Integrated Analyses of Phenotype and Quantitative Proteome of CMTM4 Deficient Mice Reveal Its Association with Male Fertility
2019; Elsevier BV; Volume: 18; Issue: 6 Linguagem: Inglês
10.1074/mcp.ra119.001416
ISSN1535-9484
AutoresFujun Liu, Xuexia Liu, Xin Liu, Ting Li, Peng Zhu, Zhengyang Liu, Hui Xue, Wenjuan Wang, Xiulan Yang, Juan Liu, Wenling Han,
Tópico(s)Reproductive System and Pregnancy
ResumoThe chemokine-like factor (CKLF)-like MARVEL transmembrane domain-containing family (CMTM) is a gene family that has been implicated in male reproduction. CMTM4 is an evolutionarily conserved member that is highly expressed in the testis. However, its function in male fertility remains unknown. Here, we demonstrate that CMTM4 is associated with spermatogenesis and sperm quality. Using Western blotting and immunohistochemical analyses, we found CMTM4 expression to be decreased in poor-quality human spermatozoa, old human testes, and testicular biopsies with nonobstructive azoospermia. Using CRISPR-Cas9 technology, we knocked out the Cmtm4 gene in mice. These Cmtm4 knockout (KO) mice showed reduced testicular daily sperm production, lower epididymal sperm motility and increased proportion of abnormally backward-curved sperm heads and bent sperm midpieces. These mice also had an evident sub-fertile phenotype, characterized by low pregnancy rates on prolonged breeding with wild type female mice, reduced in vitro fertilization efficiency and a reduced percentage of acrosome reactions. We then performed quantitative proteomic analysis of the testes, where we identified 139 proteins to be downregulated in Cmtm4-KO mice, 100 (71.9%) of which were related to sperm motility and acrosome reaction. The same proteomic analysis was performed on sperm, where we identified 3588 proteins with 409 being differentially regulated in Cmtm4-KO mice. Our enrichment analysis showed that upregulated proteins were enriched with nucleosomal DNA binding functions and the downregulated proteins were enriched with actin binding functions. These findings elucidate the roles of CMTM4 in male fertility and demonstrates its potential as a promising molecular candidate for sperm quality assessment and the diagnosis or treatment of male infertility. The chemokine-like factor (CKLF)-like MARVEL transmembrane domain-containing family (CMTM) is a gene family that has been implicated in male reproduction. CMTM4 is an evolutionarily conserved member that is highly expressed in the testis. However, its function in male fertility remains unknown. Here, we demonstrate that CMTM4 is associated with spermatogenesis and sperm quality. Using Western blotting and immunohistochemical analyses, we found CMTM4 expression to be decreased in poor-quality human spermatozoa, old human testes, and testicular biopsies with nonobstructive azoospermia. Using CRISPR-Cas9 technology, we knocked out the Cmtm4 gene in mice. These Cmtm4 knockout (KO) mice showed reduced testicular daily sperm production, lower epididymal sperm motility and increased proportion of abnormally backward-curved sperm heads and bent sperm midpieces. These mice also had an evident sub-fertile phenotype, characterized by low pregnancy rates on prolonged breeding with wild type female mice, reduced in vitro fertilization efficiency and a reduced percentage of acrosome reactions. We then performed quantitative proteomic analysis of the testes, where we identified 139 proteins to be downregulated in Cmtm4-KO mice, 100 (71.9%) of which were related to sperm motility and acrosome reaction. The same proteomic analysis was performed on sperm, where we identified 3588 proteins with 409 being differentially regulated in Cmtm4-KO mice. Our enrichment analysis showed that upregulated proteins were enriched with