Functional analysis of Fanconi anemia mutations in China
2018; Elsevier BV; Volume: 66; Linguagem: Inglês
10.1016/j.exphem.2018.07.003
ISSN1873-2399
AutoresNiu Li, Lixia Ding, Benshang Li, Jian Wang, Alan D. D’Andrea, Jing Chen,
Tópico(s)BRCA gene mutations in cancer
Resumo•Multiple molecular diagnostic tools were used for Fanconi anemia (FA) diagnosis.•We present a convenient functional study system to determine the pathogenicity of the variants.•This is the largest Chinese FA cohort study the variant spectrum.•We developed a comprehensive workflow to overcome the lack of cytogenetic analysis. Fanconi anemia (FA) is a rare recessive disease characterized by progressive bone marrow failure, congenital abnormalities, and increased incidence of cancers. To date, mutations in 22 genes can cause FA or an FA-like phenotype. In China, in addition to clinical information, FA diagnosis primarily relies on genetic sequencing because the chromosome breakage test is rarely performed. Here, we employed multiple genetic diagnostic tools (DNA sequencing, multiplex ligation-dependent probe amplification, and chromosome microarray) and a variant-based functional assay platform to investigate the genetic cause in 25 Chinese suspected FA patients. A total of 45 distinct candidate variants were detected in six FA genes (FA-A, FA-B, FA-C, FA-D2, FA-G, and FA-J), of which 36 were novel. Eight missense variants and one indel variant were unable to restore FANCD2 mono-ubiquitination and mitomycin C resistance in a panel of FA indicator cell lines, indicating that these mutations are deleterious. Three missense variants (FANCA-L424V, FANCC-E273K, and FANCG-A153G) were harmless. Finally, 23 patients were molecularly diagnosed with FA, consistent with their clinical phenotype. In the FA-A subgroup, large deletions accounted for 14% of the disease-causing variants. We have established a comprehensive molecular diagnostic workflow for Chinese FA patients that can substitute for standard FA cytogenetic analysis. Fanconi anemia (FA) is a rare recessive disease characterized by progressive bone marrow failure, congenital abnormalities, and increased incidence of cancers. To date, mutations in 22 genes can cause FA or an FA-like phenotype. In China, in addition to clinical information, FA diagnosis primarily relies on genetic sequencing because the chromosome breakage test is rarely performed. Here, we employed multiple genetic diagnostic tools (DNA sequencing, multiplex ligation-dependent probe amplification, and chromosome microarray) and a variant-based functional assay platform to investigate the genetic cause in 25 Chinese suspected FA patients. A total of 45 distinct candidate variants were detected in six FA genes (FA-A, FA-B, FA-C, FA-D2, FA-G, and FA-J), of which 36 were novel. Eight missense variants and one indel variant were unable to restore FANCD2 mono-ubiquitination and mitomycin C resistance in a panel of FA indicator cell lines, indicating that these mutations are deleterious. Three missense variants (FANCA-L424V, FANCC-E273K, and FANCG-A153G) were harmless. Finally, 23 patients were molecularly diagnosed with FA, consistent with their clinical phenotype. In the FA-A subgroup, large deletions accounted for 14% of the disease-causing variants. We have established a comprehensive molecular diagnostic workflow for Chinese FA patients that can substitute for standard FA cytogenetic analysis. Fanconi anemia (FA) is a genetically and phenotypically heterogeneous condition characterized by progressive bone marrow failure (BMF) during childhood, congenital abnormalities, and increased cancer susceptibility. FA is a rare disease with an estimated incidence of one to five in 1,000,000 live births [1D'Andrea AD The Fanconi anemia and breast cancer susceptibility pathways.N Engl J Med. 2010; 362: 1909-1919Crossref PubMed Scopus (261) Google Scholar, 2Kottemann MC Smogorzewska A Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.Nature. 