Portal de Periódicos da CAPES

First Report of Ergot ( Claviceps purpurea ) on Canary Grass ( Phalaris canariensis ) in Saskatchewan, Canada

2019; American Phytopathological Society; Volume: 103; Issue: 10 Linguagem: Inglês

10.1094/pdis-11-18-2083-pdn

1943-7692

L. P. Cholango-Martinez, Jake Halliday, P. Hucl, H. R. Kutcher,

Turfgrass Adaptation and Management

HomePlant DiseaseVol. 103, No. 10First Report of Ergot (Claviceps purpurea) on Canary Grass (Phalaris canariensis) in Saskatchewan, Canada PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Ergot (Claviceps purpurea) on Canary Grass (Phalaris canariensis) in Saskatchewan, CanadaL. P. Cholango-Martinez, J. R. Halliday, P. J. Hucl, and H. R. KutcherL. P. Cholango-Martinez†Corresponding author: L. P. Cholango-Martinez; E-mail Address: [email protected]http://orcid.org/0000-0003-3945-6972Crop Development Centre/Department of Plant Science, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada, J. R. HallidayCrop Development Centre/Department of Plant Science, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada, P. J. HuclCrop Development Centre/Department of Plant Science, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada, and H. R. Kutcherhttp://orcid.org/0000-0002-3432-4535Crop Development Centre/Department of Plant Science, University of Saskatchewan, Saskatoon, SK S7N 5A8, CanadaAffiliationsAuthors and Affiliations L. P. Cholango-Martinez † J. R. Halliday P. J. Hucl H. R. Kutcher Crop Development Centre/Department of Plant Science, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada Published Online:25 Jul 2019https://doi.org/10.1094/PDIS-11-18-2083-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Canary grass (Phalaris canariensis L.) belongs to the Poaceae family and is used mainly for bird feed, although efforts are underway to improve its quality for human consumption. Saskatchewan, Canada, is the main producer and exporter of canary grass. Claviceps purpurea (Fr.) Tul. infects unfertilized ovaries of cereal crops, resulting in ergot of rye (Secale cereale), wheat (Triticum aestivum), durum (Triticum durum), and approximately 400 species of grasses (Taber 1985). The presence of ergot sclerotia in grain can reduce yield and flour quality owing to the alkaloids present, which are toxic to livestock and humans. During the 2016 to 2017 season a survey was conducted, and sclerotia were observed in canary grass fields. Sclerotia present on canary grass panicles appeared dark brown to black, straight to slightly curved, and were more prominent late in the growing season (August). The sclerotia were surface sterilized in 5% bleach (NaOCl) solution for 1 min and rinsed three times in sterile water, plated on potato dextrose agar, and placed under a 12-h light/dark regime at room temperature (23°C). Claviceps spp. colonies were isolated for identification. Molecular identification was based on the genomic DNA (gDNA) sequencing of the DNA replication licensing factor (McM7) gene of Claviceps spp. (Pažoutová et al. 2015). gDNA was extracted from three 7-day-old single-spore cultures using the DNeasy Plant Mini Kit (Qiagen). A 434-base pair (bp) fragment of the McM7 gene was amplified using primers McM7-F (GGCTCACTACATTCGTCAACAC) and McM7-R (AGCAAATGCCATTGTCAGC), further confirming that the gDNA was from C. purpurea. PCR reactions were conducted in a C1000 Thermocycler (Bio‐Rad, Hercules, CA): initial denaturation cycle for 3 min at 95°C; 34 cycles of 45 s at 95°C, 30 s at 55°C, and 1.5 min at 72°C; and a final extension cycle for 10 min at 72°C. The reaction mixture consisted of 1.25 U/µl of Taq DNA polymerase, 10× PCR buffer, 2.5 mM of MgCl2, 0.2 mM of each deoxynucleotide (dNTP), 1 µM of each of the primers, and approximately 2 ng/µl of gDNA in a total PCR reaction volume of 25 µl. Further diagnostic information was obtained by sequencing the purified PCR products using Mcm7-F and McM7-R as the sequencing primers. The resulting sequences for the three isolates were used to BLAST query the GenBank database (National Center for Biotechnology Information) and resulted in 99% (EliasN6), 98% (EliasN8), and 98% (PI) similarity with Claviceps purpurea var. spartinae Mcm7 gene (JX083599.1). The accession numbers for three isolates were submitted to GenBank (MK942051, MK942052, and MK942053). The isolate EliasN6 and cultivar Keet were chosen for Koch's postulates. Canary grass plants were grown at 22/18°C day/night and a 16-h photoperiod. Inoculum was produced in potato dextrose broth incubated for 2 weeks at 22°C and 16 h/8 h light/dark (Menzies 2004). Conidial concentration was determined by hemocytometer and adjusted to 1 × 104/ml. Twenty-four panicles were inoculated at anthesis (BBCH 65). Five to 8 days after inoculation (dai), small yellowish-white drops of honeydew were observed in some florets, and this increased over time. One to six sclerotia per head were observed 21 dai, ranging in size from 0.6 to 1 cm. Sclerotia were plated, and C. purpurea was reisolated from inoculated panicles. Identification of canary grass as a host of C. purpurea has implications for ergot management. Additional research is necessary to improve our understanding of this pathogen in canary grass.The author(s) declare no conflict of interest.References:Menzies, J. G. 2004. Can. J. Plant Sci. 84:625. https://doi.org/10.4141/P03-086 Crossref, ISI, Google ScholarPažoutová, S., et al. 2015. Fungal Biol. 119:7. https://doi.org/10.1016/j.funbio.2014.10.003 Crossref, ISI, Google ScholarTaber, W. A. 1985. Page 449 in: Biology of Industrial Microorganisms. Benjamin Cummings Publishing, New York, NY. Google ScholarThe author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 103, No. 10 October 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionBell pepper cv. Bomby infected with zucchini yellow mosaic virus along with cucumber mosaic virus, pepper mild mottle virus, and tobacco mosaic virus (Verma et al.). Photo credit: S. Tripathi. Severe stunting, leaf chlorosis, and horizontal head growth of sunflower infected with Plasmopara halstedii, causal agent of downy mildew (Humann et al.). Photo credit: S. Markell. Metrics Article History Issue Date: 3 Oct 2019Published: 25 Jul 2019First Look: 30 May 2019Accepted: 26 May 2019 Page: 2682 Information© 2019 The American Phytopathological SocietyKeywordsergotcanary seedfield cropscereals and grainsThe author(s) declare no conflict of interest.Cited byErgot in Canadian cereals – relevance, occurrence, and current status6 June 2022 | Canadian Journal of Plant Pathology, Vol. 44, No. 6Phalaris canariensis (canary grass)CABI Compendium, Vol. CABI CompendiumClaviceps purpurea (ergot)CABI Compendium, Vol. CABI CompendiumMolecular and Alkaloid Characterization of Claviceps purpurea Sensu Lato From Grass Seed Production Areas of the U.S. Pacific NorthwestJeremiah K. S. Dung, Jennifer M. Duringer, Navneet Kaur, Jeness C. Scott, Kenneth E. Frost, Darrin L. Walenta, Stephen C. Alderman, A. Morrie Craig, and Philip B. Hamm21 April 2021 | Phytopathology®, Vol. 111, No. 5