nucleosomal DNA binding functions and the downregulated proteins were enriched with actin binding functions. These findings elucidate the roles of CMTM4 in male fertility and demonstrates its potential as a promising molecular candidate for sperm quality assessment and the diagnosis or treatment of male infertility. The human chemokine-like factor (CKLF) 1The abbreviations used are: CKLFchemokine-like factorKOknockoutWTwild typeCMTMCKLF-like MARVEL transmembrane domain-containing familyTM4SFtransmembrane 4 superfamilyBLNKB-cell linkerANOVAone-way analysis of varianceiTRAQisobaric tags for relative and absolute quantificationFDRfalse discovery rateGOgene ontologyEGFRepidermal growth factor receptorPD-L1programmed death-1OAobstructive azoospermiaNOAnon-obstructive azoospermiaCRISPRclustered regularly interspaced short palindromic repeatsCAS9CRISPR-associated protein 9sgRNAssingle guide RNAsPCRpolymerase chain reactionhCGhuman choionic gonadotrophinPMSGpregnant mare serum gonadotrophinPBSphosphate buffered salineBSAbovine serum albuminDMSOdimethyl sulfoxideIHCimmunohistochemistryCASAcomputer-aided sperm analysisDSPdaily sperm productionTEABtriethylammonium bicarbonateDTTdithiothreitolRPreversed-phaseLC-MSliquid chromatograph mass spectrometerDAVIDdatabase for annotation, visualization and integrated discoverySDS-PAGEsodium dodecyl sulphate polyacrylamide gel electrophoresisTBSTris–buffered salineHRPhorseradish peroxidaseECLenhanced chemiluminescenceIODintegrated optical densityDAB3,3′-diaminobenzidineUTRuntranslated regionCDScoding sequencePCRpolymerase chain reactionIVFin vitro fertilizationVSLstraight line velocityVCLcurvilinear velocityGEOgene expression omnibusARandrogen receptor. 1The abbreviations used are: CKLFchemokine-like factorKOknockoutWTwild typeCMTMCKLF-like MARVEL transmembrane domain-containing familyTM4SFtransmembrane 4 superfamilyBLNKB-cell linkerANOVAone-way analysis of varianceiTRAQisobaric tags for relative and absolute quantificationFDRfalse discovery rateGOgene ontologyEGFRepidermal growth factor receptorPD-L1programmed death-1OAobstructive azoospermiaNOAnon-obstructive azoospermiaCRISPRclustered regularly interspaced short palindromic repeatsCAS9CRISPR-associated protein 9sgRNAssingle guide RNAsPCRpolymerase chain reactionhCGhuman choionic gonadotrophinPMSGpregnant mare serum gonadotrophinPBSphosphate buffered salineBSAbovine serum albuminDMSOdimethyl sulfoxideIHCimmunohistochemistryCASAcomputer-aided sperm analysisDSPdaily sperm productionTEABtriethylammonium bicarbonateDTTdithiothreitolRPreversed-phaseLC-MSliquid chromatograph mass spectrometerDAVIDdatabase for annotation, visualization and integrated discoverySDS-PAGEsodium dodecyl sulphate polyacrylamide gel electrophoresisTBSTris–buffered salineHRPhorseradish peroxidaseECLenhanced chemiluminescenceIODintegrated optical densityDAB3,3′-diaminobenzidineUTRuntranslated regionCDScoding sequencePCRpolymerase chain reactionIVFin vitro fertilizationVSLstraight line velocityVCLcurvilinear velocityGEOgene expression omnibusARandrogen receptor.-like MARVEL transmembrane domain-containing (CMTM) family is a gene family encoding proteins that link classical chemokines and the transmembrane 4 superfamily (TM4SF). In humans, the nine members include CKLF and CMTM1–8, which encode proteins that play important roles in the immune system, tumorigenesis, and the male reproductive system (1Han W. Lou Y. Tang J. Zhang Y. Chen Y. Li Y. Gu W. Huang J. Gui L. Tang Y. Li F. Song Q. Di C. Wang L. Shi Q. Sun R. Xia D. Rui M. Tang J. Ma D. Molecular cloning and characterization of chemokine-like factor 1 (CKLF1), a novel human cytokine with unique structure and potential chemotactic activity.Biochem. J. 2001; 357: 127-135Crossref PubMed Scopus (156) Google Scholar, 2Han W. Ding P. Xu M. Wang L. Rui M. Shi S. Liu Y. Zheng Y. Chen Y. Yang T. Ma D. Identification of eight genes encoding chemokine-like factor superfamily members 1–8 (CKLFSF1–8) by in silico cloning and experimental validation.Genomics. 