2013; 493: 356-363Crossref PubMed Scopus (420) Google Scholar]. To date, 22 FANC genes have been identified, including 18 well-known bona fide FA genes (FANC-A, B, C, D1, D2, E, F, G, I, J, L, N, P, Q, T, U, V, and W) and four FA-like genes (FANC-M, O, R, and S) [3Ceccaldi R Sarangi P D'Andrea AD The Fanconi anaemia pathway: New players and new functions.Nat Rev Mol Cell Biol. 2016; 17: 337-349Crossref PubMed Scopus (367) Google Scholar, 4Bogliolo M Surrallés J Fanconi anemia: A model disease for studies on human genetics and advanced therapeutics.Curr Opin Genet Dev. 2015; 33: 32-40Crossref PubMed Scopus (128) Google Scholar, 5Park JY Virts EL Jankowska A et al.Complementation of hypersensitivity to DNA interstrand crosslinking agents demonstrates that XRCC2 is a Fanconi anaemia gene.J Med Genet. 2016; 53: 672-680Crossref PubMed Scopus (58) Google Scholar, 6Bluteau D Masliah-Planchon J Clairmont C et al.Biallelic inactivation of REV7 is associated with Fanconi anemia.J Clin Invest. 2016; 126: 3580-3584Crossref PubMed Scopus (91) Google Scholar, 7Knies K Inano S Ramírez MJ et al.Biallelic mutations in the ubiquitin ligase RFWD3 cause Fanconi anemia.J Clin Invest. 2017; 127: 3013-3027Crossref PubMed Scopus (118) Google Scholar, 8Bogliolo M Bluteau D Lespinasse J et al.Biallelic truncating FANCM mutations cause early-onset cancer but not Fanconi anemia.Genet Med. 2018; 20: 458-463Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 9Catucci I Osorio A Arver B et al.Individuals with FANCM biallelic mutations do not develop Fanconi anemia, but show risk for breast cancer, chemotherapy toxicity and may display chromosome fragility.Genet Med. 2018; 20: 452-457Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar]. Of these, biallelic variations in FANCA (∼65%), FANCC (∼15%), and FANCG (∼10%) account for most FA patients. Additionally, the pathogenic variants in FA genes are largely private mutations except for a few founder variants in the FANCA gene [10Kimble DC Lach FP Gregg SQ et al.Comprehensive approach to identification of pathogenic FANCA variants in Fanconi anemia patients and their families.Hum Mutat. 2018; 39: 237-254Crossref PubMed Scopus (21) Google Scholar]. Generally, clinical diagnosis of FA depends on a comprehensive assessment of the patient's medical history, physical examination, and cell sensitivity assay exposed upon DNA crosslinking agents such as diepoxybutane (DEB) and mitomycin C (MMC) [3Ceccaldi R Sarangi P D'Andrea AD The Fanconi anaemia pathway: New players and new functions.Nat Rev Mol Cell Biol. 2016; 17: 337-349Crossref PubMed Scopus (367) Google Scholar]. Two types of drug sensitivity experiments can be carried out. One is a complementation analysis using a retrovirus expressing wild-type cDNA, which is transduced into peripheral blood lymphocytes or skin fibroblasts of the suspected individual to determine whether the viability of the transduced cells is significantly increased after drug treatment [10Kimble DC Lach FP Gregg SQ et al.Comprehensive approach to identification of pathogenic FANCA variants in Fanconi anemia patients and their families.Hum Mutat. 2018; 39: 237-254Crossref PubMed Scopus (21) Google Scholar, 11De Rocco D Bottega R Cappelli E et al.Molecular analysis of Fanconi anemia: The experience of the Bone Marrow Failure Study Group of the Italian Association of Pediatric Onco-Hematology.Haematologica. 2014; 99: 1022-1031Crossref PubMed Scopus (31) Google Scholar]. This test is frequently used for research, but is not a routine diagnostic technique because of the complex experimental process and long experimental time. The other is a chromosome breakage assay (the DEB test), which compares the patient's chromosomes with healthy controls [12Auerbach AD Diagnosis of Fanconi anemia by diepoxybutane analysis.Curr Protoc Hum Genet. 