Portal de Periódicos da CAPES

Calcium and zinc tune autoinflammatory Toll-like receptor 4 signaling by S100A12

2018; Elsevier BV; Volume: 142; Issue: 4 Linguagem: Inglês

10.1016/j.jaci.2018.06.027

1097-6825

Christoph Kessel, Sabrina Fuehner, Jana Zell, Bastian Zimmermann, Stephan Drewianka, S. Brockmeyer, Dirk Holzinger, Claas Hinze, Helmut Wittkowski, Dirk Foell,

Immune Response and Inflammation

Autoinflammatory diseases (AIDs) are characterized by recurrent episodes of systemic inflammation in absence of infection or autoimmunity.1Kastner D.L. Aksentijevich I. Goldbach-Mansky R. Autoinflammatory disease reloaded: a clinical perspective.Cell. 2010; 140: 784-790Abstract Full Text Full Text PDF PubMed Scopus (334) Google Scholar The granulocytic protein S100A12 as well as closely related myeloid-related S100A8/A9 are highly overexpressed in some of these disorders and their serum titers can indicate disease flares or response to therapy.E1Foell D. Wulffraat N. Wedderburn L.R. Wittkowski H. Frosch M. Gerss J. et al.Methotrexate withdrawal at 6 vs 12 months in juvenile idiopathic arthritis in remission: a randomized clinical trial.JAMA. 2010; 303: 1266-1273Crossref PubMed Scopus (192) Google Scholar, E2Wittkowski H. Frosch M. Wulffraat N. Goldbach-Mansky R. Kallinich T. Kuemmerle-Deschner J. et al.S100A12 is a novel molecular marker differentiating systemic-onset juvenile idiopathic arthritis from other causes of fever of unknown origin.Arthritis Rheum. 2008; 58: 3924-3931Crossref PubMed Scopus (121) Google Scholar, E3Wittkowski H. Kuemmerle-Deschner J.B. Austermann J. Holzinger D. Goldbach-Mansky R. Gramlich K. et al.MRP8 and MRP14, phagocyte-specific danger signals, are sensitive biomarkers of disease activity in cryopyrin-associated periodic syndromes.Ann Rheum Dis. 2011; 70: 2075-2081Crossref PubMed Scopus (49) Google Scholar As reason for their value as biomarkers it is thought that these proteins by themselves induce sterile inflammation.E4Frosch M. Ahlmann M. Vogl T. Wittkowski H. Wulffraat N. Foell D. et al.The myeloid-related proteins 8 and 14 complex, a novel ligand of toll-like receptor 4, and interleukin-1beta form a positive feedback mechanism in systemic-onset juvenile idiopathic arthritis.Arthritis Rheum. 2009; 60: 883-891Crossref PubMed Scopus (126) Google Scholar, E5Kessel C. Lippitz K. Weinhage T. Hinze C. Wittkowski H. Holzinger D. et al.Pro-inflammatory cytokine environments can drive IL-17 over-expression by gammadeltaT cells in systemic juvenile idiopathic arthritis.Arthritis Rheumatol. 2017; 69: 1480-1494Crossref PubMed Scopus (38) Google Scholar, 2Kessel C. Holzinger D. Foell D. Phagocyte-derived S100 proteins in autoinflammation: putative role in pathogenesis and usefulness as biomarkers.Clin Immunol. 2013; 147: 229-241Crossref PubMed Scopus (102) Google Scholar This can be triggered by damage-associated molecular patterns (DAMPs, "alarmins"), which are recognized by innate immune cells via sensors such as Toll-like receptor 4 (TLR4).3Liston A. Masters S.L. Homeostasis-altering molecular processes as mechanisms of inflammasome activation.Nat Rev Immunol. 2017; 17: 208-214Crossref PubMed Scopus (170) Google Scholar S100A8/A9 and S100A12 can operate as DAMPs, yet clarifying their TLR4-interaction mode may provide better understanding of their role in AID pathology.E6Vogl T. Tenbrock K. Ludwig S. Leukert N. Ehrhardt C. van Zoelen M.A. et al.Mrp8 and Mrp14 are endogenous activators of Toll-like receptor 4, promoting lethal, endotoxin-induced shock.Nat Med. 2007; 13: 1042-1049Crossref PubMed Scopus (924) Google Scholar, E7Vogl T. Stratis A. Wixler V. Voller T. Thurainayagam S. Jorch S.K. et al.Autoinhibitory regulation of S100A8/S100A9 alarmin activity locally restricts sterile inflammation.J Clin Invest. 