2003; 81: 609-617Crossref PubMed Scopus (149) Google Scholar). Our previous studies have reported that CMTM3, CMTM4, CMTM5, and CMTM7 function as tumor suppressors in the development and progression of carcinomas (3Wang Y. Li J. Cui Y. Li T. Ng K.M. Geng H. Li H. Shu X.S. Li H. Liu W. Luo B. Zhang Q. Mok T.S. Zheng W. Qiu X. Srivastava G. Yu J. Sung J.J. Chan A.T. Ma D. Tao Q. Han W. CMTM3, located at the critical tumor suppressor locus 16q22.1, is silenced by CpG methylation in carcinomas and inhibits tumor cell growth through inducing apoptosis.Cancer Res. 2009; 69: 5194-5201Crossref PubMed Scopus (91) Google Scholar, 4Li T. Cheng Y. Wang P. Wang W. Hu F. Mo X. Lv H. Xu T. Han W. CMTM4 is frequently downregulated and functions as a tumour suppressor in clear cell renal cell carcinoma.J. Exp. Clin. Cancer Res. 2015; 34: 122Crossref PubMed Scopus (40) Google Scholar, 5Shao L. Cui Y. Li H. Liu Y. Zhao H. Wang Y. Zhang Y. Ng K.M. Han W. Ma D. Tao Q. CMTM5 exhibits tumor suppressor activities and is frequently silenced by methylation in carcinoma cell lines.Clin. Cancer Res. 2007; 13: 5756-5762Crossref PubMed Scopus (65) Google Scholar, 6Li H. Li J. Su Y. Fan Y. Guo X. Li L. Su X. Rong R. Ying J. Mo X. Liu K. Zhang Z. Yang F. Jiang G. Wang J. Zhang Y. Ma D. Tao Q. Han W. A novel 3p22.3 gene CMTM7 represses oncogenic EGFR signaling and inhibits cancer cell growth.Oncogene. 2014; 33: 3109-3118Crossref PubMed Scopus (57) Google Scholar). CMTM3 and CMTM7 colocalize with RAB5 in early endosomes and facilitate epidermal growth factor receptor (EGFR) internalization and degradation by enhancing RAB5 activity and early endosome fusion (7Yuan W. Liu B. Wang X. Li T. Xue H. Mo X. Yang S. Ding S. Han W. CMTM3 decreases EGFR expression and EGF-mediated tumorigenicity by promoting Rab5 activity in gastric cancer.Cancer Lett. 2017; 386: 77-86Crossref PubMed Scopus (35) Google Scholar, 8Liu B. Su Y. Li T. Yuan W. Mo X. Li H. He Q. Ma D. Han W. CMTM7 knockdown increases tumorigenicity of human non-small cell lung cancer cells and EGFR-AKT signaling by reducing Rab5 activation.Oncotarget. 2015; 6: 41092-41107Crossref PubMed Scopus (37) Google Scholar). CMTM3 and CMTM4 mediate cell-cell adhesion by involvement in VE-cadherin turnover, and this process is involved in the regulation of angiogenesis (9Chrifi I. Louzao-Martinez L. Brandt M. van Dijk C.G.M. Burgisser P. Zhu C. Kros J.M. Duncker D.J. Cheng C. CMTM3 (CKLF-Like Marvel Transmembrane Domain 3) Mediates angiogenesis by regulating cell surface availability of VE-Cadherin in endothelial adherensjunctions.Arterioscler. Thromb. Vasc. Biol. 2017; 37: 1098-1114Crossref PubMed Scopus (19) Google Scholar, 10Chrifi I. Louzao-Martinez L. Brandt M.M. van Dijk C.G.M. Bürgisser P.E. Zhu C. Kros J.M. Verhaar M.C. Duncker D.J. Cheng C. CMTM4 regulates angiogenesis by promoting cell surface recycling of VE-cadherin to endothelial adherens junctions.Angiogenesis. 2019; 22: 75-93Crossref PubMed Scopus (46) Google Scholar). CMTM3 and CMTM7 also initiate B-cell linker (BLNK)-mediated signal transduction (11Imamura Y. Katahira T. Kitamura D. Identification and characterization of a novel BASH N terminus-associated protein, BNAS2.J. Biol. Chem. 2004; 279: 26425-26432Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 12Miyazaki A. Yogosawa S. Murakami A. Kitamura D. Identification of CMTM7 as a transmembrane linker of BLNK and the B-cell receptor.PLoS One. 2012; 7: e31829Crossref PubMed Scopus (29) Google Scholar). CMTM6 and CMTM4 have been identified as programmed death-1 (PD-L1) regulators that inhibit immune function (13Mezzadra R. Sun C. Jae L.T. Gomez-Eerland R. de Vries E. Wu W. Logtenberg M.E.W. Slagter M. Rozeman E.A. Hofland I. Broeks A. Horlings H.M. Wessels L.F.A. Blank C.U. Xiao Y. Heck A.J.R. Borst J. Brummelkamp T.R. Schumacher T.N.M. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators.Nature. 2017; 549: 106-110Crossref PubMed Scopus (372) Google Scholar, 14Burr M.L. Sparbier C.E. Chan Y.C. Williamson J.C. Woods K. Beavis P.A. Lam E.Y.N. Henderson M.A. Bell C.C. Stolzenburg S. Gilan O. Bloor S. Noori T. Morgens D.W. Bassik M.C. Neeson P.J. Behren A. Darcy P.K. Dawson S.J. Voskoboinik I. Trapani J.A. Cebon J. Lehner P.J. Dawson M.A. CMTM6 maintains the expression of PD-L1 and regulates anti-tumour immunity.Nature. 2017; 549: 101-105Crossref PubMed Scopus (456) Google Scholar). These studies showed that the CMTM family has important regulatory effects on the trafficking, degradation, and signal transduction of membrane molecules. Interestingly, CMTM1, CMTM2, and CMTM4 are highly expressed in the human testis, implying biological roles in male reproduction (2Han W. Ding P. Xu M. Wang L. Rui M. Shi S. Liu Y. Zheng Y. Chen Y. Yang T. Ma D. Identification of eight genes encoding chemokine-like factor superfamily members 1–8 (CKLFSF1–8) by in silico cloning and experimental validation.Genomics. 2003; 81: 609-617Crossref PubMed Scopus (149) Google Scholar). CMTM1 is predominantly expressed in the human testis, with at least 23 alternative splicing isoforms (15Wang L. Wu C. Zheng Y. Qiu X. Wang L. Fan H. Han W. Lv B. Wang Y. Zhu X. Xu M. Ding P. Cheng S. Zhang Y. Song Q. Ma D. Molecular cloning and characterization of chemokine-like factor super family member 1 (CKLFSF1), a novel human gene with at least 23 alternative splicing isoforms in testis tissue.Int. J. Biochem. Cell Biol. 2004; 36: 1492-1501Crossref PubMed Scopus (30) Google Scholar). However, Cmtm1 knockout (KO) has no significant influence on male fertility (16Fujihara Y. Oji A. Kojima-Kita K. Larasati T. Ikawa M. Coexpression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice.J. Cell Sci. 2018; 131: jcs221481Crossref PubMed Scopus (20) Google Scholar). CMTM2 is highly expressed in the testis and is closely correlated with spermatogenic defects (17Shi S. Rui M. Han W. Wang Y. Qiu X. Ding P. Zhang P. Zhu X. Zhang Y. Gan Q. Ma D. CKLFSF2 is highly expressed in testis and can be secreted into the seminiferous tubules.Int. J. Biochem. Cell Biol. 2005; 37: 1633-1640Crossref PubMed Scopus (41) Google Scholar, 18Liu G. Xin Z.C. Chen L. Tian L. Yuan Y.M. Song W.D. Jiang X.J. Guo Y.L. Expression and localization of CKLFSF2 in human spermatogenesis.Asian. J. Androl. 2007; 9: 189-198Crossref PubMed Scopus (22) Google Scholar). Its two homologs in the mouse, Cmtm2a and Cmtm2b, serve as androgen receptor corepressor and enhancer, respectively (19Jeong B.C. Hong C.Y. Chattopadhyay S. Park J.H. Gong E.Y. Kim H.J. Chun S.Y. Lee K. Androgen receptor corepressor-19 kDa (ARR19), a leucine-rich protein that represses the transcriptional activity of androgen receptor through recruitment of histone deacetylase.Mol. Endocrinol. 2004; 18: 13-25Crossref PubMed Scopus (56) Google Scholar, 20Qamar I. Gong E.Y. Kim Y. Song C.H. Lee H.J. Chun S.Y. Lee K. Anti-steroidogenic factor ARR19 inhibits testicular steroidogenesis through the suppression of Nur77 transactivation.J. Biol. Chem. 2010; 285: 22360-22369Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar, 21Qamar I. Ahmad M.F. Narayanasamy A. A time-course study of long term over-expression of ARR19 in mice.Sci. Rep. 2015; 5: 13014Crossref PubMed Scopus (4) Google Scholar, 22Li T. Han W. Yang T. Ding P. Rui M. Liu D. Wang Y. Ma D. Molecular cloning and