2015; 85 (8.7.1–17)Crossref PubMed Scopus (51) Google Scholar]. The latter has been widely used by clinical laboratories in Europe, the United States, and many other countries and regions [13Auerbach AD Fanconi anemia and its diagnosis.Mutat Res. 2009; 668: 4-10Crossref PubMed Scopus (374) Google Scholar]. However, several factors have prevented its universal launch in China. First, China lacks an authoritative organization (e.g., the Clinical Laboratory Improvement Amendments [CLIA] or the College of American Pathologists [CAP] in the United States) for providing training and technical standards, laboratory certification, and accreditation for this test. Furthermore, the test itself can result in false negatives, especially if the patient has mosaicism of the peripheral blood lymphocytes [11De Rocco D Bottega R Cappelli E et al.Molecular analysis of Fanconi anemia: The experience of the Bone Marrow Failure Study Group of the Italian Association of Pediatric Onco-Hematology.Haematologica. 2014; 99: 1022-1031Crossref PubMed Scopus (31) Google Scholar]. Third, molecular studies for identifying specific pathogenic variants following positive chromosome breakage assays are generally not available [12Auerbach AD Diagnosis of Fanconi anemia by diepoxybutane analysis.Curr Protoc Hum Genet. 2015; 85 (8.7.1–17)Crossref PubMed Scopus (51) Google Scholar]. More importantly, the rapid development and relatively low cost next-generation sequencing (NGS) in China is replacing cytogenetic testing. Therefore, as in other inherited diseases, genetic investigation plays a crucial role in FA diagnosis in China and depends largely on pathogenicity assessment of the variants. The pivotal step in the FA/BRCA pathway is mono-ubiquitination of the FANCD2-FANCI heterodimer, which triggers a series of damage repair events. FA genes are therefore divided into the upstream FA core complex (A, B, C, E, F, G, L, M, and T), which catalyzes mono-ubiquitination, and downstream repair components (D, 1, J, N, O, P, Q, V, and W) [2Kottemann MC Smogorzewska A Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.Nature. 2013; 493: 356-363Crossref PubMed Scopus (420) Google Scholar, 6Bluteau D Masliah-Planchon J Clairmont C et al.Biallelic inactivation of REV7 is associated with Fanconi anemia.J Clin Invest. 2016; 126: 3580-3584Crossref PubMed Scopus (91) Google Scholar, 7Knies K Inano S Ramírez MJ et al.Biallelic mutations in the ubiquitin ligase RFWD3 cause Fanconi anemia.J Clin Invest. 2017; 127: 3013-3027Crossref PubMed Scopus (118) Google Scholar]. Detection of the ubiquitination of FANCD2 or FANCI can be regarded as a very effective diagnostic tool, especially for upstream FA core complex genes. In this study, we applied multiple molecular diagnostic methods in 25 suspected FA patients who were not tested with either of the standard drug sensitivity assays. Pathogenicity of the candidate variants was determined using a stable functional experimental platform. The diagnostic workflows of our group and other research groups were compared. A total of 25 patients (five females, 20 males), age 0.6 to 11 years old, were enrolled from the Department of Hematology and Oncology in Shanghai Children's Medical Center. Of them, 24 patients showed significant BMF as well as pancytopenia in peripheral blood, except for patient FA-G-1, who presented with refractory anemia without leukopenia or thrombocytopenia. Ninety-two percent of patients (23/25) displayed at least one congenital malformation and were originally suspected of having FA according to clinical features (except for FA-A-6 and FA-G-1). Congenital malformations primarily included polydactyly (10/25), short stature (9/25), malformed thumbs (8/25), and café-au-lait spots (8/25) (Supplementary Table E1, online only, available at www.exphem.org). The study was approved by the ethics committee of Shanghai Children's Medical Center, Shanghai Jiaotong University School of Medicine. Written informed consent was obtained from each patient's family. Patients FA-A-17 and FA-A-18 were screened by whole-exome sequencing (WES) due to complicated family histories, as described previously [14Li N Song A Ding L et al.Novel variations of FANCA gene provokes Fanconi anemia: Molecular diagnosis in a special Chinese family.J Pediatr Hematol Oncol. 