Artigo Revisado por pares

First Report of Cotton Leafroll Dwarf Virus in Upland Cotton ( Gossypium hirsutum ) in Mississippi

2019; American Phytopathological Society; Volume: 103; Issue: 7 Linguagem: Inglês

10.1094/pdis-01-19-0017-pdn

ISSN

1943-7692

Autores

Nina Aboughanem‐Sabanadzovic, Thomas Wesley Allen, Tessie H. Wilkerson, Kassie Conner, Edward J. Sikora, R. L. Nichols, Sead Sabanadzovic,

Tópico(s)

Research in Cotton Cultivation

Resumo

HomePlant DiseaseVol. 103, No. 7First Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in Mississippi PreviousNext DISEASE NOTESFirst Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in MississippiN. Aboughanem-Sabanadzovic, T. W. Allen, T. H. Wilkerson, K. N. Conner, E. J. Sikora, R. L. Nichols, and S. SabanadzovicN. Aboughanem-SabanadzovicDelta Research and Extension Center, Mississippi State University, Stoneville, MSSearch for more papers by this author, T. W. Allenhttp://orcid.org/0000-0003-2828-3420Mississippi State University, Delta Research and Extension Center, Stoneville, MSSearch for more papers by this author, T. H. WilkersonMississippi State University, Delta Research and Extension Center, Stoneville, MSSearch for more papers by this author, K. N. ConnerAlabama Cooperative Extension System, Auburn University, ALSearch for more papers by this author, E. J. SikoraAlabama Cooperative Extension System, Auburn University, ALSearch for more papers by this author, R. L. NicholsCotton Inc, Cary, NCSearch for more papers by this author, and S. Sabanadzovic†Corresponding author: S. Sabanadzovic; E-mail Address: [email protected]http://orcid.org/0000-0002-2995-2633Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MSSearch for more papers by this authorAffiliationsAuthors and Affiliations N. Aboughanem-Sabanadzovic1 T. W. Allen2 T. H. Wilkerson2 K. N. Conner3 E. J. Sikora3 R. L. Nichols4 S. Sabanadzovic5 † 1Delta Research and Extension Center, Mississippi State University, Stoneville, MS 2Mississippi State University, Delta Research and Extension Center, Stoneville, MS 3Alabama Cooperative Extension System, Auburn University, AL 4Cotton Inc, Cary, NC 5Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS Published Online:10 May 2019https://doi.org/10.1094/PDIS-01-19-0017-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Cotton leafroll dwarf virus (CLRDV), associated with “cotton blue disease” known to occur in Africa, Asia-Pacific, and South America (Corrêa et al. 2005; Distéfano et al. 2010; Ray et al. 2016), has been recently reported from Alabama (Avelar et al. 2019), which prompted a survey of the Mississippi (MS) cotton production area during late October and early November 2018. During the survey, 60 samples of healthy-looking and CLRDV-suspect plants were collected from 17 counties and tested for the presence of the virus. Diseased plants expressed a range of symptoms including leaf curling, reddening and distortion, unusual secondary plant growth characterized by shortened internodes, and a general reduction in boll set. Cotton aphids (Aphis gossypii Glover) were also present on some of the collected plant material. Disease incidence in individual fields, estimated visually, ranged from 20% with the greater values occurring in southeast MS. Thirteen samples were initially tested at the Plant Disease Diagnostic Lab at Auburn University with a two-step RT-PCR protocol (Sharman et al. 2015), while the remainder were examined in the Plant Virology Lab at Mississippi State University with two independent single-tube RT-PCR tests originally designed in this study. To prepare samples for virus-specific tests, total RNAs were purified from petioles using the manufacturer’s protocol for the Qiagen Plant RNA Easy kit. A single-tube RT-PCR test was performed using a set of primers (CLRDV-CPF1 5′ ACGACGAAGACGAGGAGGTC′ and CLRDV-CPR1 5′ GAACCGGAGGATGTTGAAGAGG 3′) designed to amplify a 249-nt-long segment of the viral coat protein (CP) gene. A specific PCR product of predicted size was present in 38 samples collected from 13 counties indicating relatively high virus incidence (63%) and prevalence (76%). No visible bands were present in negative and water/blank controls. No discrepancies in results were observed when 10 randomly selected samples tested in one-tube tests