identification of mouse Cklfsf2a and Cklfsf2b, two homologues of human CKLFSF2.Int. J. Biochem. Cell Biol. 2006; 38: 420-429Crossref PubMed Scopus (20) Google Scholar). Coexpression of Cmtm2a and Cmtm2b is essential for male fertility in mice (16Fujihara Y. Oji A. Kojima-Kita K. Larasati T. Ikawa M. Coexpression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice.J. Cell Sci. 2018; 131: jcs221481Crossref PubMed Scopus (20) Google Scholar). These findings indicate that CMTM family members may play important roles in spermatogenesis or testicular development. chemokine-like factor knockout wild type CKLF-like MARVEL transmembrane domain-containing family transmembrane 4 superfamily B-cell linker one-way analysis of variance isobaric tags for relative and absolute quantification false discovery rate gene ontology epidermal growth factor receptor programmed death-1 obstructive azoospermia non-obstructive azoospermia clustered regularly interspaced short palindromic repeats CRISPR-associated protein 9 single guide RNAs polymerase chain reaction human choionic gonadotrophin pregnant mare serum gonadotrophin phosphate buffered saline bovine serum albumin dimethyl sulfoxide immunohistochemistry computer-aided sperm analysis daily sperm production triethylammonium bicarbonate dithiothreitol reversed-phase liquid chromatograph mass spectrometer database for annotation, visualization and integrated discovery sodium dodecyl sulphate polyacrylamide gel electrophoresis Tris–buffered saline horseradish peroxidase enhanced chemiluminescence integrated optical density 3,3′-diaminobenzidine untranslated region coding sequence polymerase chain reaction in vitro fertilization straight line velocity curvilinear velocity gene expression omnibus androgen receptor. chemokine-like factor knockout wild type CKLF-like MARVEL transmembrane domain-containing family transmembrane 4 superfamily B-cell linker one-way analysis of variance isobaric tags for relative and absolute quantification false discovery rate gene ontology epidermal growth factor receptor programmed death-1 obstructive azoospermia non-obstructive azoospermia clustered regularly interspaced short palindromic repeats CRISPR-associated protein 9 single guide RNAs polymerase chain reaction human choionic gonadotrophin pregnant mare serum gonadotrophin phosphate buffered saline bovine serum albumin dimethyl sulfoxide immunohistochemistry computer-aided sperm analysis daily sperm production triethylammonium bicarbonate dithiothreitol reversed-phase liquid chromatograph mass spectrometer database for annotation, visualization and integrated discovery sodium dodecyl sulphate polyacrylamide gel electrophoresis Tris–buffered saline horseradish peroxidase enhanced chemiluminescence integrated optical density 3,3′-diaminobenzidine untranslated region coding sequence polymerase chain reaction in vitro fertilization straight line velocity curvilinear velocity gene expression omnibus androgen receptor. CMTM4 is the most conserved member of the CMTM family, and forms a gene cluster with CKLF and CMTM1–3 on chromosome 16q22.1 (2Han W. Ding P. Xu M. Wang L. Rui M. Shi S. Liu Y. Zheng Y. Chen Y. Yang T. Ma D. Identification of eight genes encoding chemokine-like factor superfamily members 1–8 (CKLFSF1–8) by in silico cloning and experimental validation.Genomics. 2003; 81: 609-617Crossref PubMed Scopus (149) Google Scholar). Our previous studies showed higher expression of CMTM4 in the testis than in other tissues (2Han W. Ding P. Xu M. Wang L. Rui M. Shi S. Liu Y. Zheng Y. Chen Y. Yang T. Ma D. Identification of eight genes encoding chemokine-like factor superfamily members 1–8 (CKLFSF1–8) by in silico cloning and experimental validation.Genomics. 