2018; 40: e299-e304PubMed Google Scholar]. The remaining 23 patients underwent targeted NGS using a hematological disease panel containing 700 disease-causing genes (designed by us and customized by NimbleGen, Roche, CA, USA). Variants were validated using Sanger sequencing in each patient and the parents when samples were available. Multiplex ligation-dependent probe amplification (MLPA) analysis was performed using the SALSA MLPA probemix P031/P032-B2-FANCA kit (MRC Holland, Amsterdam, Netherlands) as described previously [14Li N Song A Ding L et al.Novel variations of FANCA gene provokes Fanconi anemia: Molecular diagnosis in a special Chinese family.J Pediatr Hematol Oncol. 2018; 40: e299-e304PubMed Google Scholar]. Chromosome microarray analysis (CMA) was performed with a CytoScan HD array (Affymetrix, Thermo Fisher Scientific, Waltham, MA, USA) as described previously [14Li N Song A Ding L et al.Novel variations of FANCA gene provokes Fanconi anemia: Molecular diagnosis in a special Chinese family.J Pediatr Hematol Oncol. 2018; 40: e299-e304PubMed Google Scholar]. Total RNA was extracted using an RNeasy Mini kit (Qiagen GMBH, Hilden, Germany) from peripheral blood of patients FA-A-1, FA-A-10, FA-A-12, and FA-C-1 and cDNA was obtained using a reverse transcription (RT) kit (TaKaRa, Dalian, China). All target cDNA fragments were obtained by PCR (primers listed in Supplementary Table E2, online only, available at www.exphem.org) performed either through direct sequencing of the PCR product (FA-A-2, FA-A-3, and FA-A-12) or TA clone sequencing (FA-C-1). FA fibroblasts, including GM6914 (FANCA–/–), PD426 (FANCC–/–), PD20 (FANCD2–/–), and PD326 (FANCG–/–), were derived from FA patients as described previously [15Taniguchi T D'Andrea AD The Fanconi anemia protein, FANCE, promotes the nuclear accumulation of FANCC.Blood. 2002; 100: 2457-2462Crossref PubMed Scopus (65) Google Scholar]. All FA and HEK293T cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin/streptomycin (Thermo Fisher Scientific) in a 5% CO2 incubator at 37°C. The open reading frame (ORF) sequences of wild-type FANCA, FANCD2, and FANCG were synthesized by BGI (Shanghai, China). The restriction enzyme sites EcoRI and NotI were introduced into the ORF sequences to enable directional cloning. Target fragments were ligated into the Myc-tagged pCDH1-MSCV-EF1-GreenPuro cDNA Cloning and Expression Vector (System Biosciences, Palo Alto, CA, USA) using solution I ligase (Takara) according to the manufacturer's protocol. Mutant FANCA (M1T, L278R, V378I, L424V, A733P, W957G, and L1083del), FANCD2 (M1238K), and FANCG (A153G, L229P) expression plasmids were constructed by site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent, Santa Clara, CA, USA) from the above wild-type plasmids. The primers for mutant plasmid construction are listed in Supplementary Table E3 (online only, available at www.exphem.org). ORF sequences of FANCC wild-type and FANCC mutant (P235L and E273K) were obtained using PCR from patients' cDNA and introduced into the above lentivirus vector with the BamHI and NotI restriction enzymes. All of the plasmids were prepared using ZymoPURE II Plasmid Midiprep kit (Irvine, CA, USA). To produce lentivirus, HEK293T cells were seeded at 60% confluence in a 60-mm dish for 24 hours before transfection. Each expression plasmid was transfected together with the packaging plasmids (psPAX2 and PMD2.G) using LipoLTX reagent (Life Technologies). Virus