2018; 128: 1852-1866Crossref PubMed Scopus (63) Google Scholar, 2Kessel C. Holzinger D. Foell D. Phagocyte-derived S100 proteins in autoinflammation: putative role in pathogenesis and usefulness as biomarkers.Clin Immunol. 2013; 147: 229-241Crossref PubMed Scopus (102) Google Scholar, 4Foell D. Wittkowski H. Kessel C. Luken A. Weinhage T. Varga G. et al.Proinflammatory S100A12 can activate human monocytes via Toll-like receptor 4.Am J Respir Crit Care Med. 2013; 187: 1324-1334Crossref PubMed Scopus (42) Google Scholar In this context, it is remarkable that the S100A12 structure is significantly impacted by Ca2+ binding and Zn2+ binding.5Moroz O.V. Burkitt W. Wittkowski H. He W. Ianoul A. Novitskaya V. et al.Both Ca2+ and Zn2+ are essential for S100A12 protein oligomerization and function.BMC Biochem. 2009; 10: 11Crossref PubMed Scopus (91) Google Scholar In AIDs, Zn2+ serum and plasma levels are reported to remain at or in part massively exceed healthy control levels, which is in contrast to inflammation resulting from infection.E8Besecker B.Y. Exline M.C. Hollyfield J. Phillips G. Disilvestro R.A. Wewers M.D. et al.A comparison of zinc metabolism, inflammation, and disease severity in critically ill infected and noninfected adults early after intensive care unit admission.Am J Clin Nutr. 2011; 93: 1356-1364Crossref PubMed Scopus (117) Google Scholar, E9Gaetke L.M. McClain C.J. Talwalkar R.T. Shedlofsky S.I. Effects of endotoxin on zinc metabolism in human volunteers.Am J Physiol. 1997; 272: E952-E956PubMed Google Scholar, 6Holzinger D. Fassl S.K. de Jager W. Lohse P. Rohrig U.F. Gattorno M. et al.Single amino acid charge switch defines clinically distinct proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1)-associated inflammatory diseases.J Allergy Clin Immunol. 2015; 136: 1337-1345Abstract Full Text Full Text PDF PubMed Google Scholar We therefore aimed to investigate the relevance of Zn2+ and Ca2+ in tuning the TLR4-dependent DAMP function of S100A12 in autoinflammation. Initially, we observed S100A12 to strongly bind human TLR4 (hTLR4)/myeloid differentiation protein-2 (MD2) when in buffers containing Zn2+, regardless of whether S100A12 was sensor-chip immobilized in buffer spiked with just Ca2+ (Fig 1, A) or both Ca2+ and Zn2+ (Fig 1, B). Latter conditions rendered S100A12 a high-affinity TLR4 ligand (KD = 0.2 ± 0.06 nM; Fig 1, C). Only buffer or just Ca2+ established no S100A12 binding to TLR4/MD2. Similarly, addition of the Zn2+>Ca2+-chelator EDTA abrogated S100A12 binding to TLR4/MD2 (Fig 1, A and B). Next, on the basis of amino acid sequence of ion-binding incapable S100A10 (Fig 1, D), we substituted one Zn2+-coordinating residue (D25; Fig 1, E) or residues constituting the protein's primary Ca2+-binding site by alanine (N63E72; Fig 1, F). In kinetic stimulation experiments of primary human monocytes with these mutants, we observed strong reduction of the proinflammatory as well as IFN-β–related cyto-/chemokine secretion profile compared with LPS-free wild-type S100A12 or LPS stimulations (Fig 1, G and H; see Fig E1, A and B, in this article's Online Repository at www.jacionline.org). Because recently Ca2+ binding to S100A12 has been demonstrated to tune the protein's Zn2+ chelating,7Cunden L.S. Gaillard A. Nolan E.M. Calcium ions tune the zinc-sequestering properties and antimicrobial activity of human S100A12.Chem Sci. 2016; 7: 1338-1348Crossref PubMed Google Scholar our monocyte stimulation and surface plasmon resonance data collectively suggest disturbed Zn2+ sequestering to impair both TLR4 binding and signaling by S100A12. Importantly, we observed both mutants to impair Ca2+- and Zn2+-induced oligomerization into defined tetrameric and hexameric quarternary structures as observed with wild-type S100A12 (Fig 1, I). Furthermore, we generated defined S100A12 oligomers fixed by chemical crosslinking and separated by size exclusion chromatography (Fig E1, C and D). In stimulation experiments using hTLR4/CD14/MD2-expressing 293 cells (Fig 1, J) as well as primary human monocytes (Fig 1, K and L; Fig E2, A, B and D), only hexameric S100A12 was able to induce Il8 reporter gene (Fig 1, J), monocytic TNF-α release (Fig 1, K and L), or gene (see Fig E2, A and B, in this article's Online Repository at www.jacionline.org) expression, respectively. Although qualitative TLR4/MD2-binding data suggest some binding of tetrameric S100A12 (Fig E2, C), neither dimeric nor tetrameric protein reduced hexamer-induced monocytic TNF-α release (Fig E2, D). However, TNF-α expression was efficiently impaired by blockade of TLR4 and CD14 but not MD2 (Fig 1, L). Similarly, MD2 independence of S100A12 signaling has been suggested by a previous study investigating an MD2-specific peptide inhibitor.8Yang H. Wang H. Ju Z. Ragab A.A. Lundback P. Long W. et al.MD-2 is required for disulfide HMGB1-dependent TLR4 signaling.J Exp Med. 2015; 212: 5-14Crossref PubMed Scopus (186) Google Scholar To better understand the physiological dynamics of S100A12 oligomerization, we treated recombinant S100A12 protein with different Ca2+ and Zn2+ concentration ranges (Fig 2, A and B; see Fig E3, A and B, in this article's Online Repository at www.jacionline.org). These experiments revealed assembly of the protein's hexameric quarternary structure to require simultaneous presence of Ca2+ in millimolar and Zn2+ in greater than or equal to 20 μM ranges (Fig 2, B), whereas oligomer stability was rather affected by selective Ca2+ chelating but not Zn2+ chelating (Fig E3, C-F). We further analyzed S100A12 oligomerization in human granulocytes (Fig 2, C and D) as well as serum (Fig 2, E). Immunoprecipitation of chemically crosslinked S100A12 from cell lysates of resting (Fig 2, C) or phorbol 12-myristate 13-acetate– and LPS-treated human granulocytes (Fig 2, D) revealed cells to predominantly contain S100A12 in its dimeric complex form. In contrast, S100A12 isolated from human serum following bis(sulfosuccinimidyl)substrate treatment arranges into its hexameric quarternary structure (Fig 2, E). Mean serum Zn2+ levels in S100-prone AIDs such as systemic juvenile idiopathic arthritis (sJIA), familial Mediterranean fever (FMF), or pyogenic arthritis, pyoderma gangrenosum and acne syndrome are reported to range from 12 to 50 μM.6Holzinger D. Fassl S.K. de Jager W. Lohse P. Rohrig U.F. Gattorno M. et al.Single amino acid charge switch defines clinically distinct proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1)-associated inflammatory diseases.J Allergy Clin Immunol. 2015; 136: 1337-1345Abstract Full Text Full Text PDF PubMed Google Scholar According to our ion titration data, such environments should particularly facilitate S100A12 hexamerization. According to separation by SEC, chemically crosslinked S100A12 isolated from sera of patients with FMF, sJIA, or pyogenic arthritis, pyoderma gangrenosum and acne syndrome eluted at similar volumes as chemically crosslinked recombinant S100A12 hexamers (Fig 2, F). Although S100A12 in healthy donor serum remained below detection limits, when spiked with recombinant wild-type protein, S100A12 oligomers predominantly eluted in volumes between tetrameric and hexameric S100A12 (Fig 2, F). Furthermore, we isolated native S100A12 oligomers for cell stimulations from proline-serine-threonine phosphatase-interacting protein 1–associated myeloid-related proteinemia inflammatory syndrome (PAMI) patient's sera.6Holzinger D. Fassl S.K. de Jager W. Lohse P. Rohrig U.F. Gattorno M. et al.Single amino acid charge switch defines clinically distinct proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1)-associated inflammatory diseases.J Allergy Clin Immunol. 