BioLegendCD115BV421AFS98BioLegendCD117APC-eFluor 7802B8eBioscienceCD117PE2B8BD PharmingenCD135PEA2F10.1BD PharmingenCD169PE3D6.112BioLegendF4/80Fitc, BV510BM8BioLegendGr-1APC, FitcRB6-8C5BD PharmingenLy6CAPC-Cy7AL-21BD PharmingenLy6GAPC1A8BD PharmingenSca-1PerCP-Cy5.5D7eBioscienceMERTKPE-Cy7DS5MMEReBioscienceTER119FitcTER-119BD PharmingenKi67PE-Cy7B56BD PharmingenIsotype for Ki67PE-Cy7IgG1κBD PharmingenStreptavidinPacific Orange-Invitrogen Open table in a new tab 5-Fluorouracil (5-FU, F6627, Sigma-Aldrich) was dissolved in PBS and administered at a concentration of 150mg/kg intraperitoneally. Cell recovery was determined every 2–3days, but individual mice were only bled weekly to avoid excessive stress. A small volume of blood was drawn from the tail vein. Cell counts were performed on a Sysmex XP-300 counter. After lysis of erythrocytes, cells were stained with CD11b-, Ly6G-, BB20-, CD3-, and Ly6C-specific antibodies (Table 1). After obtaining BM cells by flushing the femurs, the same femurs were flushed with PBS and RLT buffer (Qiagen) to obtain cell lysates of endosteal cells. RNA was obtained using the RNeasy mini kit (Qiagen) according to the manufacturer's recommendations and cDNA was generated using Superscript III (Invitrogen). Primer sets used for quantitative real-time polymerase chain reaction (qRT-PCR) experiments are shown in Table 2. qRT-PCR was performed using TaqMan Universal MasterMix (Thermo Fisher) and Universal Probes (Roche) on a StepOnePlus cycler (Thermo Fisher). Relative gene expression was calculated using the comparative threshold cycle (CT) method, with Hprt, Abl, or Gapdh as the endogenous reference genes.Table2Overview of the primer pairs used in the studyGeneForward (5′–3′)Reverse (5′–3′)HPRTGGAGCGGTAGCACCTCCTAACCTGGTTCATCATCGCTAAGAPDHAAGAGGGATGCTGCCCTTATTGTCTACGGGACGAGGAAAABLTGGAGATAACACTCTAAGCATAACTAAAGGTGATGTAGTTGCTTGGGACCCACXCL12CTGTGCCCTTCAGATTGTTGCTCTGCGCCCCTTGTTTAVCAM-1TCTTACCTGTGCGCTGTGACACTGGATCTTCAGGGAATGAGTSCFTCAACATTAGGTCCCGAGAAAACTGCTACTGCTGTCATTCCTAAGAngpt1GGAAGATGGAAGCCTGGATACCAGAGGGATTCCCAAAACIL-7CTGCTGCAGTCCCAGTCATTCAGTGGAGGAATTCCAAAGACSF3RCTCGACCCCATGGATGTTGAGAGACTACATCAGGGCCAAT Open table in a new tab Mice were injected intraperitoneally with 10μg of recombinant human G-CSF (Amgen, Thousand Oaks, California, USA) in 0.2mL of 0.1 % BSA/PBS once a day for 3 consecutive days. Control mice received 0.2mL of 0.1% BSA/PBS. Two hundred microliters of PB was depleted of erythrocytes using a specific lysis buffer (LUMC Pharmacy). Next, the equivalent of 100 μL of PB was cultured in duplo in 3.5cm dishes containing semisolid medium supplemented with recombinant murine GM-CSF (1.25 ng/mL; BD Biosciences), recombinant murine interleukin-3 (IL-3) (25 ng/mL; BD-Biosciences), recombinant human erythropoietin (0.2 units/mL; LUMC Pharmacy), and recombinant human G-CSF (100 ng/mL; Amgen). After 6days of culture, the number of colonies (defined as an aggregate of ≥20 cells) was scored using an inverted light microscope. Recipients were irradiated in Perspex chambers using an Orthovolt (Xstrahl Medical, Walsall, UK). A total dose of 9.5 Gy total body irradiation (TBI) was administered. Four hours after TBI, 750 × 103 PB mononuclear cells were injected via caudal vein injection in 200 μL of 0.1% BSA/PBS. Recombinant murine osteoprotegerin (OPG) was obtained from R&D Systems (Minneapolis, USA), dissolved in PBS, and administered intravenously before G-CSF administration. The OPG concentration was determined using a mouse OPG immunoassay (R&D Systems) according to the manufacturer's recommendations. M-CSF concentrations were assessed using a mouse M-CSF ELISA (R&D Systems). EV-depleted MSC medium was obtained by centrifuging MSC medium at 100,000 g at 4°C for 16hours using a Beckman Coulter