was harvested 48 hours after transfection, filtered through a 0.45 μm low-protein-binding membrane (Millipore, Burlington, MA, USA), and then placed on the corresponding FA cell line with a density of 10%. Monoclone was collected after 2 weeks of selection by puromycin (1 μg/mL for the GM6914 and PD20 cell lines, 2 μg/mL for PD326, and 4 μg/mL for PD426). A total of 1.5 × 103 cells per well were plated in a 96-well plate. After 4–5 days of culture in the indicated concentrations of MMC, cell viability was measured using a Cell Titer-Glo luminescent assay (Promega, Madison, WI, USA) according to the manufacturer's instructions. To prepare whole-cell extracts, cells were washed once with ice-cold phosphate-buffered saline and lysed with radioimmunoprecipitation buffer (Cell Signaling Technology, Danvers, MA, USA). Equal amounts of samples were subjected to 3–8% Tris-acetate gel (Thermo Fisher Scientific). The protein was transferred to a PVDF membrane. Membranes were blocked in 2% BSA in TBS-T for 1 hour and then incubated overnight at 4°C with the following antibodies: anti-Myc-tag (Cell Signaling Technology, 2276), anti-beta-actin (Cell Signaling Technology, 4967), anti-FANCA (Bethyl Laboratories, A301-980), anti-FANCC (Abcam, ab54631), anti-FANCG (Novus Biologicals, NB100-2566), and anti-FANCD2 (Novus Biologicals, NB100-182). Proteins were detected using a chemiluminescence system with a horseradish peroxidase-conjugated secondary antibody. For FANCD2 monoubiquitination, cells were treated with 4 mmol/L hydroxyurea (HU) for 6 hours before protein extraction. The genetic evaluation integrated applied NGS, Sanger sequencing, MLPA, and CMA technologies. A total of 45 variants were revealed in six FA genes (32 in FANCA, one in FANCB, three in FANCC, two in FANCD2, five in FANCG, and two in FANCJ) in the 25 patients. Of these variants, 22 were novel and 15 were previously reported by us [14, 16]. A comprehensive list of all identified variants is summarized in Table 1.Table 1Summary of the variants found in Chinese FA patients classified by mutant genescDNA changeProtein ChangeStatusaCorresponding to the detection method.PositionOriginNoveltyFANCA gene (chr16: NM_000135.2)FA-A-1c.792+1G>AExon 8 skipping (p.D237Gfs*3)HomIntron 8Father (WT for mother)16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.Exons 6-22 delHetMotherNovelFA-A-2c.833T>Gp.L278RHetExon 10FatherNovelc.985_988delACTCp.H330Afs*4HetExon 11Mother17Levran O Diotti R Pujara K et al.Spectrum of sequence variations in the FANCA gene: an International Fanconi Anemia Registry (IFAR) study.Hum Mutat. 2005; 25: 142-149Crossref PubMed Scopus (59) Google ScholarFA-A-3c.985_988delACTCp.H330Afs*4HetExon 11Mother17Levran O Diotti R Pujara K et al.Spectrum of sequence variations in the FANCA gene: an International Fanconi Anemia Registry (IFAR) study.Hum Mutat. 2005; 25: 142-149Crossref PubMed Scopus (59) Google Scholarc.3419_3451 delp.N1140_L1150delHetExon 35FatherNovelFA-A-4c.1270C>Gp.L424VHetExon 14MotherAF: 0.0012%c.2197G>Cp.A733PHetExon 24FatherNovelExons 9-10 delHetMotherNovelFA-A-5c.2T>Cp.M1THetExon 1MotherAF: 0.0043%; 17Levran O Diotti R Pujara K et al.Spectrum of sequence variations in the FANCA gene: an International Fanconi Anemia Registry (IFAR) study.Hum Mutat. 2005; 25: 142-149Crossref PubMed Scopus (59) Google Scholarc.3248_3250delTCCp.L1083delHetExon 33FatherNovelFA-A-6c.1658dupAp.A554Gfs*6HetExon 18FatherNovelc.3929_3932delAGAGp.E1310Vfs*52HetExon 39MotherNovelFA-A-7c.643_644delTGcMLPA analysis results showed that heterozygous deletion of exon 7 due to the variant of c.643_644delTG occurred on the probe site.p.C215Lfs*4HetExon 7MotherNovelc.2869 T>Gp.W957GHetExon 30FatherNovelFA-A-8c.1144 C>Tp.Q382*HomExon 13Unknown16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarFA-A-9c.3973delGp.D1325Ifs*38HomExon 40Father/Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FA-A-10c.3240-3G>CAltered