with CP primers were verified by the protocol of Sharman et al. (2015) and with another set of primers designed in this study targeting a 770-nt-long portion of viral RdRp gene (CLRDV-RdRpF2 5′GGAGCCGCACAAACAAGCTAA 3′and CLRDV-RdRpR1 5′ AACAGGCGTTCAGGTAGTTGGA 3′). Both amplicons (249 bp and 770 bp) from six samples collected from four counties (Bolivar, Grenada, Tallahatchie, and Washington) were cloned and custom sequenced. Pair-wise and BLASTn analyses revealed that they share highly conserved nucleotide content (95 to 100%) with each other and with the recent record from Alabama (GenBank MH883236), as well as with CLRDV isolates from Brazil and Argentina available in the NCBI/GenBank (December 2018). Nucleotide sequences of two genomic regions (RdRp and CP) for six virus isolates from Mississippi have been deposited in GenBank under accession nos. MK512759 to MK512770. This is the first report of polerovirus infections of cotton in MS. Results from this study, along with recent report of the same virus from Alabama, call for multidisciplinary research to understand population structure, epidemiology and ecology of the virus, and its potential impact on the United States cotton industry.The author(s) declare no conflict of interest.References:Avelar, S., et al. 2019. Plant Dis. 103:592. https://doi.org/10.1094/PDIS-09-18-1550-PDN ISI, Google ScholarCorrêa, R. L., et al. 2005. Arch. Virol. 150:1357. https://doi.org/10.1007/s00705-004-0475-8 Google ScholarDistéfano, A. J., et al. 2010. Arch. Virol. 155:1849. https://doi.org/10.1007/s00705-010-0764-3 ISI, Google ScholarRay, J. D., et al. 2016. Australas. Plant Dis. Notes 11:29. https://doi.org/10.1007/s13314-016-0217-2 Google ScholarSharman, M., et al. 2015. Australas. Plant Dis. Notes 10:24. https://doi.org/10.1007/s13314-015-0174-1 Google ScholarFunding: Cotton Incorporated.The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 103, No. 7 July 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionApple cultivar Joya Cripps Red lesions caused by Colletotrichum fructicola (Nodet et al.). Photo credit: P. Nodet. Symptoms of Lotus powdery mildew caused by Erysiphe takamatsui (Zhou et al.). Photo credit: C. Liang. Symptoms of tar spot (Phyllachora maydis) on maize leaves (Dalla Lana et al.). Photo credit: F. Dalla Lana. Metrics Article History Issue Date: 20 Jun 2019Published: 10 May 2019First Look: 22 Feb 2019Accepted: 18 Feb 2019 Page: 1798 InformationThis article is in the public domain and not copyrightable. It may be freely reprinted with customary crediting of the source. The American Phytopathological Society, 2019.Keywordsviruses and viroidsfield cropspathogen detectionThe author(s) declare no conflict of interest.Cited byAnalysis of Cotton Leafroll Dwarf Virus P0 Gene Sequences from South Carolina Reveals Low Variability Among IsolatesWilliam W. Spivey, Zachary Williamson, Jacob Seiter, Peter Abrahamian, Hehe Wang, Jeremy Greene, and Elizabeth Cieniewicz19 September 2023 | Plant Disease, Vol. 107, No. 9Discovery and Analyses of Caulimovirid-like Sequences in Upland Cotton (Gossypium hirsutum)28 July 2023 | Viruses, Vol. 15, No. 8A newly isolated cotton-infecting Polerovirus with cryptic pathogenicity encodes a weak suppressor of RNA silencing24 July 2023 | Frontiers in Agronomy, Vol. 5Seasonal Dynamics of Aphid Flights and Cotton Leafroll Dwarf Virus Spread in Alabama4 July 2023 | Insects, Vol. 14, No. 7The Spatiotemporal Distribution, Abundance, and Seasonal Dynamics of Cotton-Infesting Aphids in the Southern U.S.15 July 2023 | Insects, Vol. 14, No. 7First Report of Pothos Latent Virus Infecting Upland Cotton (Gossypium hirsutum) in the United StatesN. Aboughanem-Sabanadzovic, T. W. Allen, J. Scheffler, and S. Sabanadzovic12 July 2023 | Plant Disease, Vol. 107, No. 7Characterizing the vector competence of Aphis gossypii , Myzus persicae and Aphis craccivora (Hemiptera: Aphididae) to transmit cotton leafroll dwarf virus to cotton in the United States12 May 2023 | Journal of Economic Entomology, Vol. 116, No. 3Cotton leafroll dwarf disease: An enigmatic viral disease in cotton10 April 2023 | Molecular Plant Pathology, Vol. 24, No. 6First Report of Cotton Leafroll Dwarf Virus Infecting Hibiscus syriacus in South KoreaDavaajargal Igori, Ah Young Shin, Se Eun Kim, Suk Yoon