2003; 81: 609-617Crossref PubMed Scopus (149) Google Scholar, 23Plate M. Li T. Wang Y. Mo X. Zhang Y. Ma D. Han W. Identification and characterization of CMTM4, a novel gene with inhibitory effects on HeLa cell growth through Inducing G2/M phase accumulation.Mol. Cells. 2010; 29: 355-361Crossref PubMed Scopus (38) Google Scholar), which warrants exploration of its significance in male reproduction. Given its sequence structure and expression characteristics, CMTM4 might also play crucial roles in male fertility as do CMTM2 (16Fujihara Y. Oji A. Kojima-Kita K. Larasati T. Ikawa M. Coexpression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice.J. Cell Sci. 2018; 131: jcs221481Crossref PubMed Scopus (20) Google Scholar, 17Shi S. Rui M. Han W. Wang Y. Qiu X. Ding P. Zhang P. Zhu X. Zhang Y. Gan Q. Ma D. CKLFSF2 is highly expressed in testis and can be secreted into the seminiferous tubules.Int. J. Biochem. Cell Biol. 2005; 37: 1633-1640Crossref PubMed Scopus (41) Google Scholar). Previous studies have indicated that CMTM4 acts as a tumor suppressor through its involvement in cell growth and cell cycle regulation (4Li T. Cheng Y. Wang P. Wang W. Hu F. Mo X. Lv H. Xu T. Han W. CMTM4 is frequently downregulated and functions as a tumour suppressor in clear cell renal cell carcinoma.J. Exp. Clin. Cancer Res. 2015; 34: 122Crossref PubMed Scopus (40) Google Scholar, 23Plate M. Li T. Wang Y. Mo X. Zhang Y. Ma D. Han W. Identification and characterization of CMTM4, a novel gene with inhibitory effects on HeLa cell growth through Inducing G2/M phase accumulation.Mol. Cells. 2010; 29: 355-361Crossref PubMed Scopus (38) Google Scholar, 24Bei C. Zhang Y. Wei R. Zhu X. Wang Z. Zeng W. Chen Q. Tan S. Clinical significance of CMTM4 expression in hepatocellular carcinoma.Onco Targets Ther. 2017; 10: 5439-5443Crossref PubMed Scopus (25) Google Scholar). However, its roles in male reproduction remain unknown. In the present study, we first assessed the expression of CMTM4 in the spermatozoa and testes of patients with male infertility to characterize its association with spermatogenesis and sperm quality. Because the amino acid sequences are highly homologous between human and mouse CMTM4, the functions of CMTM4 in male fertility were examined in a KO mouse model, and the underlying mechanism was investigated using isobaric tags for relative and absolute quantification (iTRAQ)-based proteomics. Consistent with the association of CMTM4 expression with sperm quality in patients, Cmtm4 KO mice showed male subfertility with phenotypes of decreased sperm motility and aberrant acrosome reaction. Gene ontology (GO) term analysis revealed that proteins downregulated in KO mice testis and spermatozoa compared with wild-type (WT) were mainly involved in spermatogenesis and sperm functions including motility, the acrosome reaction, and histone-to-protamine exchange. This study also provided in-depth proteomic mapping of the mouse testis and sperm that will facilitate to understand of spermatogenesis and sperm functions. Combining phenotypic characteristics and proteomic analyses of Cmtm4 KO mice, we have shown that CMTM4 plays key roles in regulating sperm function and male fertility by affecting sperm motility and the acrosome reaction. The present study was approved by the Medical Ethical Committee of the YuHuangDing hospital and all participants provided written informed consent. All experiments were performed in accordance with the guidelines provided by YuHuangDing hospital. All animal experiments were carried out in according with the guidelines of the care and use of laboratory animals. All mice were kept under light/dark cycles of 12/12 h with free access to food and water. Samples of human semen were collected from the YuHuangDing hospital, and were classified into