splicing (p.R1080fs*9)HomIntron 32Father/Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FA-A-11c.367C>Tp.Q123*HomExon 4Unknown16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FA-A-12c.1007-1G>AExons 12-14 skippingHetIntron 11Father16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.c.1213C>Tp.Q405*HetExon 13Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FA-A-13c.989_995delp.H330Lfs*3HetExon 11Father16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.c.3971delT,p.P1324Rfs*39HetExon 40Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FA-A-14c.2832dupTp.Ala945Cysfs*6HetExon 29FatherNovelExons 12-14 delHetMotherNovelFA-A-15c. 457C>Tp.Q153*HetExon5FatherNovelc.1132G>Ap.V378IHetExon13MotherNovelFA-A-16Exons 32-43 delHomFather (Het)NovelUPD of chr16c.1057C>Ap.P353THomExon12Father (Het)NovelFA-A-17c.1471-1G>AAltered splicing (p.V490Hfs*6)HetIntron 15Father[14]bExons 23-30 delHetMother[14]bFA-A-18c.1471-1G>AAltered splicing (p.V490Hfs*6)HomIntron 15Mother (WT for father)[14]bExons 1-18 delHetFather[14]bFANCB gene (chrX: NM_001018113.1)FA-B-1c.1330G>Tp.E444*HemExon 7Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FANCC gene (chr9: NM_000136.2)FA-C-1c.844-1 G>AExon 9 skipping (p.P282Vfs*73)HetIntron 8MotherNovelc.704C>Tp.P235LHetExon 8FatherNovelc.817G>Ap.E273KHetExon 8FatherNovelFANCD2 gene (chr3: NM_033084.3)FA-D2-1c.3294delGp.K1099Nfs*40HetExon 33Father16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.c.3713T>Ap.M1238KHetExon 37MotherAF: 0.0004% 16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarFANCG gene (chr9: NM_004629.1)FA-G-1c.458C>Gp.A153GHetExon 4FatherAF: 0.0047%c.686T>Cp.L229PHetExon 6MotherNovelFA-G-2c.17_18delCCp.T6Ifs*15HomExon 1Father/MotherNovelFA-G-3c.91C>Tp.Q31XHetExon 2Father16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.c.1652dupA,p.Tyr551*HetExon 13Mother16Li Q Luo C Luo C et al.Disease-specific hematopoietic stem cell transplantation in children with inherited bone marrow failure syndromes.Ann Hematol. 2017; 96: 1389-1397Crossref PubMed Scopus (9) Google ScholarbFirst reported by us as a novel variant.FANCJ/BRIP1 gene (chr17: NM_032043.2)FA-J-1c.1777T>Cp.C593RHetExon 12FatherNovelc.2345T>Cp.I782THetExon 16MotherAF: 0.0006%Hom=Homozygote; Het=heterozygote; Hem=hemizygote; WT=wild-type; AF=allele frequency (in gnomAD database: http://gnomad.broadinstitute.org/)a Corresponding to the detection method.b First reported by us as a novel variant.c MLPA analysis results showed that heterozygous deletion of exon 7 due to the variant of c.643_644delTG occurred on the probe site. Open table in a new tab Supplementary Table E1Summary of congenital malformationsPatientGenderAge (years)BMF with PancytopeniaCafé-au-Lait SpotsShort StatureSkeletal AnomalyOther AnomaliesFA-A-1M4++–Polydactyly, carpale deformityUnilateral kidneyFA-A-2M2+–+Malformed thumbFA-A-3F6+++–FA-A-4M7++–Malformed thumbMicropenisFA-A-5M4+––PolydactylyFA-A-6M5+––FA-A-7M3+–+FA-A-8M4+–+PolydactylyMental retardationFA-A-9F11++–Malformed thumbFA-A-10F7+–+FA-A-11M2+–+MicrognathismPDAFA-A-12M0.6+––Malformed thumbFA-A-13M4+––PolydactylyFA-A-14M8++–PolydactylyFA-A-15M11+––Malformed thumbFA-A-16F1.7+–+PolydactylyFA-A-17M6++–PolydactylyMicrocephalyFA-A-18M5+––PolydactylyFA-B-1M3+++Malformed thumbFA-C-1M5+–+FA-D2-1M3.5+––Malformed thumbFA-G-1F5–(Refractory anemia)––FA-G-2M8++–PolydactylyFA-G-3M8+––Malformed thumb, long limbsPDAFA-J-1M2+––PolydactylyF=Female; M=male; BMF=bone marrow failure; PDA=patent ductus arteriosus Open table in a new tab Supplementary Table E2Primers for PCR and sequencing of cDNA fragmentsVariantForward Primer 5′–3′Backward Primer 5′–3′Product Size (bp)FANCA: c.792+1G>AATCGTGGCTCTTCAGGAATCTGTTCACGATCTTGTGAGTGGAGGACT266FANCA: c.1007-1G>AAGGTGCTGGTTCGGAGTGTTGGGCTCAGTAATGTCCCCAG744FANCA: c.3240-3C>GATGTGCCACAGAAATGGACAGGCTTCCAATTGAAATAGCTTGCCCCACTT466FANCC: c.844-1 