2015; 136: 1337-1345Abstract Full Text Full Text PDF PubMed Google Scholar Immunoblot data confirmed the S100A12 oligomer distribution according to SEC (Fig 2, G) and preparations of the individual native S100A12 oligomers revealed no contaminating S100A8/A9 (see Fig E4, A, in this article's Online Repository at www.jacionline.org). Native S100A12 hexamers and tetramers could be used at equal concentration for stimulation of THP-1 cells and this demonstrated native hexamers to induce pronounced TNF-α release compared with tetrameric protein (Fig 2, H). Finally, in whole blood stimulations of healthy donors compared with patients with sJIA and FMF (see Table E1 in this article's Online Repository at www.jacionline.org), we observed wild-type S100A12 but not the hexamerization-incapable N63E72 mutant to induce IL-1β and particularly IL-18 expression, while LPS predominantly triggered TNF-α and IL-6 release (Fig 2, I, and Fig E4, B). Collectively, we now postulate the extracellular Ca2+ and Zn2+ ion environment to serve as molecular switch, which renders S100A12 from a cell-intrinsic noninflammatory protein into a proinflammatory alarmin upon its release. In AIDs, available ions together with high levels of S100A12 following spontaneous hypersecretion9Gohar F. Orak B. Kallinich T. Jeske M. Lieber M. von Bernuth H. et al.Secretory activity of neutrophils correlates with genotype in familial Mediterranean fever.Arthritis Rheumatol. 2016; 68: 3010-3022Crossref PubMed Scopus (16) Google Scholar may generate a sterile inflammatory environment, triggering disease activity. Interestingly, recent data suggest a contrary mechanism for S100A8/A9.E7Vogl T. Stratis A. Wixler V. Voller T. Thurainayagam S. Jorch S.K. et al.Autoinhibitory regulation of S100A8/S100A9 alarmin activity locally restricts sterile inflammation.J Clin Invest. 2018; 128: 1852-1866Crossref PubMed Scopus (63) Google Scholar With respect to our data, investigating potential gain-of-function mutations promoting S100A12 oligomerization in AIDs may be conceivable because to our knowledge there are currently no published data in this context. Finally, our data suggest that targeted blockade of hexameric S100A12 could pose an interesting therapeutic option. Similar to paralleling strategies regarding HMGB1,8Yang H. Wang H. Ju Z. Ragab A.A. Lundback P. Long W. et al.MD-2 is required for disulfide HMGB1-dependent TLR4 signaling.J Exp Med. 2015; 212: 5-14Crossref PubMed Scopus (186) Google Scholar this may allow elimination of an endogenous TLR4 ligand while not affecting the protective, endotoxin-sensing function of the receptor. Primary human granulocytes or monocytes were isolated from healthy donor buffy coats by dextran sedimentation or density centrifugation, respectively, or isolated from fresh healthy donor whole blood (EasySep direct human monocyte isolation kit, Stemcell Technologies, Cologne, Germany). All patients' serum samples were collected at the University Children's Hospital, Muenster. All patients or parents provided written informed consent. The study was approved by the local ethics committee. Recombinant human S100A12 (wild-type S100A12 [wtS100A12]) was expressed in Escherichia coli as described earlier.E10Foell D. Wittkowski H. Kessel C. Luken A. Weinhage T. Varga G. et al.Proinflammatory S100A12 can activate human monocytes via Toll-like receptor 4.Am J Respir Crit Care Med. 2013; 187: 1324-1334Crossref PubMed Scopus (79) Google Scholar Cleared protein solution from lyzed bacterial pellets was dialyzed against 20 mM Tris-HCl, pH 8.5, 1 mM EDTA, 1 mM ethylene glycol tetraacetic acid (EGTA) (AIEX buffer A), filtered (0.45 μM), and loaded onto an anion-exchange column (Q-Sepharose fast flow, CV = 80 mL; GE Healthcare, Uppsala, Sweden) equilibrated with AIEX buffer A. Proteins were eluted by a 160-mL linear gradient from 0% to 100% high-salt buffer (20 mM Tris-HCl, pH 8.5, 1 mM EDTA, 1 mM EGTA, 1 mol NaCl) with a flow rate of 1 