four groups without leukocytospermia as follows: the normozoospermia group (24–37 years old, sperm count >39 × 106, progressive motile spermatozoa >40%), asthenozoospermia group (27–36 years old, progressive motile spermatozoa <32%), oligoasthenozoospermia group (27–39 years old, sperm count <39 × 106, progressive motile spermatozoa <32%), and teratozoospermia (27–40 years old, normal morphology <4%). Young testes were obtained from five young fathers (23–27 years old) who died in car accidents, had no history of pathology that could affect reproductive function, and had previously indicated a willingness to donate their bodies to medical research. Donations of their organs for medical research were approved by their immediate family members. Aged testes samples were obtained from five elderly fathers (70–74 years old) who were prostate cancer patients with no anti-androgen treatment before orchiectomy and who had given written informed consent. All procedures were approved by the Ethics Committee of YuHuangDing Hospital. A total of 25 patients with azoospermia (26–37 years old) who underwent surgical testicular sperm extraction were recruited and divided into the obstructive azoospermia (OA) group (n = 5) and the nonobstructive azoospermia (NOA) group (n = 20). In OA, spermatozoa were produced normally inside the testicle, whereas in NOA, spermatogenesis problems were observed with a very low level of sperm production or a total lack of production. Patients with abnormal karyotypes and those who had previously suffered from an injury to the genitals were excluded. Human testicular quality was evaluated by the modified Johnsen score according to our previous studies (25Bergmann M. Kliesch S. Hodenbiopsie.in: Krause W Weidner W Andrologie. Enke Verlag, Stuttgart1998: 66-71Google Scholar, 26Liu F.J. Liu X. Han J.L. Wang Y.W. Jin S.H. Liu X.X. Liu J. Wang W.T. Wang W.J. Aged men share the sperm protein PATE1 defect with young asthenozoospermia patients.Hum. Reprod. 2015; 30: 861-869Crossref PubMed Scopus (32) Google Scholar). Human sperm samples exhibiting normozoospermia, asthenozoospermia, oligoasthenozoospermia, and teratozoospermia were collected for protein extraction. As in our previous reports (26Liu F.J. Liu X. Han J.L. Wang Y.W. Jin S.H. Liu X.X. Liu J. Wang W.T. Wang W.J. Aged men share the sperm protein PATE1 defect with young asthenozoospermia patients.Hum. Reprod. 2015; 30: 861-869Crossref PubMed Scopus (32) Google Scholar), after centrifugation at 800 × g for 20 min at 4 °C in a 50% step Percoll gradient in phosphate buffered saline (PBS) media, the seminal plasma and other contaminating cells in semen were removed. Sperm pellets were dissolved in lysis solution and sonicated for three times at 5 s intervals. Then they were kept at 4 °C for 2 h before the solution was centrifuged at 12,000 × g for 45 min, and the supernatant was collected. After determination of protein concentration, protein samples were stored at −80 °C. CRISPR-Cas9 constructs were synthesized as described previously (27Wang Y. Ding Y. Li J. CRISPR-Cas9-Mediated Gene Editing in Mouse Spermatogonial Stem Cells.Methods. Mol. Biol. 2017; 1622: 293-305Crossref PubMed Scopus (10) Google Scholar). Briefly, Cas9 mRNA was synthesized in vitro from linear DNA templates by using the mMESSAGE mMACHINE T7 Ultra kit (Thermo Fisher Scientific Inc, CA) according to the manufacturer's instructions. DNA templates for single guide RNAs (sgRNAs) were also synthesized in vitro by polymerase chain reaction (PCR); RNA was synthesized from these templates with a MEGA shortscript T7 kit (Thermo Fisher Scientific) according to the manufacturer's instructions. The constructs were diluted with RNase-free injection buffer (0.25 mm EDTA, 10 mm Tris at pH 