G>AGACAGATGTTGACCCCCTGGCTGAGATGGTGGCAGAGCAA652 Open table in a new tab Supplementary Table E3Primers for mutant plasmid constructionForward Primer 5′–3′Backward Primer 5′–3′FANCA geneT2CTTCGGACGTCCGACTCGTGGGTCCCGAGGACGTCCGAATTCGGGCCTCCATGGT833GTGCACGTGACGCTTTGGCTGCTGGAGTACGTCACGTGCAAAAATCAGCATTCTCTGCAG1132AAAGAAATTCTGGAAACGCAGGAGGTCCAGAATTTCTTGCAAATGGCCAACCC1270GCCAGGTGGACAGCATGGTCACTGCTGTCCACCTGGCAGCTCTCGAATGCCG2197CGATGGCTCCCTCCAGTGTCGCTCCCCCGAGGGAGCCATCAGGTTCTGACAGAAAGAT2869GCCAGGGGGCGATCCATGAGCACTTCGCCCCCTGGTGGAAGTCCTGCCGT3248_3250 delTCCTCCGCCTGCCTTCGTCTGTCCTCAGGCGGAGGATCCGTTTGTACATTAFANCD2 geneT3713ATGTGAAGATGGCTGAACTAGAGAAGAGCCATCTTCACACGGAAGAAAACAACAFANCG geneC458GGAGTGGTGACCGTCTTGGGGACCTGGCGGTCACCACTCAACCAGAGGGCAGCCTGT686CGCACCAAGCAGCCTTCATGAAGCGCTGCTTGGTGCCTTGTCTGGGTTCCPCR primers for FANCC geneWild-type and mutant plasmidsCCCCCCGGATCCATGGCTCAAGATTCAGTAGACCCCCCGCGGCCGCCTAGACTTGAGTTCGCAGCTCTT Open table in a new tab Hom=Homozygote; Het=heterozygote; Hem=hemizygote; WT=wild-type; AF=allele frequency (in gnomAD database: http://gnomad.broadinstitute.org/) F=Female; M=male; BMF=bone marrow failure; PDA=patent ductus arteriosus NGS identified 25 variants in the FANCA gene from 18 patients, including seven homozygotes, nine compound heterozygotes, and in two patients only a heterozygous variant. Five variants in the FANCG gene were detected in three patients, including two compound heterozygotes and one homozygote. One patient with a hemizygous variant in the FANCB gene, one patient carrying three heterozygous variants in the FANCC gene, and two patients with compound heterozygous variants in the FANCD2 and FANCJ (BRIP1) genes were also reported. All variants were validated by direct sequencing (Table 1, Supplementary Figure E1, online only, available at www.exphem.org). It is well known that intragenic large deletion frequently occurs in the FANCA gene due to recombination between 2 Alu repeats [18Castella M Pujol R Callén E et al.Origin, functional role, and clinical impact of Fanconi anemia FANCA mutations.Blood. 2011; 117: 3759-3769Crossref PubMed Scopus (88) Google Scholar, 19Yagasaki H Hamanoue S Oda T et al.Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population.Hum Mutat. 2004; 24: 481-490Crossref PubMed Scopus (34) Google Scholar]. We adopted the following strategy. Unless both biallelic variants of the FANCA gene were definitively pathogenic (i.e., null variants, nonsense variants, frameshifts, or classic ±1 or ±2 splicing variants) and the parents were respectively heterozygous for the two variants, an MLPA analysis of FANCA gene must be performed for the patient. MLPA analyses of 16 FA-A patients (except for FA-A-6 and FA-A-9) revealed six heterozygous deletions and one homozygous deletion in seven patients (Table 1 and Supplementary Table E4, online only, available at www.exphem.org). The seven patients' parents were subsequently screened by MLPA to determine whether they were carriers. The heterozygous deletion of exon 7 in patient FA-A-7 due to the c.643_644delTG variant occurred at the probe sequence site.Supplementary Table E4Peak value of MLPA results for the FANCA gene in seven patientsFA-A-1FA-A-4FA-A-7FA-A-14FA-A-16FA-A-17FA-A-18Exon1NormalNormalNormalNormalNormalNormal0.451Exon 2NormalNormalNormalNormalNormalNormal0.487Exon 3NormalNormalNormalNormalNormalNormal0.404Exon 4NormalNormalNormalNormalNormalNormal0.536Exon 5NormalNormalNormalNormalNormalNormal0.413Exon 60.510NormalNormalNormalNormalNormal0.461Exon 70.511Normal0.593NormalNormalNormal0.335Exon 80.516NormalNormalNormalNormalNormal0.542Exon 90.4600.491NormalNormalNormalNormal0.405Exon 100.5020.490NormalNormalNormalNormal0.556Exon 110.475NormalNormalNormalNormalNormal0.401Exon 120.482NormalNormal0.500NormalNormal0.555Exon 130.468NormalNormal0.501NormalNormal0.440Exon 140.549NormalNormal0.505NormalNormal0.511Exon 150.498NormalNormalNorm
Referência(s)