mL/min. Human S100A12-containing fractions was pooled, dialyzed against 20 mM Tris-HCl, 140 mM NaCl, and 25 mM CaCl2, pH 7.5 (hydrophobic interaction chromatography [HIC] buffer A), filtered, and subjected to a buffer A–equilibrated phenyl sepharose column (Phenyl Sepharose High Performance, CV = 120 mL, GE Healthcare). Protein was eluted (20 mM Tris-HCl, 140 mM NaCl, 50 mM EDTA, pH 7.0), respective fractions were pooled, analyzed by SDS-PAGE, and dialyzed against HBS buffer. Protein solutions were concentrated to 1 mg/mL protein concentration (Amicon Ultra centrifugal filter units, MWCO 3 kDa, Merck Millipore, Darmstadt, Germany). Eventual remnant endotoxin contamination was quantified by EndoLISA endotoxin test (Hyglos, Bernried, Germany; detection range, 0.05-50 EU/mL) according to the manufacturer's recommendations. If not tested completely LPS-free, remnant endotoxin was removed (EndoTRAP red, Hyglos) and efficient LPS depletion was tested by EndoLISA. S100A12-D25A and S100A12-N63AE72A mutants were generated by site-directed mutagenesis according to the manufacturer's instructions (QuickChange II, Agilent Technologies, Santa Clara, Calif; D25A forward: GGAAGGGGCATTTTGCCACCCTCTCTAAGG, D25A reverse: CCTTAGAGAGGGTGGCAAAATGCCCCTTCC, N63A forward: CCAAGGCCTGGATGCTGCTCAAGATGAACAGGTCG, N63A reverse: CGACCTGTTCATCTTGAGCAGCATCCAGGCCTTGG, E72A forward: GAACAGGTCGACTTTCAAGCATTCATATCCCTGGTAGC, E72A reverse: GCTACCAGGGATATGAATGCTTGAAAGTCGACCTGTTC) and expressed in E coli. Anion-exchange chromatography of cytosolic protein was performed as described above. S100A12-D25A HIC was performed in buffer A containing 10 mM CaCl2, whereas S100A12-N63AE72A required HIC in a decreasing salt concentration gradient (1.5-0 mol (NH4)2SO4) and size exclusion chromatography (SEC; HiLoad26/600 Superdex, GE Healthcare). Endotoxin quantification, and eventually required complete removal, was performed as described above. For preparation of defined S100A12 oligomers, LPS-free wtS100A12 generated as described above was treated with 25 mM CaCl2 and 1 mM ZnCl2 (hexamer) or 5 mM CaCl2 (dimer, tetramer) in HBS. Proteins were separated by SEC (HiLoad26/600 Superdex, GE Healthcare) and concentrated (Amicon centrifugal filters, MWCO 3 KDa, Merck Millipore). Proteins were analyzed by SDS-PAGE followed by Coomassie brilliant blue staining. Human wtS100A12 protein was covalently immobilized by amine coupling in low density (∼100 RU) to a CM5 sensor chip in buffer containing either 10 mM acetate, pH 5.0, with 1 mM CaCl2 ± 50 μM ZnCl2. Binding of varying concentrations (391 pM-100 nM) of TLR4/MD2 complex protein (R&D Systems, Minneapolis, Minn) was monitored in running buffer containing Ca2+ and Zn2+ (10 mM HEPES, pH 7.4, 150 mM NaCl, 0.05% Tween 20, 1 mM CaCl2, 50 μM ZnCl2, 30 μM EDTA) at a flow rate of 30 μL/min at 25°C on a Biacore T200 instrument (GE Healthcare). All binding curves were double referenced using an activated and deactivated negative control surface and blank buffer injections. Binding of 25 nM TLR4/MD2 was monitored using varying Ca2+/Zn2+ conditions in running buffer as indicated. Recombinant human TLR4/MD2 complex (2.5 μg/mL, R&D Systems) was immobilized on Nunc MaxiSorp ELISA plates (1 hour, 37°C). Plates were washed and blocked (1% BSA) and incubated with S100A12 oligomers in concentrations as indicated (1 hour, room temperature [RT]). Oligomer binding to TLR4/MD2 was detected by biotinylated anti-S100A12 mAb (1 μg/mL, in-house, 1 hour, RT) followed by horseradish peroxidase (HRP)-conjugated streptavidin (1 hour, RT, Thermo Fisher) and TMB substrate (20 minutes, RT, BD Bioscience, Heidelberg, Germany). The reaction was stopped by addition of sulfuric acid (0.5 mol) and plates were read at 450 nm. Human embryonic kidney cells stably coexpressing human TLR4, CD14, and MD2 (Invivogen, Toulouse, France) were cultured