7.4) before microinjection. The following sequence information was used for sgRNA synthesis: sgRNA#1: AGCGCGCCGCGCAGGTAGTC; sgRNA#2: GAGGAGCTGGACGGCTTCGA. CRISPR-Cas9 constructs and sgRNAs were microinjected into fertilized C57BL/6J oocytes. Knockout of Cmtm4 was confirmed by Sanger sequencing. Genotypes were confirmed by the PCR with the following primers Cmtm4, forward primer: 5′-GGTCTGGGCCTTTCCTTGC-3′, reverse primer: 5′-GCCCAAGGACCTCGGAGTA-3′; Gapdh was internal control, Gapdh, forward primer: 5′-CACTCATTGCCCCCGTGTTT-3′, reverse primer: 5′-GTCAGGTTTCCCATCCCCACATA-3′. PCR was performed as follows: denaturation at 98 °C for 2 min, 30 cycles of 98 °C for 10 s, 62 °C for 10 s and 72 °C for 50 s; extension at 72 °C for 5 min. Electrophoresis was conducted on 1.2% (w/v) agarose gels and visualized with a Bio-Rad ChemiDOC MP system (Bio-Rad, Hercules, CA 94547). To assess fertility and fecundity, one littermate male (6 weeks old) was placed in cages with two mature WT females for two months or more. Two littermate females were caged with a WT fertile male for the same period. The number of female mice achieving pregnancy and the number of offspring were recorded. Mouse sperm suspensions were prepared by mincing the cauda epididymidis of a mature male mouse (WT or KO) in 1 ml IVF medium for about 1 h. Part of this sperm suspension was divided into 30 μl pellets using a micropipette in a plastic culture dish (35 mm × 11 mm) covered with paraffin oil, and the rest was treated by 10 μm calcium ionophore A23187 (Sigma-Aldrich, St. Louis, MO) for assessing the induction of the acrosome reaction. Mature female mice (WT or KO) were induced to super-ovulate by i.p. injection of 10 i.u. pregnant mare serum gonadotrophin (PMSG) and human chorionic gonadotrophin (hCG) 48 h apart. The oocytes were recovered from the oviducts 14 h after injection of hCG and were introduced into each sperm suspension. The sperm concentration was counted by using improved-Neubauer counting chamber, and at least 200 cells were counted. About 106 spermatozoa/ml was used for insemination. The development stage and morphology of embryos were recorded at 24 h interval after zygote collection. Epididymal spermatozoa was collected from the caudal part of the epididymis. The cauda epididymidis was placed in PBS supplemented with 10% (w/v) bovine serum albumin (BSA) and cut into small pieces followed by incubation on a warming metal plate at 35 °C for 5 min. Sperm motility was measured with Computer-aided Semen Analysis system (CASA) System (Medealab™, Erlangen, Germany). For each sample, 12 fields were examined. To evaluate the acrosome reaction, spermatozoa were suspended in Biggers-Whitten-Whittingham (BWW) and incubated at 37 °C, 5% CO2 for 3 h to get capacitation. Capacitated sperm was exposed to vehicle alone (DMSO, dimethyl sulfoxide) or calcium ionophore A23187 (10 μm) for 30 min, subjected to Coomassie brilliant blue staining (2% w/v G250) for 3 min, and then washed with PBS three times before mounting on slides for observation. Four hundred spermatozoa were evaluated under a light microscope (×400). Spermatozoa were scored as acrosome-intact when a bright blue staining was observed in the dorsal region of the head or as acrosome-reacted when no labeling was observed. DSP was estimated according to a previous report (28VomSaal F.S. Cooke P.S. Buchanan D.L. Palanza P. Thayer K.A. Nagel S.C. Parmigiani S. Welshons W.V. A physiologically based approach to the study of bisphenol A and other estrogenic chemicals on the size of reproductive organs, daily sperm production, and behavior.Toxicol. Ind. Health. 1998; 14: 239-260Crossref PubMed Scopus (664) Google Scholar). Briefly, after the testes were crushed in 600 μl SMT solution containin
Referência(s)