Ultracentrifuge. MSCs were cultured for 72hours in EV-depleted medium. Culture supernatant was sequentially centrifuged at 350 g for 10 minutes and at 10,000 g for 30 minutes to discard cell debris. Supernatant was collected and centrifuged for 70 minutes at 100,000 g. The pellet containing EVs was washed in PBS for 70 minutes at 100,000 g and resuspended in PBS. EVs were quantified using a qNano particle analyzer (Izon Science, Oxford, UK). EV preparations had a mean particle diameter of 133.7 ± 3.2nm. Typically, 5.3 × 1010 ± 1.7 × 1010 EVs were isolated per 1 × 106 MSCs after 3days of culture. Where indicated, EVs were stained in diluent C solution for 10 minutes using a PKH26 kit (Sigma-Aldrich). Staining was stopped by adding 1% BSA/PBS. Next, EVs were washed for 70 minutes at 100,000 g and resuspended in PBS. All values are presented as mean with standard error of the mean. All groups were compared using the unpaired t test with Welch's correction when applicable. All statistical calculations were performed using GraphPad Prism software (La Jolla, California, USA). p ≤ 0.05 was considered statistically significant. To investigate the effect of MSC administration on the hematopoietic compartment in the BM, cohorts of C57BL/6 mice received three consecutive daily injections of MSCs. On day 4, mice were sacrificed and BM cells were analyzed. The absolute number of HSCs (defined as Lin–Sca-1+c-KitHI [LSK] CD34–CD135–) was significantly decreased (Figure 1D), whereas the total number of white blood cells (WBCs) per femur and the colony-forming capacity of the BM remained comparable to controls (Figures 1A and 1B). Moreover, there was a trend toward decreased numbers of LSK cells, hematopoietic progenitor cells (HPCs), and MPPs per femur (Figures 1C–1F). To investigate whether the decrease in HSC numbers was due to altered cell cycle activity of HSPCs, the cell cycle status of the hematopoietic cells after MSC administration was assessed. The frequency of LSK cells in the G1 phase of cell cycle was a 3.2-fold increase compared with PBS-treated controls, whereas the frequencies of LSK cells in the G0 and the S/G2/M phase were decreased with 64% and 50.7% of PBS controls (Figure 1G). A similar shift in cell cycle activity was observed for HSCs and HPCs/MPPs (Supplementary Figures E1A and E1B, online only, available at www.exphem.org). The cytoreductive agent 5-FU kills actively cycling cells, including cycling HSPCs, and induces a BM stress response. In the PB, WBCs were decreased within days after 5-FU injection (Figures 1H and 1I). Administration of MSCs for 3 consecutive days followed by 5-FU injection delayed WBC recovery compared with controls receiving PBS and 5-FU. This delay was even more pronounced in the granulocytic compartment (Figures 1H and 1I). Together, these results indicate that administration of MSCs leads to a reduction of the number of LSK cells in the BM and induces HSPCs into the cell cycle. The HSC niche regulates HSC cell cycle entry. Therefore, the observed increase in cell cycle activity of HSPCs after MSC administration may be explained by changes in the niche. Macrophages have been shown to contribute to anchoring HSCs in the niche and their depletion leads to downregulation of HSC retention factors including CXCL12 and VCAM in stromal cells and their depletion induced HSPC mobilization [14Winkler IG Sims NA Pettit AR et al.Bone marrow macrophages maintain hematopoietic stem cell (HSCs) niches and their depletion mobilizes HSCss.Blood. 2010; 116: 4815-4828Crossref PubMed Scopus (575) Google Scholar, 15Chow A Lucas D Hidalgo A et al.Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche.J Exp Med. 2011; 208: 261-271Crossref PubMed Scopus (573) Google Scholar]. In turn, MSCs act on cells of the innate immune system, including macrophages [22Melief SM Schrama E Brugman MH et al.Multipotent stromal cells induce human regulatory T cells through a novel pathway involving skewing of monocytes toward anti-inflammatory macrophages.Stem Cells. 2013; 31: 1980-1991Crossref PubMed Scopus (268) Google Scholar, 23Maggini J Mirkin G Bognanni I et al.Mouse bone marrow-derived mesenchymal stromal cells turn activated macrophages into a regulatory-like profile.PLoS One. 2010; 5: e9252Crossref PubMed Scopus (431) Google Scholar, 24Bernardo ME Fibbe WE Mesenchymal stromal cells: sensors and switchers of inflammation.Cell Stem Cell. 2013; 13: 392-402Abstract Full Text Full Text PDF PubMed Scopus (879) Google Scholar]. For these reasons, we hypothesized that MSCs may alter the HSC niche through macrophages as intermediate cells. Therefore, the presence of osteomacs and CD169+ macrophages was assessed in BM after MSC administration. A significant decrease in osteomacs and CD169+ macrophages was observed compared with PBS-injected controls (Figures 2A–2F). Moreover, osteoclasts, which are macrophages specialized in regulating bone metabolism, were also decreased (p = 0.057; Figure 2G). The decline in osteoclasts upon MSC administration coincided with increased levels of the osteoclast inhibitor OPG in the BM extracellular fluid (p = 0.07), whereas the levels of M-CSF remained unchanged (Supplementary Figures E2A and E2C, online only, available at www.exphem.org). It has been reported that depletion of BM macrophages in vivo results in downregulation of Cxcl12, Vcam, Ang-1, and Scf [13Chang MK Raggatt LJ Alexander KA et al.Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo.J Immunol. 2008; 181: 1232-1244Crossref PubMed Scopus (455) Google Scholar, 14Winkler IG Sims NA Pettit AR et al.Bone marrow macrophages maintain hematopoietic stem cell (HSCs) niches and their depletion mobilizes HSCss.Blood. 2010; 116: 4815-4828Crossref PubMed Scopus (575) Google Scholar, 15Chow A Lucas D Hidalgo A et al.Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche.J Exp Med. 2011; 208: 261-271Crossref PubMed Scopus (573) Google Scholar]. Similarly, after MSC administration, the expression of Cxcl12 and Vcam was decreased significantly in endosteal cells, whereas a modest decrease in Scf expression was observed (Figures 2H–2J). To further study the effect of macrophages on gene expression in stromal cells, in vitro culture experiments were performed in which cells of the immortalized macrophage cell line RAW264.7 were incubated with either S17 or MS-5 stromal cells. Cultures were performed in a Transwell setting to investigate the effect of secreted factors or cell–cell contact. Next, gene expression was assessed. Direct cell–cell contact between RAW264.7 and stromal cells downregulated the expression of Cxcl12, Vcam and Scf significantly compared with S17 and MS-5 cultured in the absence of RAW264.7 cells. Factors secreted by RAW264.7 cells that were cultured in a Transwell only mildly affected the expression of Cxcl12, Vcam, and Scf (Figures 2K–2M). Not only macrophages, but also B lymphocytes, were decreased significantly in the BM and PB after MSC administration (Supplementary Figures E2D–E2F, online only, available at www.exphem.org). This decrease coincided with a significant reduction in IL-7 expression in endosteal cells. Given the crucial role of IL-7 in B lymphopoiesis [25Clark MR Mandal M Ochiai K Singh H Orchestrating B cell lymphopoiesis through interplay of IL-7 receptor and pre-B cell receptor signalling.Nat Rev Immunol. 2014; 14: 69-80Crossref PubMed Scopus (184) Google Scholar], these results suggest that MSC administration may impair B lymphopoiesis in the BM. The depletion of macrophages and the downregulation of C
Referência(s)