according to the manufacturer's recommendations. Cells grown to 80% confluency were stimulated with rS100A12 oligomers or LPS in concentrations as indicated (4 hours, 5% CO2, 37°C). Cells were harvested for mRNA isolation and Il8 reporter gene expression by quantitative RT-PCR. THP-1 cells were cultured according to the distributor's recommendations (ATCC). To increase TLR4 expression, cells were treated with 10 μM phorbol 12-myristate 13-acetate (PMA; Sigma Aldrich, Munich, Germany). After 48 hours, adherent cells were washed with PBS and cultured in fresh growth medium without PMA for an additional 72 hours. Cells were stimulated in fresh growth medium with native S100A12 oligomers or LPS (4 hours, 5% CO2, 37°C). Following stimulations, supernatants were collected for analysis of TNF-α secretion (Human TNF ELISA Set, BD OptEIA, BD Bioscience) according to the manufacturer's instructions. Primary human monocytes isolated from healthy donor whole blood were stimulated with wild-type D25A-S100A12, N63AE72A-S100A12, or LPS for 4, 8, and 18 hours (3 × 105 cells/mL, 200 μL/well, 5% CO2, 37°C) and were treated with 5 mM ATP (30 minutes, 5% CO2, 37°C) before harvest of respective culture supernatants for cytokine expression analysis. Monocytes isolated from healthy donor buffy coats were stimulated with S100A12 oligomers, LPS, or Poly I:C (Invivogen) as indicated (2 × 106 cells/mL, 1500 μL/well, 4 hours, 5% CO2, 37°C). In some experiments, TLR4-, CD14-, or MD2-blocking antibodies (anti-hTLR4 IgG, anti-hCD14 IgA, anti-MD2 IgG; all from Invivogen, 5 μg/mL) were used as indicated. Following stimulations, culture supernatants were collected for analysis of TNF-α release by ELISA as described above. Patients' and healthy controls' fresh heparinized whole blood was treated (4 hours, 5% CO2, 37°C) with recombinant N63E72- or wtS100A12 (both 5, 10, 20 μg/mL) or LPS (10, 100, 1000 pg/mL). Following stimulation, samples were centrifuged (1500rpm, 15 minutes, RT) and the serum fraction was transferred to fresh tubes and stored at −20°C until subjected to bead array assay. Quantitative real-time-PCRs were performed on a BioRad CFX 384 Real-Time System (Biorad, Hercules, Calif) using KAPA SYBR Fast qPCR Kits (Peqlab, Erlangen, Germany) according to the manufacturer's instructions. Il1b: ATGATGGCTTATTACAGTGGCAA, GTCGGAGATTCGTAGCTGGA); Il6: ACTCACCTCTTCAGAACGAATTG, CCATCTTTGGAAGGTTCAGGTTG; Il8: ACTGAGAGTGATTGAGAGTGGAC, AACCCTCTGCACCCAGTTTTC; Cxcl10: AGACATCTCTTCTCACCCTTC, GGAACCTCCAGTCTCAGCACCA; Ifnb: GACGCCGCATTGACCATCTA, CCTTAGGATTTCCACTCTGACT. The relative expression was normalized as 2−ΔCt specific gene/2−ΔCt mean (housekeeping genes), using glyceraldehyde phosphate dehydrogenase and ribosomal protein L13a as endogenous housekeeping control genes and calculated as n-fold in reference to gene expression by untreated cells. Supernatants of time kinetic monocyte stimulation experiments and whole blood stimulations were analyzed for indicated cyto-/chemokine expression by bead array assay (ProcartaPlex, eBioscience, San Diego, Calif) according to the manufacturer's instructions. Data acquisition was performed on a MAGPIX instrument (Merck Millipore) using xPONENT v4.2 software (Luminex, Austin, Tex). Data were analyzed by ProcartaPlex Analyst software (v1.0, eBioscience, Waltham, Mass). For intracellular crosslinking, freshly isolated human granulocytes with or without stimulation (1 hour, 10 nM PMA or 1 ng/mL LPS) were treated with 5 mM dithiobis(succinimidyl propionate) (Thermo Fisher, Waltham, Mass). Cells were harvested and lyzed in mammalian protein extraction buffer (Thermofisher Scientific, 2 × 106/100 μL) according to the manufacturer's instructions. Cell lysates were mixed with bead-coupled (protein G, Thermo Fisher) anti-S100A12 mAb (produced in-house) and mAb-bound protein was eluted from washed beads (glycine