Kwon, and Jae Sun Moon3 October 2022 | Plant Disease, Vol. 106, No. 11Prospective Alternate Hosts of an Emerging Polerovirus in Cotton Landscapes in the Southeastern United States13 October 2022 | Viruses, Vol. 14, No. 10Investigating the effects of planting date and Aphis gossypii management on reducing the final incidence of cotton leafroll dwarf virusCrop Protection, Vol. 158Complete Genome Sequence of Cotton Leafroll Dwarf Virus Infecting Cotton in Oklahoma, USAMicrobiology Resource Announcements, Vol. 11, No. 7Antibodies for the Coat Protein of Cotton Leafroll Dwarf Virus Detect Commelina sp. as an Intermediary Host for Cotton Blue Disease13 July 2022 | Frontiers in Plant Science, Vol. 13A review of visible and near-infrared (Vis-NIR) spectroscopy application in plant stress detectionSensors and Actuators A: Physical, Vol. 338Aphis gossypii (cotton aphid)CABI Compendium, Vol. CABI CompendiumCotton leafroll dwarf virus (cotton blue)CABI Compendium, Vol. CABI CompendiumCotton Leafroll Dwarf Virus US Genomes Comprise Divergent Subpopulations and Harbor Extensive Variability5 November 2021 | Viruses, Vol. 13, No. 11Effect of Cotton Leafroll Dwarf Virus on Physiological Processes and Yield of Individual Cotton Plants1 October 2021 | Frontiers in Plant Science, Vol. 12Genome analysis of cotton leafroll dwarf virus reveals variability in the silencing suppressor protein, genotypes and genomic recombinants in the USA7 July 2021 | PLOS ONE, Vol. 16, No. 7What we know about poleroviruses: Advances in understanding the functions of polerovirus proteins30 March 2021 | Plant Pathology, Vol. 70, No. 5Natural host range, incidence on overwintering cotton and diversity of cotton leafroll dwarf virus in Georgia USACrop Protection, Vol. 144First Report of Cotton Leafroll Dwarf Virus in Cotton Plants Affected by Cotton Leafroll Dwarf Disease in North CarolinaLindsey D. Thiessen, Tyler Schappe, Marcio Zaccaron, Kassie Conner, Jenny Koebernick, Alana Jacobson, and Anders Huseth8 October 2020 | Plant Disease, Vol. 104, No. 12First Report of Cotton Leafroll Dwarf Virus in FloridaF. B. Iriarte, K. K. Dey, I. M. Small, K. N. Conner, G. K. O’Brien, L. Johnson, C. Savery, E. Carter, D. Sprague, R. L. Nichols, D. L. Wright, M. J. Mulvaney, and M. Paret27 July 2020 | Plant Disease, Vol. 104, No. 10First Report of Cotton Leafroll Dwarf Virus from Upland Cotton (Gossypium hirsutum) in ArkansasTravis R. Faske, Daisy Stainton, Nina Aboughanem-Sabanadzovic, and Tom W. Allen18 August 2020 | Plant Disease, Vol. 104, No. 10First Report of Cotton Leafroll Dwarf Virus from Cotton (Gossypium hirsutum) in OklahomaAkhtar Ali, Samira Mokhtari, and Conner Ferguson1 July 2020 | Plant Disease, Vol. 104, No. 9First Report of Cotton Leafroll Dwarf Virus in Cotton Fields of South CarolinaH. Wang, J. Greene, J. Mueller, K. Conner, and A. Jacobson6 July 2020 | Plant Disease, Vol. 104, No. 9Genome Sequence of Cotton Leafroll Dwarf Virus Infecting Cotton in Georgia, USAMicrobiology Resource Announcements, Vol. 9, No. 34First Report of Cotton Leafroll Dwarf Virus Infecting Cotton (Gossypium hirsutum) in KansasAkhtar Ali and Samira Mokhtari25 March 2020 | Plant Disease, Vol. 104, No. 6Complete Genome Sequence of Cotton Leafroll Dwarf Virus Isolated from Cotton in Texas, USAMicrobiology Resource Announcements, Vol. 9, No. 16Characterization of the Complete Genome and P0 Protein for a Previously Unreported Genotype of Cotton Leafroll Dwarf Virus, an Introduced Polerovirus in the United StatesSofia Avelar, Roberto Ramos-Sobrinho, Kassie Conner, Robert L. Nichols, Kathy Lawrence, and Judith K. Brown20 January 2020 | Plant Disease, Vol. 104, No. 3First Report of Cotton leafroll dwarf virus Infecting Upland Cotton (Gossypium hirsutum) in TexasOlufemi J. Alabi, Thomas Isakeit, Robert Vaughn, David Stelly, Kassie N. Conner, Brianna C. Gaytán, Cecilia Villegas, Christian Hitzelberger, Luis De Santiago, Cecilia Monclova-Santana, and Judith K. Brown5 January 2020 | Plant Disease, Vol. 104, No. 3First Report of Cotton Leafroll Dwarf Virus in LouisianaTrey Price, Rodrigo Valverde, Raghuwinder Singh, Jeff Davis, Sebe Brown, and Hank Jones29 April 2020 | Plant Health Progress, Vol. 21, No. 2Full Issue PDF26 August 2021 | Plant Health Progress, Vol. 21, No. 2

Referência(s)
Altmetric
PlumX