HCl, pH 2.7). Eluted S100A12 oligomers were separated by 4% to 20% Mini-Protean TGX gels (Biorad, Munich, Germany) and analyzed by Western blot (biotinylated anti-S100A12 mAb produced in-house [1 μg/mL] followed by streptavidin-HRP [Thermo Fisher, 0.01 μg/mL]). Patients' or healthy donor serum was treated with 5 mM bis(sulfosuccinimidyl)suberate (BS3, Thermo Fisher) and S100A12 oligomers were isolated from serum samples by S100A12 pull-down as described above. Eluted S100A12 was analyzed by Western blot (described above) or applied to SEC (HiLoad26/600 Superdex, GE Healthcare). SEC fractions of S100A12 oligomers isolated from Proline-serine-threonine phosphatase-interacting protein 1–associated myeloid-related proteinemia inflammatory syndromeE11Holzinger D. Fassl S.K. de Jager W. Lohse P. Rohrig U.F. Gattorno M. et al.Single amino acid charge switch defines clinically distinct proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1)-associated inflammatory diseases.J Allergy Clin Immunol. 2015; 136: 1337-1345Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar patients' serum were further analyzed by Coomassie brilliant blue–stained PAGE and Western blot for S100A12 (described above) or S100A8/A9 (biotinylated anti-S100A8 [1 μg/mL, Dianova, Hamburg, Germany], biotinylated anti-S100A9 [1 μg/mL, BMA Biomedicals, Augst, Switzerland] followed by streptavidin-HRP [Thermo Fisher, 0.01 μg/mL]). For ion titration experiments, wild-type D25A-S100A12 or N63AE72A-S100A12 was treated for 30 minutes with respective ion donors (CaCl2, ZnCl2) in concentrations covering possible intracellular (Ca2+: 0.1-0.2 μME12Bruzzone S. Moreschi I. Guida L. Usai C. Zocchi E. De Flora A. Extracellular NAD+ regulates intracellular calcium levels and induces activation of human granulocytes.Biochem J. 2006; 393: 697-704Crossref PubMed Scopus (52) Google Scholar; Zn2+: 0.2-0.4 nME13Dubben S. Honscheid A. Winkler K. Rink L. Haase H. Cellular zinc homeostasis is a regulator in monocyte differentiation of HL-60 cells by 1 alpha,25-dihydroxyvitamin D3.J Leukoc Biol. 2010; 87: 833-844Crossref PubMed Scopus (54) Google Scholar) or extracellular ranges (Ca2+: 1-3 mME14Bowers Jr., G.N. Brassard C. Sena S.F. Measurement of ionized calcium in serum with ion-selective electrodes: a mature technology that can meet the daily service needs.Clin Chem. 1986; 32: 1437-1447PubMed Google Scholar; Zn2+: 10-50 μME15De Leon-Rodriguez L. Lubag Jr., A.J. Sherry A.D. Imaging free zinc levels in vivo–what can be learned?.Inorganica Chim Acta. 2012; 393: 12-23Crossref PubMed Scopus (39) Google Scholar), followed by 5 mM BS3 (Thermo Fisher). Proteins were analyzed by SDS-PAGE followed by Coomassie brilliant blue staining. For chelator experiments, wtS100A12 was incubated with 1.8 mM CaCl2 and 50 μM ZnCl2 for 30 minutes at RT before treatment with either N,N,N',N'-tetrakis(2-pyridylmethyl)ethane-1,2-diamine or EGTA at indicated concentrations (30 minutes, RT). S100A12 oligomers were fixed by BS3 treatment as described above and proteins were analyzed by SDS-PAGE followed by Coomassie brilliant blue staining. Alternatively, 1.8 mM CaCl2 and 50 μM ZnCl2 were treated with different concentrations of either N,N,N',N'-tetrakis(2-pyridylmethyl)ethane-1,2-diamine or EGTA before addition of wtS100A12. Oligomers were fixed by BS3 treatment and were separated by PAGE followed by Coomassie brilliant blue staining. Data were analyzed by Graphpad Prism software (version 6.0 for Mac OS X, Graphpad Software, La Jolla, Calif) as indicated in respective figure legends. Ana, Anakinra; Cana, canakinumab; Col, colchicine; comp. het., compound heterozygous; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; HC, healthy control; hom., homozygous; n.a., not applicable; n.d., not determined; Pred, prednisolone; SAA, serum amyloid A; sIL2R, soluble interleukin 2 receptor.